Aanat | GeneID:25120 | Rattus norvegicus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 25120 | Official Symbol | Aanat |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | AA-NAT; Nat4 | ||
| Full Name | arylalkylamine N-acetyltransferase | ||
| Description | arylalkylamine N-acetyltransferase | ||
| Chromosome | 10q32.3 | ||
| Also Known As | Arylalkylamine N - acetyltransferase (Serotonin N - acetyltransferase); Seretonin N-acetyltransferase; arylakylamine N-acetyltransferase | ||
| Summary | regulates melatonin biosynthesis; may play a role in circadian rhythm and response to photoperiod [RGD] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 31013
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:15 | AANAT | NP_001079.1 | Homo sapiens |
| GeneID:11298 | Aanat | NP_033721.1 | Mus musculus |
| GeneID:25120 | Aanat | NP_036950.1 | Rattus norvegicus |
| GeneID:281583 | AANAT | NP_803475.1 | Bos taurus |
| GeneID:393677 | aanat1 | NP_956998.1 | Danio rerio |
| GeneID:396066 | AANAT | NP_990489.1 | Gallus gallus |
| GeneID:483331 | AANAT | XP_540450.1 | Canis lupus familiaris |
| GeneID:503504 | AANAT | NP_001012442.1 | Pan troglodytes |
| GeneID:618594 | AANAT | XP_876019.2 | Bos taurus |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | acris | SP5279P | Serotonin acetylase pSer206; antibody Ab |
| 2 | acris | SP5278CP | Serotonin acetylase Control Peptide; antibody Ab/CP |
| 3 | acris | SP5279CP | Serotonin acetylase pSer206, Control Peptide; antibody Ab/CP |
| 4 | acris | SP5278P | Serotonin acetylase; antibody Ab |
| 5 | sigma | S0814 | Anti-phospho-Serotonin N-Acetyltransferase (N-Terminal) (pThr29) antibody produced in rabbit ; |
| 6 | sigma | S0939 | Anti-phospho-Serotonin N-Acetyltransferase (C-Terminal) (pSer206) antibody produced in rabbit ; |
| 7 | sigma | S0564 | Anti-Serotonin N-Acetyltransferase (N-Terminal) antibody produced in rabbit ; |
| 8 | sigma | S0689 | Anti-Serotonin N-Acetyltransferase (C-Terminal) antibody produced in rabbit ; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005737 | Component | cytoplasm |
| GO:0008415 | Function | acyltransferase activity |
| GO:0004059 | Function | aralkylamine N-acetyltransferase activity |
| GO:0004060 | Function | arylamine N-acetyltransferase activity |
| GO:0005184 | Function | neuropeptide hormone activity |
| GO:0016740 | Function | transferase activity |
| GO:0007623 | Process | circadian rhythm |
| GO:0043153 | Process | entrainment of circadian clock by photoperiod |
| GO:0030187 | Process | melatonin biosynthetic process |
| GO:0008152 | Process | metabolic process |
| GO:0009648 | Process | photoperiodism |
| GO:0051592 | Process | response to calcium ion |
| GO:0051591 | Process | response to cAMP |
| GO:0046688 | Process | response to copper ion |
| GO:0051412 | Process | response to corticosterone stimulus |
| GO:0034097 | Process | response to cytokine stimulus |
| GO:0032868 | Process | response to insulin stimulus |
| GO:0009416 | Process | response to light stimulus |
| GO:0014070 | Process | response to organic cyclic substance |
| GO:0034695 | Process | response to prostaglandin E stimulus |
| GO:0010043 | Process | response to zinc ion |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSRNOT00000015221 | MI0003600 | hsa-miR-550 | AGUGCCUGAGGGAGUAAGAGCCC |
| ENSRNOT00000015221 | MI0003601 | hsa-miR-550 | AGUGCCUGAGGGAGUAAGAGCCC |
| ENSRNOT00000015221 | MI0003662 | hsa-miR-647 | GUGGCUGCACUCACUUCCUUC |
| ENSRNOT00000015221 | MI0003665 | hsa-miR-650 | AGGAGGCAGCGCUCUCAGGAC |
| ENSRNOT00000015221 | MI0003670 | hsa-miR-662 | UCCCACGUUGUGGCCCAGCAG |
| ENSRNOT00000015221 | MI0005562 | hsa-miR-887 | GUGAACGGGCGCCAUCCCGAGG |
| ENSRNOT00000015221 | MI0005712 | hsa-miR-920 | GGGGAGCUGUGGAAGCAGUA |
| ENSRNOT00000015221 | MI0005755 | hsa-miR-933 | UGUGCGCAGGGAGACCUCUCCC |
| ENSRNOT00000015221 | MI0005756 | hsa-miR-934 | UGUCUACUACUGGAGACACUGG |
| ENSRNOT00000015221 | MI0005481 | mmu-miR-105 | CCAAGUGCUCAGAUGCUUGUGGU |
| ENSRNOT00000015221 | MI0005512 | mmu-miR-467c | UAAGUGCGUGCAUGUAUAUGUG |
| ENSRNOT00000015221 | MI0005513 | mmu-miR-467d | UAAGUGCGCGCAUGUAUAUGCG |
| ENSRNOT00000015221 | MI0002404 | mmu-miR-469 | UGCCUCUUUCAUUGAUCUUGGUGUCC |
| ENSRNOT00000015221 | MI0004680 | mmu-miR-491 | AGUGGGGAACCCUUCCAUGAGG |
| ENSRNOT00000015221 | MI0005554 | mmu-miR-511 | AUGCCUUUUGCUCUGCACUCA |
| ENSRNOT00000015221 | MI0004134 | mmu-miR-668 | UGUCACUCGGCUCGGCCCACUACC |
| ENSRNOT00000015221 | MI0005003 | mmu-miR-676 | CCGUCCUGAGGUUGUUGAGCU |
| ENSRNOT00000015221 | MI0004654 | mmu-miR-689 | CGUCCCCGCUCGGCGGGGUCC |
| ENSRNOT00000015221 | MI0004655 | mmu-miR-689 | CGUCCCCGCUCGGCGGGGUCC |
| ENSRNOT00000015221 | MI0004695 | mmu-miR-711 | GGGACCCGGGGAGAGAUGUAAG |
| ENSRNOT00000015221 | MI0004215 | mmu-miR-762 | GGGGCUGGGGCCGGGACAGAGC |
| ENSRNOT00000015221 | MI0000895 | rno-miR-125a-3p | ACAGGUGAGGUUCUUGGGAGCC |
| ENSRNOT00000015221 | MI0000637 | rno-miR-129 | CUUUUUGCGGUCUGGGCUUGC |
| ENSRNOT00000015221 | MI0000902 | rno-miR-129 | CUUUUUGCGGUCUGGGCUUGC |
| ENSRNOT00000015221 | MI0000647 | rno-miR-151* | CUAGACUGAGGCUCCUUGAGG |
| ENSRNOT00000015221 | MI0000947 | rno-miR-205 | UCCUUCAUUCCACCGGAGUCUG |
| ENSRNOT00000015221 | MI0000858 | rno-miR-26b* | CCUGUUCUCCAUUACUUGGCUC |
| ENSRNOT00000015221 | MI0000861 | rno-miR-28 | AAGGAGCUCACAGUCUAUUGAG |
| ENSRNOT00000015221 | MI0000596 | rno-miR-325-3p | UUUAUUGAGCACCUCCUAUCAA |
| ENSRNOT00000015221 | MI0000613 | rno-miR-336 | UCACCCUUCCAUAUCUAGUCU |
| ENSRNOT00000015221 | MI0003719 | rno-miR-378 | ACUGGACUUGGAGUCAGAAGG |
| ENSRNOT00000015221 | MI0006149 | rno-miR-463 | UGAUAGACGCCAAUUUGGGUAG |
| ENSRNOT00000015221 | MI0003485 | rno-miR-483 | UCACUCCUCCCCUCCCGUCUUGU |
| ENSRNOT00000015221 | MI0006154 | rno-miR-532-3p | CCUCCCACACCCAAGGCUUGCA |
| ENSRNOT00000015221 | MI0006155 | rno-miR-598-5p | GCGGUGAUGCCGAUGGUGCGAG |
| ENSRNOT00000015221 | MI0006160 | rno-miR-708 | AAGGAGCUUACAAUCUAGCUGGG |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Garcia RA, et al. (2008) "Insulin modulates norepinephrine-mediated melatonin synthesis in cultured rat pineal gland." Life Sci. 82(1-2):108-114. PMID:18048060 - [
