ABL1 | GeneID:25 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 25 Official Symbol ABL1
Locus RP11-83J21.1 Gene Type protein-coding
Synonyms ABL; JTK7; bcr/abl; c-ABL; p150; v-abl
Full Name c-abl oncogene 1, receptor tyrosine kinase
Description c-abl oncogene 1, receptor tyrosine kinase
Chromosome 9q34.1
Also Known As OTTHUMP00000022375; OTTHUMP00000022376; bcr/c-abl oncogene protein; proto-oncogene tyrosine-protein kinase ABL1; v-abl Abelson murine leukemia viral oncogene homolog 1
Summary The ABL1 protooncogene encodes a cytoplasmic and nuclear protein tyrosine kinase that has been implicated in processes of cell differentiation, cell division, cell adhesion, and stress response. Activity of c-Abl protein is negatively regulated by its SH3 domain, and deletion of the SH3 domain turns ABL1 into an oncogene. The t(9;22) translocation results in the head-to-tail fusion of the BCR (MIM:151410) and ABL1 genes present in many cases of chronic myelogeneous leukemia. The DNA-binding activity of the ubiquitously expressed ABL1 tyrosine kinase is regulated by CDC2-mediated phosphorylation, suggesting a cell cycle function for ABL1. The ABL1 gene is expressed as either a 6- or 7-kb mRNA transcript, with alternatively spliced first exons spliced to the common exons 2-11. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3783

ID Symbol Protein Species
GeneID:25 ABL1 NP_009297.2 Homo sapiens
GeneID:11350 Abl1 NP_033724.1 Mus musculus
GeneID:311860 Abl1 XP_001067860.1 Rattus norvegicus
GeneID:417181 ABL1 XP_001233812.1 Gallus gallus
GeneID:464802 ABL1 XP_001166213.1 Pan troglodytes
GeneID:491292 ABL1 XP_548413.2 Canis lupus familiaris
GeneID:540876 ABL1 XP_613548.2 Bos taurus
GeneID:100000720 LOC100000720 XP_001337829.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab55284 c Abl (phospho Y412) antibody (ab55284); Rabbit polyclonal to c Abl (phospho Y412)
2 abcam ab54394 c Abl antibody [SPM328], prediluted (ab54394); Mouse monoclonal [SPM328] to c Abl, prediluted
3 abcam ab47410 c Abl antibody (ab47410); Rabbit polyclonal to c Abl
4 abcam ab47315 c Abl (phospho Y412) antibody (ab47315); Rabbit polyclonal to c Abl (phospho Y412)
5 abcam ab32080 c Abl antibody [Y421] (ab32080); Rabbit monoclonal [Y421] to c Abl
6 abcam ab4479 c Abl (phospho Y245) antibody (ab4479); Rabbit polyclonal to c Abl (phospho Y245)
7 abcam ab16903 c Abl antibody [19-110] (ab16903); Mouse monoclonal [19-110] to c Abl
8 abcam ab16905 c Abl antibody [24-21] (ab16905); Mouse monoclonal [24-21] to c Abl
9 abcam ab3227 c Abl antibody [8E9] (ab3227); Mouse monoclonal [8E9] to c Abl
10 abcam ab15130 c Abl antibody (ab15130); Rabbit polyclonal to c Abl
11 abcam ab10528 c Abl antibody [ABL-148] (ab10528); Mouse monoclonal [ABL-148] to c Abl
12 abcam ab15133 c Abl antibody, prediluted (ab15133); Rabbit polyclonal to c Abl, prediluted
13 abcam ab4717 c Abl (phospho Y412) antibody (ab4717); Rabbit polyclonal to c Abl (phospho Y412)
14 abcam ab63530 c Abl antibody (ab63530); Rabbit polyclonal to c Abl
15 abcam ab62189 c Abl (phospho Y245) antibody (ab62189); Rabbit polyclonal to c Abl (phospho Y245)
16 abcam ab61757 c Abl (phospho Y204) antibody (ab61757); Rabbit polyclonal to c Abl (phospho Y204)
17 abcam ab59966 c Abl (phospho S588) antibody (ab59966); Rabbit polyclonal to c Abl (phospho S588)
18 abcam ab59968 c Abl (phospho Y272) antibody (ab59968); Rabbit polyclonal to c Abl (phospho Y272)
19 abcam ab59969 c Abl (phospho Y276) antibody (ab59969); Rabbit polyclonal to c Abl (phospho Y276)
20 abgent AP3016a Phospho-ABL1-Y276 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
21 abgent AP7694d ABL1 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
22 abgent AP7694a ABL1 Antibody (N-term K219); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
23 abgent AP7694b ABL1 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
24 abgent AP3502a Phospho-ABL-pY283 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
25 abgent AP3503a Phospho-ABL-pT754 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
26 abgent AP3481a Phospho-ABL-Y204 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
27 abgent AP7694c ABL1 Antibody (N-term H246); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
28 abgent AP3015a Phospho-ABL1-Y272 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
29 abgent AP3008a Phospho-ABL-S588 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
