Abcb4 | GeneID:24891 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 24891 Official Symbol Abcb4
Locus N/A Gene Type protein-coding
Synonyms Mdr2; Pgy3
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 4
Description ATP-binding cassette, sub-family B (MDR/TAP), member 4
Chromosome 4q11-q12
Also Known As ATP-binding cassette sub-family B (MDR/TAP) member 4 (P-glycoprotein 3/ multidrug resistance 2; ATP-binding cassette sub-family B (MDR/TAP) member 4 (P-glycoprotein 3/ multidrug resistance 2); ATP-binding cassette, sub-family B (MDR/TAP), member 4 (P-glycoprotein 3/ multidrug resistance 2); ATP-binding cassette, subfamily B, member 4; P-glycoprotein 3/ multidrug resistance 2
Summary energy-dependent efflux pump; may be involved in changes in bile formation in response to diabetes [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 113698

ID Symbol Protein Species
GeneID:5244 ABCB4 NP_061337.1 Homo sapiens
GeneID:18670 Abcb4 NP_032856.1 Mus musculus
GeneID:24891 Abcb4 NP_036822.1 Rattus norvegicus
GeneID:36428 Mdr49 NP_523724.2 Drosophila melanogaster
GeneID:748364 ABCB4 XP_001160982.1 Pan troglodytes
GeneID:819314 MDR4/PGP4 NP_182223.1 Arabidopsis thaliana
GeneID:825388 PGP21 NP_191774.1 Arabidopsis thaliana
GeneID:826951 MDR3/PGP3 NP_192091.1 Arabidopsis thaliana
GeneID:826974 PGP5 NP_192092.1 Arabidopsis thaliana
GeneID:827530 PGP9 NP_193539.2 Arabidopsis thaliana
GeneID:834697 PGP7 NP_199466.1 Arabidopsis thaliana
GeneID:839282 PGP12 NP_171754.1 Arabidopsis thaliana
GeneID:839353 PGP11 NP_171753.1 Arabidopsis thaliana
GeneID:1276325 AgaP_AGAP005639 XP_315658.1 Anopheles gambiae
GeneID:4323895 Os01g0695700 NP_001043962.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016324 Component apical plasma membrane
GO:0000139 Component Golgi membrane
GO:0016021 Component integral to membrane
GO:0046581 Component intercellular canaliculus
GO:0016020 Component membrane
GO:0005624 Component membrane fraction
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0016787 Function hydrolase activity
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0008559 Function xenobiotic-transporting ATPase activity
GO:0042493 Process response to drug
GO:0051384 Process response to glucocorticoid stimulus
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_012690  UCSC Browser NP_036822