] Bai L, et al. (2008) "Daily oscillation of gene expression in the retina is phase-advanced with respect to the pineal gland." Brain Res. 1203():89-96. PMID:18321474 - [
] Klein DC, et al. (2007) "Arylalkylamine N-acetyltransferase: "the Timezyme"." J Biol Chem. 282(7):4233-4237. PMID:17164235 - [
] Itoh MT, et al. (2007) "Expression and cellular localization of melatonin-synthesizing enzymes in the rat lens." J Pineal Res. 42(1):92-96. PMID:17198543 - [
] Humphries A, et al. (2007) "Rodent Aanat: intronic E-box sequences control tissue specificity but not rhythmic expression in the pineal gland." Mol Cell Endocrinol. 270(1-2):43-49. PMID:17363136 - [
] Wang GQ, et al. (2007) "Daily oscillation and photoresponses of clock gene, Clock, and clock-associated gene, arylalkylamine N-acetyltransferase gene transcriptions in the rat pineal gland." Chronobiol Int. 24(1):9-20. PMID:17364576 - [
] Kim TD, et al. (2007) "Rhythmic control of AANAT translation by hnRNP Q in circadian melatonin production." Genes Dev. 21(7):797-810. PMID:17403780 - [
] Mathes A, et al. (2007) "Daily profile in melanopsin transcripts depends on seasonal lighting conditions in the rat retina." J Neuroendocrinol. 19(12):952-957. PMID:18001324 - [
] Lee SY, et al. (2006) "Norepinephrine activates store-operated Ca2+ entry coupled to large-conductance Ca2+-activated K+ channels in rat pinealocytes." Am J Physiol Cell Physiol. 290(4):C1060-C1066. PMID:16282194 - [
] Ho AK, et al. (2006) "Opposite effects of proteasome inhibitors in the adrenergic induction of arylalkylamine N-acetyltransferase in rat pinealocytes." Chronobiol Int. 23(1-2):361-367. PMID:16687309 - [
] Koch M, et al. (2006) "Cannabinoids attenuate norepinephrine-induced melatonin biosynthesis in the rat pineal gland by reducing arylalkylamine N-acetyltransferase activity without involvement of cannabinoid receptors." J Neurochem. 98(1):267-278. PMID:16805813 - [
] Fernandes PA, et al. (2006) "Effect of TNF-alpha on the melatonin synthetic pathway in the rat pineal gland: basis for a 'feedback' of the immune response on circadian timing." J Pineal Res. 41(4):344-350. PMID:17014691 - [
] Kim TD, et al. (2005) "Rhythmic serotonin N-acetyltransferase mRNA degradation is essential for the maintenance of its circadian oscillation." Mol Cell Biol. 25(8):3232-3246. PMID:15798208 - [
] Chansard M, et al. (2005) "Regulation of cAMP-induced arylalkylamine N-acetyltransferase, Period1, and MKP-1 gene expression by mitogen-activated protein kinases in the rat pineal gland." Brain Res Mol Brain Res. 139(2):333-340. PMID:16024134 - [
] Terriff DL, et al. (2005) "Proteasomal proteolysis in the adrenergic induction of arylalkylamine-N-acetyltransferase in rat pinealocytes." Endocrinology. 146(11):4795-4803. PMID:16099857 - [
] Han S, et al. (2005) "Rhythmic expression of adenylyl cyclase VI contributes to the differential regulation of serotonin N-acetyltransferase by bradykinin in rat pineal glands." J Biol Chem. 280(46):38228-38234. PMID:16166080 - [
] Man JR, et al. (2004) "Inhibition of p38 mitogen-activated protein kinase enhances adrenergic-stimulated arylalkylamine N-acetyltransferase activity in rat pinealocytes." Endocrinology. 145(3):1167-1174. PMID:14617573 - [
] Engel L, et al. (2004) "Rat pineal arylalkylamine-N-acetyltransferase: cyclic AMP inducibility of its gene depends on prior entrained photoperiod." Brain Res Mol Brain Res. 123(1-2):45-55. PMID:15046865 - [
] Isobe Y, et al. (2004) "Signal transmission from the suprachiasmatic nucleus to the pineal gland via the paraventricular nucleus: analysed from arg-vasopressin peptide, rPer2 mRNA and AVP mRNA changes and pineal AA-NAT mRNA after the melatonin injection during light and dark periods." Brain Res. 1013(2):204-211. PMID:15193530 - [
] Choi BH, et al. (2004) "Protein kinase C regulates the activity and stability of serotonin N-acetyltransferase." J Neurochem. 90(2):442-454. PMID:15228600 - [
] Rekasi Z, et al. (2002) "Accumulation of rat pineal serotonin N-acetyltransferase mRNA induced by pituitary adenylate cyclase activating polypeptide and vasoactive intestinal peptide in vitro." J Mol Endocrinol. 28(1):19-31. PMID:11854096 - [
] Guillaumond F, et al. (2002) "Adrenergic inducibility of AP-1 binding in the rat pineal gland depends on prior photoperiod." J Neurochem. 83(1):157-166. PMID:12358739 - [
] Garidou ML, et al. (2001) "In vivo observation of a non-noradrenergic regulation of arylalkylamine N-acetyltransferase gene expression in the rat pineal complex." Neuroscience. 105(3):721-729. PMID:11516836 - [
] Zhan-Poe X, et al. (1999) "Biochemical characterization of recombinant serotonin N-acetyltransferase." J Pineal Res. 27(1):49-58. PMID:10451024 - [
] Baler R, et al. (1997) "The rat arylalkylamine N-acetyltransferase gene promoter. cAMP activation via a cAMP-responsive element-CCAAT complex." J Biol Chem. 272(11):6979-6985. PMID:9054387 - [
] Roseboom PH, et al. (1996) "Melatonin synthesis: analysis of the more than 150-fold nocturnal increase in serotonin N-acetyltransferase messenger ribonucleic acid in the rat pineal gland." Endocrinology. 137(7):3033-3045. PMID:8770929 - [
] Coon SL, et al. (1995) "Pineal serotonin N-acetyltransferase: expression cloning and molecular analysis." Science. 270(5242):1681-1683. PMID:7502081 - [
] Baler R, et al. (1995) "Circadian expression of transcription factor Fra-2 in the rat pineal gland." J Biol Chem. 270(45):27319-27325. PMID:7592994 - [
] Borjigin J, et al. (1995) "Diurnal variation in mRNA encoding serotonin N-acetyltransferase in pineal gland." Nature. 378(6559):783-785. PMID:8524412 - [
] Ritta MN, et al. (1981) "Prostaglandin E2 increases adenosine 3',5'-monophosphate concentration and binding-site occupancy, and stimulates serotonin-N-acetyltransferase activity in rat pineal glands in vitro." Mol Cell Endocrinol. 23(2):151-159. PMID:6268470