30 abgent AP3013a Phospho-ABL1-Y245 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
31 abgent AP3014a Phospho-ABL1-Y251 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
32 abgent AP3011a Phospho-ABL1-Y134 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
33 abgent AP3018a Phospho-ABL2 Antibody (Center); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
34 abgent AP3018b ABL Antibody (R432); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
35 acris AP14451PU-N ABL1 (N-term); antibody Ab
36 acris AP12552PU-N ABL1 pTyr251; antibody Ab
37 acris AP07163PU-N ABL1 pTyr412; antibody Ab
38 acris AP15379PU-S ABL1; antibody Ab
39 acris AP15379PU-N ABL1; antibody Ab
40 acris AP02679PU-N ABL1; antibody Ab
41 acris AP02679PU-S ABL1; antibody Ab
42 acris AP12896PU-N ABL1 pTyr204; antibody Ab
43 acris AP02413PU-N ABL1 pTyr412; antibody Ab
44 acris AP02413PU-S ABL1 pTyr412; antibody Ab
45 acris AP12554PU-N ABL1 pTyr276; antibody Ab
46 acris AP12918PU-N ABL1 pThr754; antibody Ab
47 acris AP14452PU-N ABL1 (Center); antibody Ab
48 acris AP12553PU-N ABL1 pTyr272; antibody Ab
49 acris AP14449PU-N ABL1 (N-term); antibody Ab
50 acris AP14450PU-N ABL1 (C-term); antibody Ab
51 acris AP01720PU-N ABL1 pTyr412; antibody Ab
52 acris AM00309PU-N ABL1; antibody Ab
53 acris AP12550PU-N ABL1 pTyr134; antibody Ab
54 acris AP12549PU-N ABL1 pSer588; antibody Ab
55 acris AP12551PU-N ABL1 pTyr245; antibody Ab
56 acris AP12917PU-N ABL1 pTyr283; antibody Ab
57 scbt ABL1 ABL1 Antibody / ABL1 Antibodies;
58 sigma C5365 Anti-phospho-c-Abl (pTyr245) antibody produced in rabbit ;
59 sigma C5240 Anti-phospho-c-Abl (pTyr412) antibody produced in rabbit ;
60 sigma A5844 Monoclonal Anti-c-Abl antibody produced in mouse ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABL1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABL1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005856 Component cytoskeleton
GO:0005730 Component nucleolus
GO:0005634 Component nucleus
GO:0005524 Function ATP binding
GO:0003677 Function DNA binding
GO:0000287 Function magnesium ion binding
GO:0030145 Function manganese ion binding
GO:0004715 Function non-membrane spanning protein tyrosine kinase activity
GO:0000166 Function nucleotide binding
GO:0008022 Function protein C-terminus binding
GO:0016740 Function transferase activity
GO:0030036 Process actin cytoskeleton organization
GO:0007155 Process cell adhesion
GO:0008630 Process DNA damage response, signal transduction resulting in induction of apoptosis
GO:0006298 Process mismatch repair
GO:0018108 Process peptidyl-tyrosine phosphorylation
GO:0051353 Process positive regulation of oxidoreductase activity
GO:0006464 Process protein modification process
GO:0006355 Process regulation of transcription, DNA-dependent
GO:0000115 Process regulation of transcription during S-phase of mitotic cell cycle

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_005157  UCSC Browser NP_005148 A3KFJ3   P00519  
2 NM_007313  UCSC Browser NP_009297 Q17R61   Q59FK4  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000372348 MI0000825 hsa-miR-345 GCUGACUCCUAGUCCAGGGCUC
ENST00000372348 MI0001445 hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU
ENST00000372348 MI0003513 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC
ENST00000372348 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000372348 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000372348 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENST00000372348 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENST00000372348 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENST00000372348 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENST00000372348 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENST00000372348 MI0005416 hsa-miR-675 UGGUGCGGAGAGGGCCCACAGUG
ENST00000372348 MI0005567 hsa-miR-760 CGGCUCUGGGUCUGUGGGGA
ENST00000372348 MI0000098 hsa-miR-96* AAUCAUGUGCAGUGCCAAUAUG
