Aanat | GeneID:25120 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 25120 Official Symbol Aanat
Locus N/A Gene Type protein-coding
Synonyms AA-NAT; Nat4
Full Name arylalkylamine N-acetyltransferase
Description arylalkylamine N-acetyltransferase
Chromosome 10q32.3
Also Known As Arylalkylamine N - acetyltransferase (Serotonin N - acetyltransferase); Seretonin N-acetyltransferase; arylakylamine N-acetyltransferase
Summary regulates melatonin biosynthesis; may play a role in circadian rhythm and response to photoperiod [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 31013

ID Symbol Protein Species
GeneID:15 AANAT NP_001079.1 Homo sapiens
GeneID:11298 Aanat NP_033721.1 Mus musculus
GeneID:25120 Aanat NP_036950.1 Rattus norvegicus
GeneID:281583 AANAT NP_803475.1 Bos taurus
GeneID:393677 aanat1 NP_956998.1 Danio rerio
GeneID:396066 AANAT NP_990489.1 Gallus gallus
GeneID:483331 AANAT XP_540450.1 Canis lupus familiaris
GeneID:503504 AANAT NP_001012442.1 Pan troglodytes
GeneID:618594 AANAT XP_876019.2 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 acris SP5279P Serotonin acetylase pSer206; antibody Ab
2 acris SP5278CP Serotonin acetylase Control Peptide; antibody Ab/CP
3 acris SP5279CP Serotonin acetylase pSer206, Control Peptide; antibody Ab/CP
4 acris SP5278P Serotonin acetylase; antibody Ab
5 sigma S0689 Anti-Serotonin N-Acetyltransferase (C-Terminal) antibody produced in rabbit ;
6 sigma S0814 Anti-phospho-Serotonin N-Acetyltransferase (N-Terminal) (pThr29) antibody produced in rabbit ;
7 sigma S0939 Anti-phospho-Serotonin N-Acetyltransferase (C-Terminal) (pSer206) antibody produced in rabbit ;
8 sigma S0564 Anti-Serotonin N-Acetyltransferase (N-Terminal) antibody produced in rabbit ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0008415 Function acyltransferase activity
GO:0004059 Function aralkylamine N-acetyltransferase activity
GO:0004060 Function arylamine N-acetyltransferase activity
GO:0005184 Function neuropeptide hormone activity
GO:0016740 Function transferase activity
GO:0007623 Process circadian rhythm
GO:0043153 Process entrainment of circadian clock by photoperiod
GO:0030187 Process melatonin biosynthetic process
GO:0008152 Process metabolic process
GO:0009648 Process photoperiodism
GO:0051592 Process response to calcium ion
GO:0051591 Process response to cAMP
GO:0046688 Process response to copper ion
GO:0051412 Process response to corticosterone stimulus
GO:0034097 Process response to cytokine stimulus
GO:0032868 Process response to insulin stimulus
GO:0009416 Process response to light stimulus
GO:0014070 Process response to organic cyclic substance
GO:0034695 Process response to prostaglandin E stimulus
GO:0010043 Process response to zinc ion

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_012818  UCSC Browser NP_036950

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000015221 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSRNOT00000015221 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSRNOT00000015221 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENSRNOT00000015221 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENSRNOT00000015221 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENSRNOT00000015221 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSRNOT00000015221 MI0005712 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA
ENSRNOT00000015221 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENSRNOT00000015221 MI0005756 hsa-miR-934 UGUCUACUACUGGAGACACUGG
ENSRNOT00000015221 MI0005481 mmu-miR-105 CCAAGUGCUCAGAUGCUUGUGGU
ENSRNOT00000015221 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENSRNOT00000015221 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENSRNOT00000015221 MI0002404 mmu-miR-469 UGCCUCUUUCAUUGAUCUUGGUGUCC
ENSRNOT00000015221 MI0004680 mmu-miR-491 AGUGGGGAACCCUUCCAUGAGG
ENSRNOT00000015221 MI0005554 mmu-miR-511 AUGCCUUUUGCUCUGCACUCA