The mammalian pineal gland synthesizes melatonin in a circadian manner, peaking during the dark phase. This synthesis is primarily regulated by sympathetic innervations via noradrenergic fibers, but is also modulated by many peptidergic and hormonal systems. A growing number of studies reveal a complex role for melatonin in influencing various physiological processes, including modulation of insulin secretion and action. In contrast, a role for insulin as a modulator of melatonin synthesis has not been investigated previously. The aim of the current study was to determine whether insulin modulates norepinephrine (NE)-mediated melatonin synthesis. The results demonstrate that insulin (10(- 8)M) potentiated norepinephrine-mediated melatonin synthesis and tryptophan hydroxylase (TPOH) activity in ex vivo incubated pineal glands. When ex vivo incubated pineal glands were synchronized (12h NE-stimulation, followed by 12h incubation in the absence of NE), insulin potentiated NE-mediated melatonin synthesis and arylalkylamine-N-acetyltransferase (AANAT) activity. Insulin did not affect the activity of hydroxyindole-O-methyltranferase (HIOMT), nor the gene expression of tpoh, aanat, or hiomt, under any of the conditions investigated. We conclude that insulin potentiates NE-mediated melatonin synthesis in cultured rat pineal gland, potentially through post-transcriptional events.
The photoreceptive retina and the non-photoreceptive pineal gland are components of the circadian and the melatonin forming system in mammals. To contribute to our understanding of the functional integrity of the circadian system and the melatonin forming system we have compared the daily oscillation of the two tissues under various seasonal lighting conditions. For this purpose, the 24-h profiles of the expression of the genes coding for arylalkylamine N-acetyltransferase (AA-NAT), nerve growth factor inducible gene-A (NGFI-A), nerve growth factor inducible gene-B (NGFI-B), retinoic acid related orphan receptor beta (RORbeta), dopamine D4 receptor, and period2 (Per2) have been simultaneously recorded in the retina and the pineal gland of rats under short day (light/dark 8:16) and long day (light/dark 16:8) conditions. We have found that the cyclical patterns of all genes are phase-advanced in the retina, often with a lengthened temporal interval under short day conditions. In both tissues, the AA-NAT gene expression represents an indication of the output of the relevant pacemakers. The temporal phasing in the AA-NAT transcript amount between the retina and the pineal gland is retained under constant darkness suggesting that the intrinsic self-cycling clock of the retina oscillates in a phase-advanced manner with respect to the self-cycling clock in the suprachiasmatic nucleus, which controls the pineal gland. We therefore conclude that daily rhythms in gene expression in the retina are phase-advanced with respect to the pineal gland, and that the same temporal relationship appears to be valid for the self-cycling clocks influencing the tissues.
Arylalkylamine N-acetyltransferase controls daily changes in melatonin production by the pineal gland and thereby plays a unique role in biological timing in vertebrates. Arylalkylamine N-acetyltransferase is also expressed in the retina, where it may play other roles in addition to signaling, including neurotransmission and detoxification. Large changes in activity reflect cyclic 3',5'-adenosine monophosphate-dependent phosphorylation of arylalkylamine N-acetyltransferase, leading to formation of a regulatory complex with 14-3-3 proteins. This activates the enzyme and prevents proteosomal proteolysis. The conserved features of regulatory systems that control arylalkylamine N-acetyltransferase are a circadian clock and environmental lighting.
Melatonin (N-acetyl-5-methoxytryptamine) prevents oxidative stress-induced cataract development, and previous studies have suggested that the ocular lens synthesizes melatonin. In the present study, we examined whether two key enzymes in melatonin biosynthesis, arylalkylamine N-acetyltransferase (AANAT) and hydroxyindole-O-methyltransferase (HIOMT), are expressed in the lens of adult male rats. Reverse transcriptase-polymerase chain reaction analyses demonstrated that both AANAT and HIOMT mRNAs are expressed in the lens. Western blotting for AANAT protein showed that the lens, like the pineal gland, contains this enzyme protein with a molecular mass of 24 kDa. Immunohistochemistry revealed that AANAT protein is localized to the lens cortical fiber cells. Serotonin, which is a substrate for AANAT and a melatonin precursor, was also found in this region. These findings demonstrate that the lens expresses AANAT and HIOMT, and suggest that the cortical fiber cells are the main melatonin-synthesizing sites in the lens. Locally synthesized melatonin in the lens cortical fiber cells may protect the lens itself from cataract development.
Arylalkylamine N-acetyltransferase (Aanat) is the penultimate enzyme in the serotonin-N-acetylserotonin-melatonin pathway. It is nearly exclusively expressed in the pineal gland and the retina. A marked rhythm of Aanat gene expression in the rat pineal is mediated by cyclic AMP response elements located in the promoter and first intron. Intron 1 also contains E-box elements, which mediate circadian gene expression in other cells. Here we examined whether these elements contribute to rhythmic Aanat expression in the pineal gland. This was done using transgenic rats carrying Aanat transgenes with mutant E-box elements. Circadian expression of Aanat transgenes was not altered by these mutations. However, these mutations enhanced ectopic expression establishing that the intronic Aanat E-box elements contribute to the gene's pineal specific expression. A similar role of the Aanat E-box has been reported in zebrafish, indicating that Aanat E-box mediated silencing is a conserved feature of vertebrate biology.