ENST00000372348 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000372348 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000372348 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000372348 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENST00000372348 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENST00000372348 MI0004647 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENST00000372348 MI0004648 mmu-miR-684 AGUUUUCCCUUCAAGUCAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AA524892   AB209456   AB209642   AF113911   AJ131466   AK294983   AL707819   BC107069   BC107070   BC117451   CA335983   CR598308   CR614023   M14752   M14753   M14754   M25946   M30833   NM_005157   NM_007313   X16416  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAA35593   AAA35697   AAA51561   AAA51562   AAA51563   AAA51895   AAA51896   AAA88011   AAA88012   AAB60393   AAB60394   AAD04633   AAD14034   AAI07070   AAI07071   AAI17452   AAZ38718   BAD92693   BAD92879   BAG58052   CAA10376   CAA34438   CAM45754   CAM45755   CAM45756   EAW87947   EAW87948   EAW87949   NP_005148   NP_009297   P00519   Q13688   Q13689   Q13690   Q13691   Q13848   Q13914   Q13915   Q14020   Q17R61   Q3B836   Q3B837   Q59F19   Q59FK4  

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.?90
c.944C>T27
c.763G>A22
c.1052T>C18
c.757T>C10
c.764A>T6
c.756G>C5
c.1075T>G5
c.749G>A4
c.1064A>G4
Primary Site / Histology (Top 10)Mutations (sites * observations)
haematopoietic and lymphoid tissue / haematopoietic neoplasm190
haematopoietic and lymphoid tissue / lymphoid neoplasm22
lung / carcinoma1
skin / malignant melanoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid
  • 3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid results in increased expression of ABL1 mRNA
16788091
Acetaminophen
  • Acetaminophen affects the expression of ABL1 mRNA
17562736
arsenic disulfide
  • arsenic disulfide does not affect the expression of ABL1 mRNA mutant form
  • arsenic disulfide results in decreased activity of ABL1 protein
  • arsenic disulfide results in decreased expression of and results in decreased activity of ABL1 protein mutant form
12421474
arsenic trioxide
  • arsenic trioxide does not affect the degradation of ABL1 protein mutant form
  • arsenic trioxide does not affect the expression of ABL1 mRNA mutant form
  • arsenic trioxide results in decreased expression of ABL1 protein mutant form
14633726
Cocaine
  • Cocaine affects the expression of ABL1 mRNA
15681117
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of ABL1 mRNA
17555576
imatinib
  • imatinib results in decreased phosphorylation of ABL1 protein
  • imatinib results in decreased phosphorylation of ABL1 protein
12032135
imatinib
  • imatinib results in decreased activity of ABL1 protein mutant form
15329907
imatinib
  • imatinib analog results in decreased activity of ABL1 protein modified form
15501042
imatinib
  • imatinib results in decreased activity of ABL1 protein
16940797
Lipopolysaccharides
  • Lipopolysaccharides results in increased expression of ABL1 mRNA
12057914
olomoucine II
  • olomoucine II does not affect the activity of ABL1 protein
16003486
sodium arsenite
  • sodium arsenite results in increased expression of ABL1 mRNA
12016162
sodium arsenite
  • sodium arsenite results in decreased expression of ABL1 mRNA
16014739
Tamoxifen
  • Tamoxifen affects the expression of ABL1 mRNA
17555576
Tretinoin
  • Tretinoin results in increased expression of ABL1 mRNA
16788091
Zinc
  • Zinc affects the expression of ABL1 protein
16636310

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Acrodermatitis inferred via Zinc 17190629, 17202136, 16889938
Alzheimer Disease inferred via Zinc 17119284, 16580781, 16410023, 16325427
Anemia, Sickle Cell inferred via Zinc 16916123
Asthma inferred via Zinc 17085522
Brain Injuries inferred via Zinc 17109824
Carcinoma, Squamous Cell inferred via Zinc 16543248
Cardiovascular Diseases inferred via Zinc 16936243
Diabetes Mellitus inferred via Zinc 16479319
Esophageal Neoplasms inferred via Zinc 16543248
Gastritis inferred via Zinc 17241300
Growth Disorders inferred via Zinc 17217573
Heart Failure inferred via Zinc 17162251
Heart Injuries inferred via Zinc 17074742
Helicobacter Infections inferred via Zinc 17241300
Hepatolenticular Degeneration inferred via Zinc 17276780
Ischemia inferred via Zinc 16584753
Kidney Diseases inferred via Zinc 16960431
Kidney Failure, Chronic inferred via Zinc 16518626
Mammary Neoplasms, Experimental inferred via Zinc 12773700
Pre-Eclampsia inferred via Zinc 17114810
Prostatic Neoplasms inferred via Zinc 12429649, 16517595, 16700911, 16606632
Retinal Degeneration inferred via Zinc 16584753
Tongue Neoplasms inferred via Zinc 16543248
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16443354, 16166294