ENSRNOT00000015221 MI0004134 mmu-miR-668 UGUCACUCGGCUCGGCCCACUACC
ENSRNOT00000015221 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENSRNOT00000015221 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSRNOT00000015221 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSRNOT00000015221 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG
ENSRNOT00000015221 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENSRNOT00000015221 MI0000895 rno-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENSRNOT00000015221 MI0000637 rno-miR-129 CUUUUUGCGGUCUGGGCUUGC
ENSRNOT00000015221 MI0000902 rno-miR-129 CUUUUUGCGGUCUGGGCUUGC
ENSRNOT00000015221 MI0000647 rno-miR-151* CUAGACUGAGGCUCCUUGAGG
ENSRNOT00000015221 MI0000947 rno-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENSRNOT00000015221 MI0000858 rno-miR-26b* CCUGUUCUCCAUUACUUGGCUC
ENSRNOT00000015221 MI0000861 rno-miR-28 AAGGAGCUCACAGUCUAUUGAG
ENSRNOT00000015221 MI0000596 rno-miR-325-3p UUUAUUGAGCACCUCCUAUCAA
ENSRNOT00000015221 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU
ENSRNOT00000015221 MI0003719 rno-miR-378 ACUGGACUUGGAGUCAGAAGG
ENSRNOT00000015221 MI0006149 rno-miR-463 UGAUAGACGCCAAUUUGGGUAG
ENSRNOT00000015221 MI0003485 rno-miR-483 UCACUCCUCCCCUCCCGUCUUGU
ENSRNOT00000015221 MI0006154 rno-miR-532-3p CCUCCCACACCCAAGGCUUGCA
ENSRNOT00000015221 MI0006155 rno-miR-598-5p GCGGUGAUGCCGAUGGUGCGAG
ENSRNOT00000015221 MI0006160 rno-miR-708 AAGGAGCUUACAAUCUAGCUGGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

DQ075321   NM_012818   U29664   U38306   U40803  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Garcia RA, et al. (2008) "Insulin modulates norepinephrine-mediated melatonin synthesis in cultured rat pineal gland." Life Sci. 82(1-2):108-114. PMID:18048060
  2. [ + ] Bai L, et al. (2008) "Daily oscillation of gene expression in the retina is phase-advanced with respect to the pineal gland." Brain Res. 1203():89-96. PMID:18321474
  3. [ + ] Kim TD, et al. (2007) "Rhythmic control of AANAT translation by hnRNP Q in circadian melatonin production." Genes Dev. 21(7):797-810. PMID:17403780
  4. [ + ] Wang GQ, et al. (2007) "Daily oscillation and photoresponses of clock gene, Clock, and clock-associated gene, arylalkylamine N-acetyltransferase gene transcriptions in the rat pineal gland." Chronobiol Int. 24(1):9-20. PMID:17364576
  5. [ + ] Humphries A, et al. (2007) "Rodent Aanat: intronic E-box sequences control tissue specificity but not rhythmic expression in the pineal gland." Mol Cell Endocrinol. 270(1-2):43-49. PMID:17363136
  6. [ + ] Klein DC, et al. (2007) "Arylalkylamine N-acetyltransferase: "the Timezyme"." J Biol Chem. 282(7):4233-4237. PMID:17164235
  7. [ + ] Itoh MT, et al. (2007) "Expression and cellular localization of melatonin-synthesizing enzymes in the rat lens." J Pineal Res. 42(1):92-96. PMID:17198543
  8. [ + ] Mathes A, et al. (2007) "Daily profile in melanopsin transcripts depends on seasonal lighting conditions in the rat retina." J Neuroendocrinol. 19(12):952-957. PMID:18001324
  9. [ + ] Ho AK, et al. (2006) "Opposite effects of proteasome inhibitors in the adrenergic induction of arylalkylamine N-acetyltransferase in rat pinealocytes." Chronobiol Int. 23(1-2):361-367. PMID:16687309
  10. [ + ] Fernandes PA, et al. (2006) "Effect of TNF-alpha on the melatonin synthetic pathway in the rat pineal gland: basis for a 'feedback' of the immune response on circadian timing." J Pineal Res. 41(4):344-350. PMID:17014691
  11. [ + ] Koch M, et al. (2006) "Cannabinoids attenuate norepinephrine-induced melatonin biosynthesis in the rat pineal gland by reducing arylalkylamine N-acetyltransferase activity without involvement of cannabinoid receptors." J Neurochem. 98(1):267-278. PMID:16805813
  12. [ + ] Lee SY, et al. (2006) "Norepinephrine activates store-operated Ca2+ entry coupled to large-conductance Ca2+-activated K+ channels in rat pinealocytes." Am J Physiol Cell Physiol. 290(4):C1060-C1066. PMID:16282194