This study was conducted to investigate the circadian rhythms and light responses of Clock and arylalkylamine N-acetyltransferase (NAT) gene expressions in the rat pineal gland under the environmental conditions of a 12 h light (05:00-17:00 h): 12 h-dark (17:00-05:00 h) cycle (LD) and constant darkness (DD). The pineal gland of Sprague-Dawley rats housed under a LD regime (n=42) for four weeks and of a regime (n=42) for eight weeks were sampled at six different times, every 4 h (n=7 animals per time point), during a 24 h period. Total RNA was extracted from each sample, and the semiquantitative reverse transcription polymerase chain reaction (RT-PCR) was used to determine temporal changes in mRNA levels of Clock and NAT genes during different circadian or zeitgeber times. The data and parameters were analyzed by the cosine function software, Clock Lab software, and the amplitude F test was used to reveal the circadian rhythm. In the DD or LD condition, both the Clock and NAT mRNA levels in the pineal gland showed robust circadian oscillation (p<0.05) with the peak at the subjective night or at nighttime. In comparison with the DD regime, the amplitudes and mRNA levels at the peaks of Clock and NAT expressions in LD in the pineal gland were significantly reduced (p<0.05). In the DD or LD condition, the circadian expressions of NAT were similar in pattern to those of Clock in the pineal gland (p>0.05). These findings indicate that the transcriptions of Clock and NAT genes in the pineal gland not only show remarkably synchronous endogenous circadian rhythmic changes, but also respond to the ambient light signal in a reduced manner.
The circadian rhythm of pineal melatonin requires the nocturnal increment of serotonin N-acetyltransferase (arylalkylamine N-acetyltransferase [AANAT]) protein. To date, only limited information is available in the critical issue of how AANAT protein expression is up-regulated exclusively at night regardless of its species-specific mRNA profiles. Here we show that the circadian timing of AANAT protein expression is regulated by rhythmic translation of AANAT mRNA. This rhythmic control is mediated by both a highly conserved IRES (internal ribosome entry site) element within the AANAT 5' untranslated region and its partner hnRNP Q (heterogeneous nuclear ribonucleoprotein Q) with a peak in the middle of the night. Consistent with the enhancing role of hnRNP Q in AANAT IRES activities, knockdown of the hnRNP Q level elicited a dramatic decrease of peak amplitude in the AANAT protein profile parallel to reduced melatonin production in pinealocytes. This translational regulation of AANAT mRNA provides a novel aspect for achieving the circadian rhythmicity of vertebrate melatonin.
The retinal photopigment melanopsin (Opn4) mediates photoentrainment of the circadian system. In the present study, seasonal regulation of the melanopsin gene was investigated in comparison with the arylalkylamine N-acetyltransferase (AA-NAT) gene as an indicator of retinal pacemaker output. For this purpose, the daily profiles in the amount of melanopsin mRNA and AA-NAT mRNA were monitored under 8 : 16 h light/dark, 12 : 12 h light/dark and 16 : 8 h light/dark photoperiods using real-time polymerase chain reaction analysis. We found that, under all of the lighting regimes, melanopsin and AA-NAT expression oscillated with a peak around dark onset and the middle of the dark phase, respectively. The lighting regime influenced both genes, but in an opposing manner. Under long photoperiods, the duration of peak expression was prolonged for melanopsin, whereas it was shortened for AA-NAT. Under constant darkness, the rhythm of mRNA was abolished for melanopsin, but persisted for AA-NAT whereas, under constant light, the rhythm of mRNA was abolished for both genes. Our findings suggest that, in contrast to the AA-NAT gene, the daily and photoperiod-dependent regulation of the melanopsin gene does not rely on a circadian oscillator but is directly illumination-dependent.
Norepinephrine (NE) is one of the major neurotransmitters that determine melatonin production in the pineal gland. Although a substantial amount of Ca(2+) influx is triggered by NE, the Ca(2+) entry pathway and its physiological relevance have not been elucidated adequately. Herein we report that the Ca(2+) influx triggered by NE significantly regulates the protein level of serotonin N-acetyltransferase, or arylalkylamine N-acetyltransferase (AANAT), a critical enzyme in melatonin production, and is responsible for maintaining the Ca(2+) response after repetitive stimulation. Ca(2+) entry evoked by NE was dependent on PLC activation. NE evoked a substantial amount of Ca(2+) entry even after cells were treated with 1-oleoyl-2-acetyl-sn-glycerol (OAG), an analog of diacylglycerol. To the contrary, further OAG treatment after cells had been exposed to OAG did not evoke additional Ca(2+) entry. Moreover, NE failed to induce further Ca(2+) entry after the development of Ca(2+) entry induced by thapsigargin (Tg), suggesting that the pathway of Ca(2+) entry induced by NE might be identical to that of Tg. Interestingly, Ca(2+) entry evoked by NE or Tg induced membrane hyperpolarization that was reversed by iberiotoxin (IBTX), a specific inhibitor of large-conductance Ca(2+)-activated K(+) (BK) channels. Moreover, IBTX-sensitive BK current was observed during application of NE, suggesting that activation of the BK channels was responsible for the hyperpolarization. Furthermore, the activation of BK channels triggered by NE contributed to regulation of the protein level of AANAT. Collectively, these results suggest that NE triggers Ca(2+) entry coupled to BK channels and that NE-induced Ca(2+) entry is important in the regulation of AANAT.
In the rat pineal gland, the steady-state level of arylalkylamine N-acetyltransferase (AANAT) protein is controlled by transcriptional and translational mechanisms as well as by proteasome-mediated degradation. Studies with proteasome inhibitors, MG132 and clasto-lactacystin beta-lactone (c-lact), show two opposite effects of proteasomal inhibition on norepinephrine (NE)-induction of Aanat. Addition of MG132 or c-lact following NE stimulation causes an increase in AANAT protein level and enzyme activity without affecting the level of Aanat mRNA. In contrast, addition of inhibitors prior to NE stimulation reduces the NE-stimulated Aanat mRNA, AANAT protein, and enzyme activity. The inhibitory effect of proteasomal inhibition on adrenergic-induced Aanat transcription appears specific for Aanat because it has no effect on the adrenergic induction of mitogen-activated protein kinase phosphatase-1 (mkp-1). The effects of the proteasome inhibitors on NE-stimulated Aanat induction appear to be mediated by accumulation of a protein repressor.