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 16823087, 16140955, 16331271, 17294898, 17361223, 17368321, 17301526, 17339181, 17506722, 17217047, 16766008, 17107899, 16788101, 16935935, 15748426, 12679006
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Breast Neoplasms inferred via Tamoxifen 16202921, 16818667, 15668708, 17440819, 17893378, 17261762, 17049068, 16873071, 11161223, 15565566, 17242785
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 16827153, 14580682
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Adrenal Gland Neoplasms inferred via sodium arsenite 15276417
Adrenocortical Adenoma inferred via sodium arsenite 16712894
Carcinoma, Hepatocellular inferred via sodium arsenite 15276417, 16507464
Carcinoma, Squamous Cell inferred via sodium arsenite 18572023
Genital Neoplasms, Female inferred via sodium arsenite 16452187
Hodgkin Disease inferred via sodium arsenite 12676792
Liver Neoplasms inferred via sodium arsenite 15276417, 16712894
Lung Neoplasms inferred via sodium arsenite 15276417, 16712894, 17077188
Melanoma inferred via sodium arsenite 16487513
Neoplasms inferred via sodium arsenite 11559025
Neural Tube Defects inferred via sodium arsenite 12854658
Ovarian Neoplasms inferred via sodium arsenite 15276417
Prostatic Neoplasms inferred via sodium arsenite 16039940
Skin Neoplasms inferred via sodium arsenite 18572023
Spinal Dysraphism inferred via sodium arsenite 12854658
Urinary Bladder Neoplasms inferred via sodium arsenite 11723127, 16712894, 16452187
Uterine Cervical Neoplasms inferred via sodium arsenite 11813266
Vascular Diseases inferred via sodium arsenite 17056641
Hemolytic-Uremic Syndrome inferred via Lipopolysaccharides 16366002
Inflammation inferred via Lipopolysaccharides 17255318, 17963957
Iron Metabolism Disorders inferred via Lipopolysaccharides 17255318
Respiratory Hypersensitivity inferred via Lipopolysaccharides 10835634
Breast Neoplasms inferred via imatinib 17614352
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via imatinib 15748426, 17301526
Liver Cirrhosis, Experimental inferred via imatinib 16596278
Neoplasms, Hormone-Dependent inferred via imatinib 17614352
Precursor Cell Lymphoblastic Leukemia-Lymphoma inferred via imatinib 12476293
Thyroid Neoplasms inferred via imatinib 16940797
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 11677210, 15861022, 16919318, 17681005, 17333356, 16105132
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Adenocarcinoma inferred via arsenic trioxide 11798837
Blood Coagulation Disorders inferred via arsenic trioxide 16206674
Burkitt Lymphoma inferred via arsenic trioxide 11589617
Carcinoma, Hepatocellular inferred via arsenic trioxide 16217749, 11135700, 14691202, 15553829, 15073043
Carcinoma, Small Cell inferred via arsenic trioxide 12490120
Coronary Restenosis inferred via arsenic trioxide 12609071
Death, Sudden, Cardiac inferred via arsenic trioxide 15213294
Esophageal Neoplasms inferred via arsenic trioxide 12903497
Fatty Liver inferred via arsenic trioxide 15073043
Gallbladder Neoplasms inferred via arsenic trioxide 16904648
Leukemia inferred via arsenic trioxide 15070760
Leukemia-Lymphoma, Adult T-Cell inferred via arsenic trioxide 12560223, 17077332
Leukemia, Monocytic, Acute inferred via arsenic trioxide 16972261
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via arsenic trioxide 14633726
Leukemia, Myeloid, Acute inferred via arsenic trioxide 16467208, 16968895, 17050201
Leukemia, Promyelocytic, Acute inferred via arsenic trioxide 16891316, 16823087, 15622746, 12712474, 11468182, 15336539, 16331271, 17217047, 17107899, 15748426, 15213294, 12679006, 11161223, 16966277, 16330433
Leukemia, T-Cell inferred via arsenic trioxide 16882451
Liver Neoplasms inferred via arsenic trioxide 14682389
Long QT Syndrome inferred via arsenic trioxide 15213294
Lung Neoplasms inferred via arsenic trioxide 11798837
Multiple Myeloma inferred via arsenic trioxide 15949261, 14977855, 11468182
Myelodysplastic Syndromes inferred via arsenic trioxide 16105982, 16882451
Neoplasm Invasiveness inferred via arsenic trioxide 16624393
Ovarian Neoplasms inferred via arsenic trioxide 16624393, 12452020
Pancreatic Neoplasms inferred via arsenic trioxide 15580305
Sarcoma, Ewing's inferred via arsenic trioxide 16646077
Stomach Neoplasms inferred via arsenic trioxide 17007042
Torsades de Pointes inferred via arsenic trioxide 15213294
Urinary Bladder Neoplasms inferred via arsenic trioxide 12973940, 11780464, 12845720