  13. [ + ] Chansard M, et al. (2005) "Regulation of cAMP-induced arylalkylamine N-acetyltransferase, Period1, and MKP-1 gene expression by mitogen-activated protein kinases in the rat pineal gland." Brain Res Mol Brain Res. 139(2):333-340. PMID:16024134
  14. [ + ] Kim TD, et al. (2005) "Rhythmic serotonin N-acetyltransferase mRNA degradation is essential for the maintenance of its circadian oscillation." Mol Cell Biol. 25(8):3232-3246. PMID:15798208
  15. [ + ] Terriff DL, et al. (2005) "Proteasomal proteolysis in the adrenergic induction of arylalkylamine-N-acetyltransferase in rat pinealocytes." Endocrinology. 146(11):4795-4803. PMID:16099857
  16. [ + ] Han S, et al. (2005) "Rhythmic expression of adenylyl cyclase VI contributes to the differential regulation of serotonin N-acetyltransferase by bradykinin in rat pineal glands." J Biol Chem. 280(46):38228-38234. PMID:16166080
  17. [ + ] Choi BH, et al. (2004) "Protein kinase C regulates the activity and stability of serotonin N-acetyltransferase." J Neurochem. 90(2):442-454. PMID:15228600
  18. [ + ] Isobe Y, et al. (2004) "Signal transmission from the suprachiasmatic nucleus to the pineal gland via the paraventricular nucleus: analysed from arg-vasopressin peptide, rPer2 mRNA and AVP mRNA changes and pineal AA-NAT mRNA after the melatonin injection during light and dark periods." Brain Res. 1013(2):204-211. PMID:15193530
  19. [ + ] Engel L, et al. (2004) "Rat pineal arylalkylamine-N-acetyltransferase: cyclic AMP inducibility of its gene depends on prior entrained photoperiod." Brain Res Mol Brain Res. 123(1-2):45-55. PMID:15046865
  20. [ + ] Man JR, et al. (2004) "Inhibition of p38 mitogen-activated protein kinase enhances adrenergic-stimulated arylalkylamine N-acetyltransferase activity in rat pinealocytes." Endocrinology. 145(3):1167-1174. PMID:14617573
  21. [ + ] Rekasi Z, et al. (2002) "Accumulation of rat pineal serotonin N-acetyltransferase mRNA induced by pituitary adenylate cyclase activating polypeptide and vasoactive intestinal peptide in vitro." J Mol Endocrinol. 28(1):19-31. PMID:11854096
  22. [ + ] Guillaumond F, et al. (2002) "Adrenergic inducibility of AP-1 binding in the rat pineal gland depends on prior photoperiod." J Neurochem. 83(1):157-166. PMID:12358739
  23. [ + ] Garidou ML, et al. (2001) "In vivo observation of a non-noradrenergic regulation of arylalkylamine N-acetyltransferase gene expression in the rat pineal complex." Neuroscience. 105(3):721-729. PMID:11516836
  24. [ + ] Zhan-Poe X, et al. (1999) "Biochemical characterization of recombinant serotonin N-acetyltransferase." J Pineal Res. 27(1):49-58. PMID:10451024
  25. [ + ] Baler R, et al. (1997) "The rat arylalkylamine N-acetyltransferase gene promoter. cAMP activation via a cAMP-responsive element-CCAAT complex." J Biol Chem. 272(11):6979-6985. PMID:9054387
  26. [ + ] Roseboom PH, et al. (1996) "Melatonin synthesis: analysis of the more than 150-fold nocturnal increase in serotonin N-acetyltransferase messenger ribonucleic acid in the rat pineal gland." Endocrinology. 137(7):3033-3045. PMID:8770929
  27. [ + ] Baler R, et al. (1995) "Circadian expression of transcription factor Fra-2 in the rat pineal gland." J Biol Chem. 270(45):27319-27325. PMID:7592994
  28. [ + ] Coon SL, et al. (1995) "Pineal serotonin N-acetyltransferase: expression cloning and molecular analysis." Science. 270(5242):1681-1683. PMID:7502081
  29. [ + ] Borjigin J, et al. (1995) "Diurnal variation in mRNA encoding serotonin N-acetyltransferase in pineal gland." Nature. 378(6559):783-785. PMID:8524412
  30. [ + ] Ritta MN, et al. (1981) "Prostaglandin E2 increases adenosine 3',5'-monophosphate concentration and binding-site occupancy, and stimulates serotonin-N-acetyltransferase activity in rat pineal glands in vitro." Mol Cell Endocrinol. 23(2):151-159. PMID:6268470