Cannabinoids modulate neuronal and neuroendocrine circuits by binding to cannabinoid receptors acting upon cAMP/Ca(2+)-mediated intracellular signaling cascades. The rat pineal represents an established model to investigate intracellular signaling processes because a well defined input, the neurotransmitter norepinephrine, is transformed via cAMP/Ca(2+)-dependent mechanisms into an easily detectable output signal, the biosynthesis of melatonin. Here we investigated the impact of cannabinoids on norepinephrine-regulated melatonin biosynthesis in the rat pineal. We demonstrated that treatment of cultured rat pineals with 9-carboxy-11-nor-delta-9-tetrahydrocannabinol (THC), cannabidiol or cannabinol significantly reduced norepinephrine-induced arylalkylamine N-acetyltransferase (AANAT) activity and melatonin biosynthesis. These effects were not mimicked by the cannabinoid receptor agonist WIN55,212-2 and were not blocked by cannabinoid 1 and 2 receptor antagonists. The cannabinoids used did not affect norepinephrine-induced increases in cAMP/Ca(2+) levels. Notably, cannabinoids were found to directly inhibit AANAT activity in lysates of the pineal gland. This effect was specific in so far as cannabinoids did not influence the activity of hydroxyindole-O-methyltransferase (HIOMT), the last enzyme in melatonin biosynthesis. Taken together, our data strongly suggest that cannabinoids inhibit AANAT activity and attenuate melatonin biosynthesis through intracellular actions without involvement of classical cannabinoid receptor-dependent signaling cascades.
A retino-hypothalamic-sympathetic pathway drives the nocturnal surge of pineal melatonin production that determines the synchronization of pineal function with the environmental light/dark cycle. In many studies, melatonin has been implicated in the modulation of the inflammatory response. However, scant information on the feedback action of molecules present in the blood on the pineal gland during the time course of an inflammatory response is available. Here we analyzed the effect of tumor necrosis factor-alpha (TNF-alpha) and corticosterone on the transcription of the Aa-nat, hiomt and 14-3-3 protein genes in denervated pineal glands of rats stimulated for 5 hr with norepinephrine, using real-time reverse transcription-polymerase chain reaction. The transcription of Aa-nat, a gene encoding the key enzyme in melatonin biosynthesis, together with the synthesis of the melatonin precursor N-acetylserotonin, was inhibited by TNF-alpha. This inhibition was transient, and a preincubation of TNF-alpha for more than 24 hr had no detectable effect. In fact, a protein(s) transcribed, later on, as shown by cycloheximide, was responsible for the reversal of the inhibition of Aa-nat transcription. In addition, corticosterone induced a potentiation of norepinephrine-induced Aa-nat transcription even after 48 hr of incubation. These data support the hypothesis that the nocturnal surge in melatonin is impaired at the beginning of an inflammatory response and restored either during the shutdown of an acute response or in a chronic inflammatory pathology. Here, we introduce a new molecular pathway involved in the feedback of an inflammatory response on pineal activity, and provide a molecular basis for understanding the expression of circadian timing in injured organisms.
Serotonin N-acetyltransferase (arylalkylamine N-acetyltransferase [AANAT]) is the key enzyme in melatonin synthesis regulated by circadian rhythm. To date, our understanding of the oscillatory mechanism of melatonin has been limited to autoregulatory transcriptional and posttranslational regulations of AANAT mRNA. In this study, we identify three proteins from pineal glands that associate with cis-acting elements within species-specific AANAT 3' untranslated regions to mediate mRNA degradation. These proteins include heterogeneous nuclear ribonucleoprotein R (hnRNP R), hnRNP Q, and hnRNP L. Their RNA-destabilizing function was determined by RNA interference and overexpression approaches. Expression patterns of these factors in pineal glands display robust circadian rhythm. The enhanced levels detected after midnight correlate with an abrupt decline in AANAT mRNA level. A mathematical model for the AANAT mRNA profile and its experimental evidence with rat pinealocytes indicates that rhythmic AANAT mRNA degradation mediated by hnRNP R, hnRNP Q, and hnRNP L is a key process in the regulation of its circadian oscillation.
In rodent pineal glands, sympathetic innervation, which leads to norepinephrine release, is a key process in the circadian regulation of physiology and certain gene expressions. It has been shown that gene expression of the rate-limiting enzyme in the melatonin synthesis arylalkylamine N-acetyltransferase (Aa-Nat), circadian clock gene Period1, and mitogen-activated protein kinase (MAPK) phosphtase-1 (MKP-1), is controlled mainly by a norepinephrine-beta-adrenergic receptor-cAMP signaling cascade in the rat pineal gland. To further dissect the signaling cascades that regulate those gene expressions, we examined whether MAPKs are involved in cAMP-induced gene expression. Western blot and immunohistochemical analyses showed that one of the three MAPKs, c-Jun N-terminal kinase (JNK), was expressed in the pineal, and was phosphorylated by cAMP analogue stimulation with a peak 20 min after start of the stimulation, in vitro. A specific JNK inhibitor SP600125 (Anthra[1,9-cd]pyrazol-6(2H)-one1,9-pyrazoloanthrone), but not its negative control (N1-Methyl-1,9-pyrazoloanthrone), significantly reduced cAMP-stimulated Aa-Nat, Period1, and MKP-1 mRNA levels. Although another MAPK, p38(MAPK), has also been shown to be activated by cAMP stimulation, a p38(MAPK) inhibitor, SB203580 (4-(4-Fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)1H-imidazole, HCl), showed no effect on cAMP-induced Aa-Nat and Period1 mRNA levels; whereas SB203580, but not its negative analogue SB202474 (4-Ethyl-2(p-methoxyphenyl)-5-(4'-pyridyl)-IH-imidazole, DiHCl), significantly reduced cAMP-induced MKP-1 mRNA levels. Taken together, our data suggest that cAMP-induced Aa-Nat and Period1 are likely to be mediated by activation of JNK, whereas MKP-1 may be mediated by both p38(MAPK) and JNK activations.
In this study, we investigated the effect of proteasomal inhibition on the induction of arylalkylamine-N-acetyltransferase (AA-NAT) enzyme in cultured rat pinealocytes, using two proteasome inhibitors, MG132 and clastolactacystin beta-lactone (c-lact). Addition of c-lact or MG132 3 h after norepinephrine (NE) stimulation produced a significant increase in AA-NAT protein level and enzyme activity. However, when the proteasome inhibitors were added before or together with NE, significant reductions of the NE-induced aa-nat mRNA, protein, and enzyme activity were observed. A similar inhibitory effect of MG132 on aa-nat transcription was observed when cells were stimulated by dibutyryl cAMP, indicating an effect distal to a post-cAMP step. The inhibitory effect of MG132 on adrenergic-induced aa-nat transcription was long lasting because it remained effective after 14 h of washout and appeared specific for aa-nat because the induction of another adrenergic-regulated gene, MAPK phosphatase-1, by NE was not affected. Time-profile studies revealed that the inhibitory effect of MG132 on NE-stimulated aa-nat induction was detected after 1 h, suggesting accumulation of a protein repressor as a possible mechanism of action. This possibility was also supported by the finding that the inhibitory effect of c-lact on NE-induced aa-nat induction was markedly reduced by cycloheximide, a protein synthesis inhibitor. Together, these results support an important role of proteasomal proteolysis in the adrenergic-mediated induction of aa-nat transcription through its effect on a protein repressor.