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via arsenic disulfide 12421474
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16227642, 15968718, 16177239, 17522070, 17562736, 14986274, 16081117
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ABI1 ABL1 / ABI1 Affinity Capture-Western Biesova Z (1997)
ABI1 ABI1 / ABL1 Reconstituted Complex Tani K (2003)
ABI1 ABI1 / ABL1 Reconstituted Complex Yamamoto A (2001)
ABI2 ABL1 / ABI2 Affinity Capture-Western Cao C (2003)
ABI2 ABI2 / ABL1 Affinity Capture-Western Dai Z (1995)
ABI2 ABI2 / ABL1 Reconstituted Complex Dai Z (1995)
ABL1 ABL1 / ABL1 Protein-peptide Hantschel O (2003)
ABL2 ABL1 / ABL2 Affinity Capture-Western Cao C (2003)
ABL2 ABL2 / ABL1 Affinity Capture-Western Cao C (2003)
ABL2 ABL1 / ABL2 Reconstituted Complex Cao C (2003)
ARGBP2 ARGBP2 / ABL1 Affinity Capture-Western Soubeyran P (2003)
ARGBP2 ABL1 / ARGBP2 Biochemical Activity Wang B (1997)
ARGBP2 ARGBP2 / ABL1 Reconstituted Complex Wang B (1997)
ARHGAP17 ARHGAP17 / ABL1 Reconstituted Complex Richnau N (2001)
ATM ABL1 / ATM Affinity Capture-Western Chen G (1999)
ATM ATM / ABL1 Affinity Capture-Western Chen G (1999)
ATM ABL1 / ATM Affinity Capture-Western Kishi S (2001)
ATM ATM / ABL1 Affinity Capture-Western Kishi S (2001)
ATM ABL1 / ATM Affinity Capture-Western Shafman T (1997)
ATM ABL1 / ATM Reconstituted Complex Shafman T (1997)
ATM ATM / ABL1 Two-hybrid Shafman T (1997)
ATR ATR / ABL1 Protein-peptide Kim ST (1999)
BCAR1 BCAR1 / ABL1 Affinity Capture-Western Salgia R (1996)
BCAR1 ABL1 / BCAR1 Biochemical Activity Mayer BJ (1995)
BCR BCR / ABL1 Affinity Capture-Western Ling X (2003)
BCR ABL1 / BCR Affinity Capture-Western Puil L (1994)
BCR ABL1 / BCR Reconstituted Complex Pendergast AM (1991)
BCR ABL1 / BCR Reconstituted Complex Puil L (1994)
BRCA1 ABL1 / BRCA1 Affinity Capture-Western Foray N (2002)
BRCA1 BRCA1 / ABL1 Affinity Capture-Western Foray N (2002)
CABLES2 CABLES2 / ABL1 Affinity Capture-Western Sato H (2002)
CAT ABL1 / CAT Affinity Capture-Western Cao C (2003)
CAT CAT / ABL1 Affinity Capture-Western Cao C (2003)
CAT ABL1 / CAT Biochemical Activity Cao C (2003)
CAT ABL1 / CAT Reconstituted Complex Cao C (2003)
CBL CBL / ABL1 Affinity Capture-Western Miyoshi-Akiyama T (2001)
CBL CBL / ABL1 Affinity Capture-Western Soubeyran P (2003)
CBL ABL1 / CBL Biochemical Activity Miyoshi-Akiyama T (2001)
CBL CBL / ABL1 Far Western Miyoshi-Akiyama T (2001)
Creb1 ABL1 / Creb1 Affinity Capture-Western Birchenall-Roberts MC (1995)
CREB1 ABL1 / CREB1 Reconstituted Complex Birchenall-Roberts MC (1995)
CRKL CRKL / ABL1 Affinity Capture-Western Heaney C (1997)
CRKL CRKL / ABL1 Affinity Capture-Western Kyono WT (1998)
CRKL ABL1 / CRKL Affinity Capture-Western Ren R (1994)
CRKL ABL1 / CRKL Reconstituted Complex Heaney C (1997)
CRKL ABL1 / CRKL Reconstituted Complex Ren R (1994)
CRKL ABL1 / CRKL Two-hybrid Heaney C (1997)
CRKL ABL1 / CRKL Two-hybrid Oda T (1994)
CRKL ABL1 / CRKL Two-hybrid Ren R (1994)
DOK1 DOK1 / ABL1 Affinity Capture-Western Yamanashi Y (1997)
DOK1 ABL1 / DOK1 Biochemical Activity Yamanashi Y (1997)
DOK1 DOK1 / ABL1 Reconstituted Complex van Dijk TB (2000)
EPHB2 ABL1 / EPHB2 Invivo Yu HH (2001)
EPHB2 ABL1 / EPHB2 Two-hybrid Yu HH (2001)
EVL ABL1 / EVL Reconstituted Complex Lambrechts A (2000)
FRAP1 ABL1 / FRAP1 Affinity Capture-Western Kumar V (2000)
FRAP1 FRAP1 / ABL1 Affinity Capture-Western Kumar V (2000)
GPX1 ABL1 / GPX1 Affinity Capture-Western Cao C (2003)
GPX1 GPX1 / ABL1 Affinity Capture-Western Cao C (2003)
GPX1 ABL1 / GPX1 Reconstituted Complex Cao C (2003)
GPX1 GPX1 / ABL1 Reconstituted Complex Cao C (2003)
Grap2 Grap2 / ABL1 Reconstituted Complex Liu SK (1998)
GRB10 GRB10 / ABL1 Affinity Capture-Western Bai RY (1998)
GRB10 ABL1 / GRB10 Reconstituted Complex Frantz JD (1997)
GRB2 ABL1 / GRB2 Affinity Capture-Western Warmuth M (1997)
HCK ABL1 / HCK Affinity Capture-Western Warmuth M (1997)
INPPL1 ABL1 / INPPL1 Affinity Capture-Western Wisniewski D (1999)
Jak1 ABL1 / Jak1 Affinity Capture-Western Danial NN (1998)
JAK1 ABL1 / JAK1 Reconstituted Complex Danial NN (1998)
MDM2 ABL1 / MDM2 Affinity Capture-Western Goldberg Z (2002)
MDM2 ABL1 / MDM2 Biochemical Activity Goldberg Z (2002)
MDM2 MDM2 / ABL1 Reconstituted Complex Goldberg Z (2002)
MICAL1 ABL1 / MICAL1 Reconstituted Complex Suzuki T (2002)
NCK1 NCK1 / ABL1 Affinity Capture-Western Miyoshi-Akiyama T (2001)