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000043822 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENSRNOT00000043822 MI0003558 hsa-miR-553 AAAACGGUGAGAUUUUGUUUU
ENSRNOT00000043822 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENSRNOT00000043822 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENSRNOT00000043822 MI0005759 hsa-miR-937 AUCCGCGCUCUGACUCUCUGCC
ENSRNOT00000043822 MI0002399 mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA
ENSRNOT00000043822 MI0004589 mmu-miR-496 UGAGUAUUACAUGGCCAAUCUC
ENSRNOT00000043822 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA
ENSRNOT00000043822 MI0004662 mmu-miR-693-5p CAGCCACAUCCGAAAGUUUUC
ENSRNOT00000043822 MI0004687 mmu-miR-703 AAAACCUUCAGAAGGAAAGAA
ENSRNOT00000043822 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA
ENSRNOT00000043822 MI0004554 mmu-miR-759 GCAGAGUGCAAACAAUUUUGAC
ENSRNOT00000043822 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU
ENSRNOT00000043822 MI0000886 rno-miR-101a UACAGUACUGUGAUAACUGAA
ENSRNOT00000043822 MI0000648 rno-miR-101b UACAGUACUGUGAUAGCUGAA
ENSRNOT00000043822 MI0000841 rno-miR-10a-5p UACCCUGUAGAUCCGAAUUUGUG
ENSRNOT00000043822 MI0000915 rno-miR-142-5p CAUAAAGUAGAAAGCACUACU
ENSRNOT00000043822 MI0000855 rno-miR-24-2* GUGCCUACUGAGCUGAAACAGU
ENSRNOT00000043822 MI0000870 rno-miR-30a* CUUUCAGUCGGAUGUUUGCAGC
ENSRNOT00000043822 MI0000866 rno-miR-30c-1* CUGGGAGAGGGUUGUUUACUCC
ENSRNOT00000043822 MI0000869 rno-miR-30d* CUUUCAGUCAGAUGUUUGCUGC
ENSRNOT00000043822 MI0000867 rno-miR-30e* CUUUCAGUCGGAUGUUUACAGC
ENSRNOT00000043822 MI0003545 rno-miR-376a AUCGUAGAGGAAAAUCCACGU
ENSRNOT00000043822 MI0003550 rno-miR-409-3p AAUGUUGCUCGGUGAACCCC
ENSRNOT00000043822 MI0003720 rno-miR-505 GUCAACACUUGCUGGUUUCC
ENSRNOT00000043822 MI0006120 rno-miR-878 GCAUGACACCAUACUGGGUAGA
ENSRNOT00000051093 MI0003558 hsa-miR-553 AAAACGGUGAGAUUUUGUUUU
ENSRNOT00000051093 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

L15079   L25849   NM_012690  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAA02937   AAA64892   CAA43417   NP_036822   Q08201   Q64714  

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Zhang Y, et al. (2007) "Translational regulation of rat multidrug resistance-associated protein 2 expression is mediated by upstream open reading frames in the 5' untranslated region." Mol Pharmacol. 71(1):377-383. PMID:17065236
  2. [ + ] Ortiz DF, et al. (2004) "Identification of HAX-1 as a protein that binds bile salt export protein and regulates its abundance in the apical membrane of Madin-Darby canine kidney cells." J Biol Chem. 279(31):32761-32770. PMID:15159385
  3. [ + ] Tygstrup N, et al. (2002) "Messenger RNA profiles in liver injury and stress: a comparison of lethal and nonlethal rat models." Biochem Biophys Res Commun. 290(1):518-525. PMID:11779202
  4. [ + ] Luttringer O, et al. (2002) "Influence of isolation procedure, extracellular matrix and dexamethasone on the regulation of membrane transporters gene expression in rat hepatocytes." Biochem Pharmacol. 64(11):1637-1650. PMID:12429353
  5. [ + ] Kipp H, et al. (2000) "Newly synthesized canalicular ABC transporters are directly targeted from the Golgi to the hepatocyte apical domain in rat liver." J Biol Chem. 275(21):15917-15925. PMID:10748167
  6. [ + ] Hooiveld GJ, et al. (1999) "3-Hydroxy-3-methylglutaryl-coenzyme A reductase inhibitors (statins) induce hepatic expression of the phospholipid translocase mdr2 in rats." Gastroenterology. 117(3):678-687. PMID:10464145
  7. [ + ] Paulusma CC, et al. (1996) "Congenital jaundice in rats with a mutation in a multidrug resistance-associated protein gene." Science. 271(5252):1126-1128. PMID:8599091
  8. [ + ] Furuya KN, et al. (1994) "Isolation of rat pgp3 cDNA: evidence for gender and zonal regulation of expression in the liver." Biochim Biophys Acta. 1219(3):636-644. PMID:7948020
  9. [ + ] Brown PC, et al. (1993) "Cloning and regulation of the rat mdr2 gene." Nucleic Acids Res. 21(16):3885-3891. PMID:8103593
  10. [ + ] Deuchars KL, et al. (1992) "Identification of distinct P-glycoprotein gene sequences in rat." Biochim Biophys Acta. 1130(2):157-165. PMID:1348630