FUCA2 | GeneID:2519 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2519 Official Symbol FUCA2
Locus RP1-20N2.5 Gene Type protein-coding
Synonyms MGC1314; dJ20N2.5
Full Name fucosidase, alpha-L- 2, plasma
Description fucosidase, alpha-L- 2, plasma
Chromosome 6q24
Also Known As OTTHUMP00000017331
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 119

ID Symbol Protein Species
GeneID:2519 FUCA2 NP_114409.2 Homo sapiens
GeneID:66848 Fuca2 NP_080075.2 Mus musculus
GeneID:189173 W03G11.3 NP_510020.2 Caenorhabditis elegans
GeneID:292485 Fuca2 NP_001004218.1 Rattus norvegicus
GeneID:421668 FUCA2 XP_419707.2 Gallus gallus
GeneID:445487 zgc:92013 NP_001004115.1 Danio rerio
GeneID:463039 FUCA2 XP_518777.2 Pan troglodytes
GeneID:484016 FUCA2 XP_541133.2 Canis lupus familiaris
GeneID:515729 FUCA2 XP_593801.2 Bos taurus
GeneID:1269881 AgaP_AGAP007285 XP_308535.2 Anopheles gambiae
GeneID:3772566 CG11714 NP_648472.1 Drosophila melanogaster

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab69956 FUCA2 antibody (ab69956); Mouse polyclonal to FUCA2
2 abgent AP7646a FUCA2 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
3 abgent AP7646b FUCA2 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
4 abnova H00002519-M03 FUCA2 monoclonal antibody (M03), clone 1D2; Mouse monoclonal antibody raised against a partial recombinant FUCA2.
5 acris AP14357PU-N FUCA2 (C-term); antibody Ab
6 acris AP14356PU-N FUCA2 (N-term); antibody Ab
7 scbt FUCA2 FUCA2 Antibody / FUCA2 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of FUCA2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FUCA2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005576 Component extracellular region
GO:0004560 Function alpha-L-fucosidase activity
GO:0043169 Function cation binding
GO:0016798 Function hydrolase activity, acting on glycosyl bonds
GO:0005975 Process carbohydrate metabolic process
GO:0006004 Process fucose metabolic process
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_032020  UCSC Browser NP_114409

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000002165 MI0000060 hsa-let-7a* CUAUACAAUCUACUGUCUUUC
ENST00000002165 MI0000062 hsa-let-7a* CUAUACAAUCUACUGUCUUUC
ENST00000002165 MI0000063 hsa-let-7b* CUAUACAACCUACUGCCUUCCC
ENST00000002165 MI0000068 hsa-let-7f-2* CUAUACAGUCUACUGUCUUUCC
ENST00000002165 MI0000103 hsa-miR-101 UACAGUACUGUGAUAACUGAA
ENST00000002165 MI0000739 hsa-miR-101 UACAGUACUGUGAUAACUGAA
ENST00000002165 MI0000448 hsa-miR-130a* UUCACAUUGUGCUACUGUCUGC
ENST00000002165 MI0000449 hsa-miR-132 UAACAGUCUACAGCCAUGGUCG
ENST00000002165 MI0000475 hsa-miR-136 ACUCCAUUUGUUUUGAUGAUGGA
ENST00000002165 MI0000458 hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
ENST00000002165 MI0000460 hsa-miR-144 UACAGUAUAGAUGAUGUACU
ENST00000002165 MI0000461 hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENST00000002165 MI0000070 hsa-miR-16-1* CCAGUAUUAACUGUGCUGCUGA
ENST00000002165 MI0000483 hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCU
ENST00000002165 MI0000288 hsa-miR-212 UAACAGUCUCCAGUCACGGCC
ENST00000002165 MI0000089 hsa-miR-31* UGCUAUGCCAACAUAUUGCCAU
ENST00000002165 MI0000814 hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG
ENST00000002165 MI0001145 hsa-miR-384 AUUCCUAGAAAUUGUUCAUA
ENST00000002165 MI0003186 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA
ENST00000002165 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENST00000002165 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000002165 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000002165 MI0003557 hsa-miR-552 AACAGGUGACUGGUUAGACAA
ENST00000002165 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENST00000002165 MI0003581 hsa-miR-574-3p CACGCUCAUGCACACACCCACA
ENST00000002165 MI0003595 hsa-miR-587 UUUCCAUAGGUGAUGAGUCAC
ENST00000002165 MI0003760 hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC
ENST00000002165 MI0000263 hsa-miR-7-1* CAACAAAUCACAGUCUGCCAUA
ENST00000002165 MI0005767 hsa-miR-942 UCUUCUCUGUUUUGGCCAUGUG
ENST00000002165 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU
ENST00000002165 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENST00000002165 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENST00000002165 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Carbon Tetrachloride
  • Carbon Tetrachloride affects the expression of FUCA2 mRNA
17484886
Ethinyl Estradiol
  • Ethinyl Estradiol results in increased expression of FUCA2 mRNA
17557909
pirinixic acid
  • pirinixic acid results in increased expression of FUCA2 mRNA
17426115
Tunicamycin
  • Tunicamycin results in decreased expression of FUCA2 mRNA
17127020

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 17681005, 16105132, 15861022, 11677210, 17333356, 16919318
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16050911, 15673190, 15700767, 16124888, 16227642, 10355542, 16011737, 16097048
Fatty Liver inferred via Carbon Tetrachloride 16045604, 16239168, 15959796, 12795759, 61145, 12631006, 17595544
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 16177239, 11566570, 15968718, 15027814, 16227642, 15998439
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 17334410, 16239168
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 17557913, 15052691, 12632512, 17766677, 18418968, 12666154, 16638106, 18395095, 18156304, 17976157, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 17805973, 16116963, 15925388, 16248980, 17525996
Liver Diseases inferred via Carbon Tetrachloride 16246199, 16964402, 17285989, 15830285, 15720792
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Shah M, et al. (2008) "Serum fucosylation changes in oral cancer and oral precancerous conditions: alpha-L-fucosidase as a marker." Cancer. 113(2):336-346. PMID:18521898
  2. [ + ] Otsuki T, et al. (2005) "Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries." DNA Res. 12(2):117-126. PMID:16303743
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Clark HF, et al. (2003) "The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment." Genome Res. 13(10):2265-2270. PMID:12975309
  5. [ + ] Mungall AJ, et al. (2003) "The DNA sequence and analysis of human chromosome 6." Nature. 425(6960):805-811. PMID:14574404
  6. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  7. [ + ] Cordero OJ, et al. (2001) "Cell surface human alpha-L-fucosidase." Eur J Biochem. 268(11):3321-3331. PMID:11389735
  8. [ + ] Narahara K, et al. (1991) "Specification of small distal 6q deletions in two patients by gene dosage and in situ hybridization study of plasminogen and alpha-L-fucosidase 2." Am J Med Genet. 40(3):348-353. PMID:1951444
  9. [ + ] O'Brien JS, et al. (1987) "Molecular biology of the alpha-L-fucosidase gene and fucosidosis." Enzyme. 38(1-4):45-53. PMID:2894306
  10. [ + ] Eiberg H, et al. (1984) "Linkage of plasma alpha-L-fucosidase (FUCA2) and the plasminogen (PLG) system." Clin Genet. 26(1):23-29. PMID:6590153