The rhythmic nocturnal production of melatonin in pineal glands is controlled by the periodic release of norepinephrine from the superior cervical ganglion. Norepinephrine binds to the beta-adrenergic receptor and stimulates an increase in intracellular cAMP levels, leading to the transcriptional activation of serotonin N-acetyltransferase, which in turn promotes melatonin production. In the present study, we report that bradykinin inhibits basal- and forskolin-stimulated adenylyl cyclase activity, norepinephrine-induced cAMP generation, and N-acetyltransferase expression in a calcium-dependent manner. These effects were blocked by pretreatment with U73122 (a selective phospholipase C inhibitor), and 1,2-bis(o-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid (a Ca(2+) chelator), but not pertussis toxin. The calcium ionophore, ionomycin, inhibited isoproterenol-mediated cAMP generation, similar to bradykinin. Interestingly, the inhibitory effect of bradykinin was evident only during the daytime. At midday, bradykinin inhibited the cAMP level by approximately 50% but markedly stimulated cAMP production (by approximately 50%) at night. Northern blotting and immunoblotting data disclosed circadian expression of calcium-inhibitable adenylyl cyclase type 6. Expression of adenylyl cyclase type 6 was maximal at Zeitgeber Time (ZT) 01 and very low at ZT 13. Our results suggest that bradykinin-induced calcium inhibits melatonin synthesis through the mediation of adenylyl cyclase type 6 expression.
We have previously shown that inhibition of p38(MAPK) increases adrenergic-stimulated p42/44(MAPK) activation in rat pinealocytes. In this study we investigated whether p38(MAPK) played a role in the adrenergic regulation of arylalkylamine-N-acetyltransferase (AA-NAT) induction and melatonin (MT) synthesis. Treatment of pinealocytes with norepinephrine (NE) caused a time-dependent increase in the levels of AA-NAT mRNA, AA-NAT protein, and enzymatic activity as well as MT production. Cotreatment with SB202190, a selective p38(MAPK) inhibitor, although having no effect on AA-NAT activity or protein level 3 h after NE treatment, caused a sustained increase in AA-NAT activity and protein level after 6 h of NE treatment. The increases in NE-stimulated AA-NAT activity and protein level by SB202190 occurred in the absence of an increase in AA-NAT mRNA. Similar results were obtained when AA-NAT was induced by (Bu)(2)cAMP or when SB203580 was used to inhibit p38(MAPK). In comparison, SB202474, the inactive analog, had no effect on NE or (Bu)(2)cAMP-stimulated AA-NAT activity or protein level. SB202190 also increased cumulative NE-stimulated MT production, provided that the medium was supplemented with 5-methoxytryptamine. p38(MAPK) inhibitors had no effect on hydroxyindole-O-methyltransferase activity. These results show that inhibition of p38(MAPK), although having no effect on cAMP-mediated AA-NAT transcription, appears to increase AA-NAT activity either by increasing translation or by reducing degradation of the AA-NAT protein. The lack of effect on NE-stimulated MT accumulation by p38(MAPK) inhibitors in the absence of 5-methoxytryptamine could be secondary to a lack of substrate, or alternatively, hydroxyindole-O-methyltransferase may become limiting.
The nocturnal biosynthesis of melatonin in the rat pineal depends on strongly enhanced expression of the enzyme N-acetyltransferase [arylalkylamine N-acetyltransferase (AA-NAT); EC 2.3.1.87]. AA-NAT transcription is stimulated during darkness by adrenergic inputs to the pineal from the suprachiasmatic nucleus (SCN). Nocturnal activation of the AA-NAT promotor following stimulation of pinealocyte adrenoceptors involves cAMP-dependent stimulation of protein kinase A (PKA). The nocturnal rise in AA-NAT depends on the lighting conditions. As compared with light/dark (LD) 12:12, the delay between dark onset and the nocturnal rise in AA-NAT is shortened under long photoperiods and prolonged under short photoperiods. Here, we report that the rapidity of nocturnal AA-NAT induction depends on cAMP inducibility of the gene. Accordingly, cAMP produces a strong AA-NAT response in pineals obtained from rats housed under long photoperiods and a weak AA-NAT response under short photoperiods. Changes in AA-NAT inducibility are fully developed not earlier than after seven cycles. This observation suggests that long-term changes in the photoperiod are necessary to achieve full adjustment of cAMP inducibility of the gene. A direct relationship was found between cAMP-dependent AA-NAT inducibility and the pineal protein kinase A (PKA) activity. As compared to LD 12:12, PKA activity was increased under LD 20:4 and attenuated under LD 4:20. On the basis of the present findings, we suggest that the photoperiod determines the effectiveness of nocturnal AA-NAT induction by long-term modulation of the intrapineal pathway that transmits the cAMP signal to the AA-NAT gene.
Arg-vasopressin (AVP) containing neurons are one of the output paths from the suprachiasmatic nucleus (SCN), the center of the biological clock. AVP mRNA transcription is controlled by a negative feedback loop of clock genes. Circadian rhythm of melatonin release from the pineal gland is regulated by the SCN via the paraventricular nucleus (PVN). To clarify the transduction system of circadian signals from the SCN to the pineal gland, we determined the effects of melatonin injection (1 mg/kg, i.p.) during light and dark periods on Per2 and AVP mRNAs in the SCN and PVN, in addition to arylalkylamine N-acetyltransferase (AA-NAT) and inducible cAMP early repressor (ICER) mRNAs in the pineal gland of rats using RT-PCR. AVP peptide contents were also measured in the SCN and PVN. AVP content in the SCN decreased during the light period, while no changes were observed in the PVN. In the SCN, Per2 mRNA increased during both light and dark periods. In the PVN, Per2 decreased during the light period and increased during the dark period at 180 min after melatonin injection. In the pineal gland, Per2 mRNA increased between 60 and 180 min after the melatonin injection during the light period, while it did not significantly change during the dark period. The AA-NAT mRNA varied similar to the Per2 mRNA changes. These results might suggest that the different responses to melatonin in the pineal gland during the light and dark periods was originated in the changes of Per2 in the PVN via SCN.