NEDD9 ABL1 / NEDD9 Affinity Capture-Western Law SF (1996)
NEDD9 NEDD9 / ABL1 Affinity Capture-Western Minegishi M (1996)
NTRK1 NTRK1 / ABL1 Affinity Capture-Western Yano H (2000)
NTRK1 ABL1 / NTRK1 Reconstituted Complex Koch A (2000)
NTRK1 NTRK1 / ABL1 Two-hybrid Koch A (2000)
PAG1 ABL1 / PAG1 Affinity Capture-Western Wen ST (1997)
PAG1 ABL1 / PAG1 Two-hybrid Wen ST (1997)
PAK2 PAK2 / ABL1 Affinity Capture-Western Roig J (2000)
PAK2 PAK2 / ABL1 Biochemical Activity Roig J (2000)
PIK3R1 ABL1 / PIK3R1 Reconstituted Complex Kapeller R (1994)
PLCG1 ABL1 / PLCG1 Reconstituted Complex Koch A (2000)
PRKDC ABL1 / PRKDC Reconstituted Complex Jin S (1997)
PSTPIP1 PSTPIP1 / ABL1 Affinity Capture-Western Cong F (2000)
PSTPIP1 PSTPIP1 / ABL1 Reconstituted Complex Cong F (2000)
PSTPIP1 PSTPIP1 / ABL1 Two-hybrid Cong F (2000)
PTPN6 ABL1 / PTPN6 Affinity Capture-Western Kharbanda S (1996)
RAD51 ABL1 / RAD51 Affinity Capture-Western Chen G (1999)
RAD51 RAD51 / ABL1 Affinity Capture-Western Chen G (1999)
RAD51 ABL1 / RAD51 Reconstituted Complex Chen G (1999)
RAD9A ABL1 / RAD9A Affinity Capture-Western Yoshida K (2002)
RAD9A RAD9A / ABL1 Affinity Capture-Western Yoshida K (2002)
RAD9A ABL1 / RAD9A Biochemical Activity Yoshida K (2002)
RAD9A ABL1 / RAD9A Reconstituted Complex Yoshida K (2002)
RAN RAN / ABL1 Affinity Capture-Western Daniel R (2001)
RB1 ABL1 / RB1 Affinity Capture-Western Miyamura T (1997)
RB1 RB1 / ABL1 Reconstituted Complex Welch PJ (1993)
RFX1 ABL1 / RFX1 Affinity Capture-Western Agami R (1998)
RFX1 ABL1 / RFX1 Reconstituted Complex Agami R (1998)
RYBP RYBP / ABL1 Far Western Zhu J (1996)
RYBP RYBP / ABL1 Reconstituted Complex Zhu J (1996)
RYBP ABL1 / RYBP Two-hybrid Zhu J (1996)
SH3BP1 SH3BP1 / ABL1 Reconstituted Complex Cicchetti P (1992)
SHC1 ABL1 / SHC1 Affinity Capture-Western Puil L (1994)
SHC1 SHC1 / ABL1 Affinity Capture-Western Wisniewski D (1999)
SHD SHD / ABL1 Two-hybrid Oda T (1997)
SLC9A2 SLC9A2 / ABL1 Reconstituted Complex Chow CW (1999)
SORBS1 SORBS1 / ABL1 Affinity Capture-Western Lin WH (2001)
SORBS1 SORBS1 / ABL1 Invitro Lin WH (2001)
SORBS1 SORBS1 / ABL1 Invivo Lin WH (2001)
SOS1 SOS1 / ABL1 Affinity Capture-Western Puil L (1994)
SPTA1 ABL1 / SPTA1 Affinity Capture-Western Ziemnicka-Kotula D (1998)
SPTA1 ABL1 / SPTA1 Reconstituted Complex Ziemnicka-Kotula D (1998)
SPTAN1 ABL1 / SPTAN1 Reconstituted Complex Ziemnicka-Kotula D (1998)
SPTAN1 ABL1 / SPTAN1 Two-hybrid Ziemnicka-Kotula D (1998)
ST5 ST5 / ABL1 Reconstituted Complex Majidi M (1998)
TERF1 ABL1 / TERF1 Affinity Capture-Western Kishi S (2001)
TERF1 TERF1 / ABL1 Affinity Capture-Western Kishi S (2001)
TP53 ABL1 / TP53 Reconstituted Complex Nie Y (2000)
TP73 ABL1 / TP73 Affinity Capture-Western Agami R (1999)
TP73 ABL1 / TP73 Affinity Capture-Western Yuan ZM (1999)
TP73 ABL1 / TP73 Reconstituted Complex Yuan ZM (1999)
TUB ABL1 / TUB Biochemical Activity Kapeller R (1999)
VAV1 VAV1 / ABL1 Affinity Capture-Western Bassermann F (2002)
VAV1 ABL1 / VAV1 Biochemical Activity Bassermann F (2002)
VAV1 VAV1 / ABL1 Reconstituted Complex Bassermann F (2002)
VAV1 ABL1 / VAV1 Two-hybrid Bassermann F (2002)
XRCC6 ABL1 / XRCC6 Invivo Kumaravel TS (1998)
YT521 YT521 / ABL1 Affinity Capture-Western Rafalska I (2004)
YT521 ABL1 / YT521 Biochemical Activity Rafalska I (2004)
ZAP70 ZAP70 / ABL1 Affinity Capture-Western Neumeister EN (1995)
ZDHHC16 ABL1 / ZDHHC16 Affinity Capture-Western Li B (2002)
ZDHHC16 ABL1 / ZDHHC16 Two-hybrid Li B (2002)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ly KT, et al. (2009) "Abelson tyrosine kinase facilitates Salmonella enterica serovar Typhimurium entry into epithelial cells." Infect Immun. 77(1):60-69. PMID:18936177
  2. [ + ] Clybouw C, et al. (2009) "BimL upregulation induced by BCR cross-linking in BL41 Burkitt's lymphoma results from a splicing mechanism of the BimEL mRNA." Biochem Biophys Res Commun. 383(1):32-36. PMID:19332026
  3. [ + ] Verma D, et al. (2009) "Complexity of BCR-ABL kinase domain mutations during the course of therapy with tyrosine kinase inhibitors in chronic myeloid leukemia." Am J Hematol. 84(4):256-257. PMID:19260121
  4. [ + ] Dierov J, et al. (2009) "BCR/ABL induces chromosomal instability after genotoxic stress and alters the cell death threshold." Leukemia. 23(2):279-286. PMID:19020542
  5. [ + ] Grammatico S, et al. (2009) "Increasing the BCR-ABL expression levels and/or the occurrence of ABL point mutations does not always predict resistance to Imatinib Mesylate in BCR-ABL positive acute lymphoblastic leukemia." Leuk Res. 33(7):e73-e74. PMID:19108887
  6. [ + ] Cui L, et al. (2009) "c-Abl kinase is required for beta 2 integrin-mediated neutrophil adhesion." J Immunol. 182(5):3233-3242. PMID:19234221
  7. [ + ] Zhao Y, et al. (2009) "Simultaneous occurrence of variant Philadelphia translocations and ABL mutations in two patients with chronic myeloid leukemia." Leuk Res. 33(7):e85-e87. PMID:19203793
  8. [ + ] Shimizu H, et al. (2009) "c-ABL tyrosine kinase stabilizes RAD51 chromatin association." Biochem Biophys Res Commun. 382(2):286-291. PMID:19285032
  9. [ + ] Jaras M, et al. (2009) "Expression of P190 and P210 BCR/ABL1 in normal human CD34(+) cells induces similar gene expression profiles and results in a STAT5-dependent expansion of the erythroid lineage." Exp Hematol. 37(3):367-375. PMID:19135771
  10. [ + ] Bauer B, et al. (2009) "H. pylori selectively blocks EGFR endocytosis via the non-receptor kinase c-Abl and CagA." Cell Microbiol. 11(1):156-169. PMID:19016792
  11. [ + ] Quintas-Cardama A, et al. (2009) "Molecular biology of bcr-abl1-positive chronic myeloid leukemia." Blood. 113(8):1619-1630. PMID:18827185
  12. [ + ] Zuckerman V, et al. (2009) "c-Abl phosphorylates Hdmx and regulates its interaction with p53." J Biol Chem. 284(6):4031-4039. PMID:19075013
  13. [ + ] Westlund BS, et al. (2009) "Involvement of c-Abl, p53 and the MAP kinase JNK in the cell death program initiated in A2E-laden ARPE-19 cells by exposure to blue light." Apoptosis. 14(1):31-41. PMID:19052872
  14. [ + ] He X, et al. (2009) "Proliferating cell nuclear antigen destabilizes c-Abl tyrosine kinase and regulates cell apoptosis in response to DNA damage." Apoptosis. 14(3):268-275. PMID:19156526
  15. [ + ] Mavaddat N, et al. (2009) "Common genetic variation in candidate genes and susceptibility to subtypes of breast cancer." Cancer Epidemiol Biomarkers Prev. 18(1):255-259. PMID:19124506
  16. [ + ] Chung L, et al. (2009) "Molecular framework for response to imatinib mesylate in systemic sclerosis." Arthritis Rheum. 60(2):584-591. PMID:19180499
  17. [ + ] Srinivasan D, et al. (2009) "Reciprocal regulation of Abl and receptor tyrosine kinases." Cell Signal. 21(7):1143-1150. PMID:19275932
  18. [ + ] Polampalli S, et al. (2008) "Analysis and comparison of clinicohematological parameters and molecular and cytogenetic response of two Bcr/Abl fusion transcripts." Genet Mol Res. 7(4):1138-1149. PMID:19048492
  19. [ + ] Ban K, et al. (2008) "BCR-ABL1 mediates up-regulation of Fyn in chronic myelogenous leukemia." Blood. 111(5):2904-2908. PMID:18180382
  20. [ + ] Vega A, et al. (2008) "Evaluating new candidate SNPs as low penetrance risk factors in sporadic breast cancer: A two-stage Spanish case-control study." Gynecol Oncol. ():. PMID:18950845
  21. [ + ] De Keersmaecker K, et al. (2008) "Intrinsic differences between the catalytic properties of the oncogenic NUP214-ABL1 and BCR-ABL1 fusion protein kinases." Leukemia. 22(12):2208-2216. PMID:18784740
  22. [ + ] Nolz JC, et al. (2008) "The WAVE2 complex regulates T cell receptor signaling to integrins via Abl- and CrkL-C3G-mediated activation of Rap1." J Cell Biol. 182(6):1231-1244. PMID:18809728
  23. [ + ] Huang X, et al. (2008) "Induction of cell retraction by the combined actions of Abl-CrkII and Rho-ROCK1 signaling." J Cell Biol. 183(4):711-723. PMID:19001122
  24. [ + ] Pene-Dumitrescu T, et al. (2008) "An inhibitor-resistant mutant of Hck protects CML cells against the antiproliferative and apoptotic effects of the broad-spectrum Src family kinase inhibitor A-419259." Oncogene. 27(56):7055-7069. PMID:18794796
  25. [ + ] Shah NP, et al. (2008) "Transient potent BCR-ABL inhibition is sufficient to commit chronic myeloid leukemia cells irreversibly to apoptosis." Cancer Cell. 14(6):485-493. PMID:19061839
  26. [ + ] Hussein K, et al. (2008) "Chronic myeloproliferative diseases with concurrent BCR-ABL junction and JAK2V617F mutation." Leukemia. 22(5):1059-1062. PMID:17972958
  27. [ + ] Eiring AM, et al. (2008) "Identification of novel posttranscriptional targets of the BCR/ABL oncoprotein by ribonomics: requirement of E2F3 for BCR/ABL leukemogenesis." Blood. 111(2):816-828. PMID:17925491
  28. [ + ] Kharas MG, et al. (2008) "Ablation of PI3K blocks BCR-ABL leukemogenesis in mice, and a dual PI3K/mTOR inhibitor prevents expansion of human BCR-ABL+ leukemia cells." J Clin Invest. 118(9):3038-3050. PMID:18704194