Effects of protein kinase C on protein stability and activity of rat AANAT were investigated in vitro and in vivo. When COS-7 cells transfected with AANAT cDNA were treated with phorbol 12-myristate 13-acetate (PMA), both the activity and protein level of AANAT were increased. These effects of PMA were blocked by GF109203X, a specific inhibitor of PKC. Moreover, PMA increased the phosphorylation of AANAT and induced the formation of AANAT/14-3-3zeta complex. PMA did not affect the basal level of cAMP and did not involve the potentiation of the cAMP production by forskolin, indicating that PKC-dependent activation of adenylyl cyclase was excluded in transfected COS-7 cells. To identify which amino acids were phosphorylated by PKC, several conserved Thr and Ser residues in AANAT were targeted for site-directed mutagenesis. Mutations of Thr29 and Ser203 prevented the increase of enzymatic activity and protein level mediated by PMA. To explore the nature of AANAT phosphorylation, purified rat AANAT was subjected to in vitro PKC kinase assay. PKC directly phosphorylated the rat recombinant AANAT. The phosphopeptides identified by mass spectrometric analysis, and western blotting indicated that Thr29 was one of target sites for PKC. To confirm the effects of the physiological activation of PKC, rat pineal glands were treated with alpha(1)-adrenergic specific agonist phenylephrine. Phenylephrine caused the phosphorylation of endogenous AANAT whereas GF109203X or prazosin, an alpha(1)-adrenergic-specific antagonist, markedly inhibited it. These results suggest that AANAT was phosphorylated at Thr29 by PKC activation through the alpha(1)-adrenergic receptor in rat pineal glands, and that its phosphorylation might contribute to the stability and the activity of AANAT.
In mammals, pineal melatonin secretion is under the control of adrenergic and peptidergic inputs regulating serotonin N-acetyltransferase (arylalkylamine N-acetyltransferase; AA-NAT) activity. In this study, the accumulation of AA-NAT mRNA induced by norepinephrine (NE) and peptides of the secretin superfamily (pituitary adenylate cyclase activating polypeptide (PACAP), vasoactive intestinal peptide (VIP), growth hormone releasing factor (GRF), secretin) was investigated by a new quantitative reverse transcription-PCR (RT-PCR) assay. We demonstrated that PACAP was the most potent peptide to increase the expression of AA-NAT mRNA and to induce cAMP production in rat pinealocytes. VIP was also able to elevate the AA-NAT mRNA level and cAMP efflux in a dose-dependent manner; however, it was six- and threefold, respectively, less potent than PACAP. The maximal values of AA-NAT mRNA level after PACAP and VIP exposures were similar (523.1 +/- 52.5 amol to 640.7 +/- 68.8 amol vs 461.5 +/- 54.3 amol to 579.2 +/- 72.4 amol). These saturable peak values were approximately five- to eightfold less than that after NE (3.0 +/- 0.3 fmol to 3.6 +/- 0.4fmol). GRF and secretin were less potent than VIP in inducing AA-NAT gene expression and cAMP efflux. These data suggest that the peptides act mostly on VIP(1)/PACAP (VPAC(1)) receptors of pinealocytes with different affinity. The peak cAMP efflux always preceded the elevation of AA-NAT gene expression during the 3-h infusion of VIP or NE. The cAMP efflux had declined by the time of onset of maximal AA-NAT gene expression, but remained significantly higher than its basal values. Our data indicate that even a submaximal level of cAMP is sufficient for maintaining the maximal AA-NAT mRNA accumulation. These findings show that, in addition to NE, PACAP and VIP may have an important role in the regulation of AA-NAT mRNA levels in rat pinealocytes.
The main known function of the pineal gland in mammals is the temporal synchronization of physiological rhythms to seasonal changes of day length (photoperiod). In rat, the transcription factor activating protein-1 (AP-1) displays a circadian rhythm in its DNA binding in the pineal gland, which results from the rhythmic expression of Fra-2. We postulated that, if AP-1 is an important component of pineal gland functioning, then variations in photoperiodic conditions should lead to an adaptation of the AP-1 binding rhythm. Here we show that AP-1 binding patterns adapt to variations in lighting conditions, in the same way as the rhythm of arylalkylamine-N-acetyltransferase (AA-NAT) activity. This adaptation appeared to result from photoperiodic adaptation of the rhythmic fra-2 gene expression and was reflected by an adapted delay between the onset of night and the acrophase of the nocturnal peak. We further showed that photoperiodic adaptation of both the AP-1 binding and AA-NAT activity rhythms resulted from adapted changes in adrenergic inducibility of both variables at night onset. We finally provided evidence that AP-1 shared with the CREM gene encoding the transcriptional repressor protein inducible cAMP early repressor (ICER) the ability to be hypersensitive or subsensitive to adrenergic stimuli, depending on prior photoperiod.
The rodent pineal gland is the end point of several peripheral and central fibers innervating the superficial and deep parts of the gland. Up to now, only the sympathetic transmitter norepinephrine is thought to regulate melatonin synthesis, although numerous biochemical experiments have reported in vitro effects of various transmitters on melatonin synthesis. To find out whether there is non-noradrenergic regulation of in vivo pineal metabolism, the mRNA encoding the enzyme arylalkylamine N-acetyltransferase was studied using the highly sensitive technique of in situ hybridization. The existence of a marked nocturnal increase of arylalkylamine N-acetyltransferase mRNA in the superficial pineal gland was confirmed. Interestingly and for the first time, a similar daily variation was observed in the deep pineal. After removal of superior cervical ganglia, the daily rhythm in arylalkylamine N-acetyltransferase mRNA was abolished in both the superficial and deep pineal indicating that the rhythm is driven by sympathetic input in the entire pineal complex. Interestingly, the remaining arylalkylamine N-acetyltransferase mRNA level in the pineal of day- and night-time ganglionectomized rats was significantly higher than in the pineal of day-time intact animals. These data reveal a sympathetic-dependent day-time inhibition of arylalkylamine N-acetyltransferase gene expression. In addition, the day-time pineal arylalkylamine N-acetyltransferase mRNA expression in ganglionectomized rats persisted after adrenal gland removal but was reduced by 50% after propranolol injection. These results indicate that arylalkylamine N-acetyltransferase mRNA in ganglionectomized rats is not induced by circulating catecholamines and may be caused by both a centrally originated norepinephrine, as already suggested, and other non-adrenergic transmitter(s).In conclusion, this work shows that norepinephrine drives the nocturnal increase of arylalkylamine N-acetyltransferase gene expression both in the superficial and deep pineal and strongly suggests that other neurotransmitters are involved in day-time inhibition and night-time stimulation of pineal metabolism.