  29. [ + ] Jung JH, et al. (2008) "Phosphorylation of c-Abl by protein kinase Pak2 regulates differential binding of ABI2 and CRK." Biochemistry. 47(3):1094-1104. PMID:18161990
  30. [ + ] Walker LC, et al. (2008) "Use of expression data and the CGEMS genome-wide breast cancer association study to identify genes that may modify risk in BRCA1/2 mutation carriers." Breast Cancer Res Treat. 112(2):229-236. PMID:18095154
  31. [ + ] Chen C, et al. (2008) "L-selectin ligation-induced CSF-1 gene transcription is regulated by AP-1 in a c-Abl kinase-dependent manner." Hum Immunol. 69(8):501-509. PMID:18619508
  32. [ + ] Bueno MJ, et al. (2008) "Genetic and epigenetic silencing of microRNA-203 enhances ABL1 and BCR-ABL1 oncogene expression." Cancer Cell. 13(6):496-506. PMID:18538733
  33. [ + ] Quigley NB, et al. (2008) "ABL kinase domain pseudoexon insertion is not uncommon in BCR-ABL transcripts." J Mol Diagn. 10(5):475-6; author reply 476. PMID:18687796
  34. [ + ] Oh AS, et al. (2008) "Tyrosine phosphorylation of the nuclear receptor coactivator AIB1/SRC-3 is enhanced by Abl kinase and is required for its activity in cancer cells." Mol Cell Biol. 28(21):6580-6593. PMID:18765637
  35. [ + ] Stoklosa T, et al. (2008) "BCR/ABL inhibits mismatch repair to protect from apoptosis and induce point mutations." Cancer Res. 68(8):2576-2580. PMID:18413724
  36. [ + ] Richebourg S, et al. (2008) "Mechanisms of genesis of variant translocation in chronic myeloid leukemia are not correlated with ABL1 or BCR deletion status or response to imatinib therapy." Cancer Genet Cytogenet. 182(2):95-102. PMID:18406870
  37. [ + ] Koch A, et al. (2008) "Inhibition of Abl tyrosine kinase enhances nerve growth factor-mediated signaling in Bcr-Abl transformed cells via the alteration of signaling complex and the receptor turnover." Oncogene. 27(34):4678-4689. PMID:18427551
  38. [ + ] Curvo RP, et al. (2008) "A recurrent splicing variant without c-ABL Exon 7 in Imatinib-resistant patients." Leuk Res. 32(3):508-510. PMID:17570524
  39. [ + ] Patel H, et al. (2008) "Subcellular distribution of p210(BCR-ABL) in CML cell lines and primary CD34+ CML cells." Leukemia. 22(3):559-571. PMID:18059481
  40. [ + ] Lee JH, et al. (2008) "Cooperative roles of c-Abl and Cdk5 in regulation of p53 in response to oxidative stress." J Biol Chem. 283(28):19826-19835. PMID:18490454
  41. [ + ] Noguchi M, et al. (2008) "[PI3K-AKT network roles in infectious diseases]" Kansenshogaku Zasshi. 82(3):161-167. PMID:18546844
  42. [ + ] Ernst T, et al. (2008) "ABL single nucleotide polymorphisms may masquerade as BCR-ABL mutations associated with resistance to tyrosine kinase inhibitors in patients with chronic myeloid leukemia." Haematologica. 93(9):1389-1393. PMID:18603549
  43. [ + ] Stagno F, et al. (2008) "Sequential mutations causing resistance to both Imatinib Mesylate and Dasatinib in a chronic myeloid leukaemia patient progressing to lymphoid blast crisis." Leuk Res. 32(4):673-674. PMID:17889935
  44. [ + ] Galan-Moya EM, et al. (2008) "c-Abl activates p38 MAPK independently of its tyrosine kinase activity: Implications in cisplatin-based therapy." Int J Cancer. 122(2):289-297. PMID:17893873
  45. [ + ] Burmeister T, et al. (2008) "A multiplex PCR for improved detection of typical and atypical BCR-ABL fusion transcripts." Leuk Res. 32(4):579-585. PMID:17928051
  46. [ + ] Sun X, et al. (2008) "MT1-MMP as a downstream target of BCR-ABL/ABL interactor 1 signaling: polarized distribution and involvement in BCR-ABL-stimulated leukemic cell migration." Leukemia. 22(5):1053-1056. PMID:17943163
  47. [ + ] Bennour A, et al. (2008) "A masked BCR/ABL rearrangement in a case of chronic myeloid leukemia with translocation t(3;9)(p14;q34)." Cancer Genet Cytogenet. 181(1):72-74. PMID:18262060
  48. [ + ] Filippakopoulos P, et al. (2008) "Structural coupling of SH2-kinase domains links Fes and Abl substrate recognition and kinase activation." Cell. 134(5):793-803. PMID:18775312
  49. [ + ] Lin J, et al. (2008) "Activated c-Abl tyrosine kinase in malignant solid tumors." Oncogene. 27(32):4385-4391. PMID:18391983
  50. [ + ] Bonhoure E, et al. (2008) "Sphingosine kinase-1 is a downstream regulator of imatinib-induced apoptosis in chronic myeloid leukemia cells." Leukemia. 22(5):971-979. PMID:18401414