Pineal and retinal melatonin synthesis is controlled by the enzymatic activity of arylalkylamine N-acetyltransferase (AA-NAT, EC 2.3.1.87), which is regulated by light/dark signals and circadian factors. This enzyme converts serotonin to N-acetylserotonin by the transfer of an acetyl group from acetyl coenzyme A. Endogenous AA-NAT instability during routine purification has made enzyme characterization difficult, but now a stable recombinant protein for AA-NAT has been synthesized to investigate the intrinsic biochemical properties of AA-NAT from a rat pineal cDNA encoding a 205 amino acid, 23 kilodalton protein, by using a glutathione-S-transferase (GST) fusion protein system. Recombinant GST-AA-NAT showed substrate specificity for arylalkylamines and stability at 4 degrees C; however, the enzyme activity was reduced by 40% upon preincubation at 37 degrees C for 2 hr. GST-AA-NAT is preferentially phosphorylated by either cyclic AMP- or cyclic GMP-dependent kinases in vitro, but no detrimental effect was observed on AA-NAT enzymatic activity. Among the metal cations tested in this study, Ca2+, Mg2+, Mn2+, Fe2+, and Co2 showed little or no inhibitory potency, while either 1 mM Zn2+ or 0.1 mM Cu2+ nearly abolished the enzymatic activity. GST-AA-NAT enzyme activity is also inhibited by reagents that are known biochemically to modify thiol groups (N-ethylmaleimide, NEM) and histidine residues (p-chloromercuribenzoate, NBS and diethyl pyrocarbonate, DEPC), suggesting the presence of essential cysteine and histidine moieties. Moreover, preincubation of acetyl CoA completely protects the recombinant AA-NAT from inactivation by NEM and DEPC, indicating that specific cysteine and histidine residues may be at the acetylation site. The conclusion is that the biochemical properties of rat recombinant AA-NAT is similar to the endogenous pineal and retinal AA-NAT with respect to the sensitivity to temperature, metal cations, as well as the thiol modification reagents. These data also suggest that the phosphorylation status of the AA-NAT does not affect enzymatic activity directly, and histidine residues are potentially important residues required for high catalytic activity.
A 10-100-fold rhythm in the activity of arylalkylamine N-acetyltransferase (AA-NAT; EC 2.3.1.87) controls the rhythm in melatonin synthesis in the pineal gland. In some mammals, including the rat, the high nocturnal level of AA-NAT activity is preceded by an approximately 100-fold increase in AA-NAT mRNA. The increase in AA-NAT mRNA is generated by norepinephrine acting through a cAMP mechanism. Indirect evidence has suggested that cAMP enhances AA-NAT gene expression by stimulating phosphorylation of a DNA-binding protein (cAMP-responsive element (CRE)-binding protein) bound to a CRE. The nature of the sites involved in cAMP activation was investigated in this report by analyzing the AA-NAT promoter. An approximately 3700-base pair fragment of the 5'-flanking region of the rat AA-NAT gene was isolated, and the major transcription start points were mapped. The results of deletion analysis and site-directed mutagenesis indicate that cAMP activation requires a CRE.CCAAT complex consisting of a near-perfect CRE and an inverted CCAAT box located within two helical turns.
In vertebrates, the circadian rhythm in the activity of serotonin N-acetyltransferase [arylalkylamine N-acetyltransferase (AA-NAT); EC 2.3.1.87] drives the daily rhythm in circulating melatonin. We have discovered that expression of the AA-NAT gene in the rat pineal gland is essentially turned off during the day and turned on at night, resulting in a more than 150-fold rhythm. Expression is regulated by a photoneural system that acts through an adrenergic-cAMP mechanism in pinealocytes, probably involving cAMP response element-binding protein phosphorylation. Turning off AA-NAT expression appears to involve de novo synthesis of a protein that attenuates transcription. A approximately 10-fold night/day rhythm in AA-NAT messenger RNA occurs in the retina, and AA-NAT messenger RNA is also detected at low levels in the brain.
Pineal serotonin N-acetyltransferase (arylalkylamine N-acetyltransferase, or AA-NAT) generates the large circadian rhythm in melatonin, the hormone that coordinates daily and seasonal physiology in some mammals. Complementary DNA encoding ovine AA-NAT was cloned. The abundance of AA-NAT messenger RNA (mRNA) during the day was high in the ovine pineal gland and somewhat lower in retina. AA-NAT mRNA was found unexpectedly in the pituitary gland and in some brain regions. The night-to-day ratio of ovine pineal AA-NAT mRNA is less than 2. In contrast, the ratio exceeds 150 in rats. AA-NAT represents a family within a large superfamily of acetyltransferases.
Physiological changes in Fos-like immunoreactivity in the rat pineal gland are shown here to be due primarily to changes in a 42/46-kDa Fos-related antigen (Fra). Studies are presented that indicate this 42/46-kDa Fra is Fra-2, a poorly understood member of the Fos family of transcription factors. Both Fra-2 mRNA and protein are absent during the day and increase robustly at night on a circadian basis; organ culture studies indicate that regulation is mediated by an adrenergic-->cyclic AMP mechanism. AP-1 binding activity changes in parallel to changes in the level of Fra-2 protein.
Formation of the pineal gland hormone melatonin increases markedly at night in response to light-dark environmental alterations. Melatonin is synthesized from serotonin by an initial N-acetylation followed by methylation of the 5-hydroxy moiety by hydroxyindole-O-methyltransferase. Serotonin N-acetyltransferase (NAT; EC2.3.1.87), which catalyses the first reaction, is the rate-limiting enzyme in this process, and its activity increases dramatically with the onset of darkness. Because melatonin may play important biological roles in reproduction, ageing and sleep, understanding the molecular factors that regulate NAT is of particular importance. To identify proteins that regulate light-dark variations in pineal function, we used a subtractive hybridization technique based on the polymerase chain reaction (PCR) to isolate rat pineal gland messages that are differentially expressed by day and night. Here we report the molecular cloning of NAT and dramatic diurnal variations in its transcription. Independently, Klein and associates have cloned NAT from sheep pineal glands.
The effects of prostaglandins (PGs) on rat pineal metabolism were examined in vitro. PGE2 (0.01-1 microM) increased the activity of serotonin-N-acetyltransferase (SNAT), the stimulation curve exhibiting a maximum at 0.1 microM. PGE1 increased SNAT activity only at the highest dose (1 microM) whereas PGF2 alpha, 15-keto-PGF2 alpha or PGI2 did not affect the enzymic activity. The stimulation of SNAT activity brought about by PGE2 in pineals from ganglionectomized rats was greater than in sham-operated controls at all the doses studied, suggesting that the observed effect is predominantly post-synaptic. Only PGE2 significantly increased pineal cAMP accumulation in vitro at doses between 0.01 and 1 microM, and depressed the unoccupied cAMP-binding sites in pineal 900 g supernatants. The total number of cAMP-binding sites remained unaltered after incubation of PGE2. The present observations together with the previously reported NE-induced release of PGs in incubated pineal glands, the occurrence of pineal PG-binding sites and the indomethacin blockade of the nocturnal rise of pineal SNAT and melatonin content, support a role for PGs in the control of melatonin synthesis.