Abcb1b | GeneID:24646 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 24646 Official Symbol Abcb1b
Locus N/A Gene Type protein-coding
Synonyms Abcb1; Mdr1; Pgy1
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 1B
Description ATP-binding cassette, sub-family B (MDR/TAP), member 1B
Chromosome 4q12
Also Known As ATP-binding cassette sub-family B (MDR/TAP) member 1 (P-glycoprotein/multidrug resistance 1); ATP-binding cassette, sub-family B (MDR/TAP), member 1 (P-glycoprotein/multidrug resistance 1); ATP-binding cassette, subfamily B, member 1B; P-glycoprotein/multidrug resistance 1
Summary member of the ATP-binding cassette (ABC) protein superfamily; may play a role in drug disposition [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 69084

ID Symbol Protein Species
GeneID:18669 Abcb1b NP_035205.1 Mus musculus
GeneID:24646 Abcb1b NP_036755.2 Rattus norvegicus
GeneID:172262 pgp-2 NP_491707.1 Caenorhabditis elegans
GeneID:818265 ATPGP1 NP_181228.1 Arabidopsis thaliana
GeneID:4346344 Os08g0564300 NP_001062529.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab3364 P Glycoprotein antibody [C219] (ab3364); Mouse monoclonal [C219] to P Glycoprotein
2 abcam ab3366 P Glycoprotein antibody [JSB-1] (ab3366); Mouse monoclonal [JSB-1] to P Glycoprotein

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016324 Component apical plasma membrane
GO:0000139 Component Golgi membrane
GO:0016021 Component integral to membrane
GO:0046581 Component intercellular canaliculus
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0015238 Function drug transporter activity
GO:0016787 Function hydrolase activity
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0005215 Function transporter activity
GO:0008559 Function xenobiotic-transporting ATPase activity
GO:0015893 Process drug transport
GO:0014045 Process establishment of endothelial blood-brain barrier
GO:0046685 Process response to arsenic
GO:0042493 Process response to drug
GO:0010212 Process response to ionizing radiation
GO:0048545 Process response to steroid hormone stimulus
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_012623  UCSC Browser NP_036755

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000037712 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENSRNOT00000037712 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSRNOT00000037712 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENSRNOT00000037712 MI0003562 hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU
ENSRNOT00000037712 MI0003586 hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU
ENSRNOT00000037712 MI0003605 hsa-miR-593 UGUCUCUGCUGGGGUUUCU
ENSRNOT00000037712 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENSRNOT00000037712 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENSRNOT00000037712 MI0003716 mmu-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENSRNOT00000037712 MI0003717 mmu-miR-302c AAGUGCUUCCAUGUUUCAGUGG
ENSRNOT00000037712 MI0005554 mmu-miR-511 AUGCCUUUUGCUCUGCACUCA
ENSRNOT00000037712 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENSRNOT00000037712 MI0000637 rno-miR-129 CUUUUUGCGGUCUGGGCUUGC
ENSRNOT00000037712 MI0000902 rno-miR-129 CUUUUUGCGGUCUGGGCUUGC
ENSRNOT00000037712 MI0000904 rno-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSRNOT00000037712 MI0000931 rno-miR-186 CAAAGAAUUCUCCUUUUGGGCU
ENSRNOT00000037712 MI0000941 rno-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENSRNOT00000037712 MI0000945 rno-miR-203 GUGAAAUGUUUAGGACCACUAG
ENSRNOT00000037712 MI0000857 rno-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSRNOT00000037712 MI0000965 rno-miR-291a-3p AAAGUGCUUCCACUUUGUGUGCC
ENSRNOT00000037712 MI0000862 rno-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENSRNOT00000037712 MI0000864 rno-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENSRNOT00000037712 MI0000865 rno-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENSRNOT00000037712 MI0000602 rno-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENSRNOT00000037712 MI0000620 rno-miR-339-3p UGAGCGCCUCGACGACAGAGCCA
ENSRNOT00000037712 MI0003551 rno-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENSRNOT00000037712 MI0003552 rno-miR-374 AUAUAAUACAACCUGCUAAGUG
ENSRNOT00000037712 MI0006148 rno-miR-455 UAUGUGCCUUUGGACUACAUCG
ENSRNOT00000037712 MI0006150 rno-miR-471 UACGUAGUAUAGUGCUUUUCAC
ENSRNOT00000037712 MI0000838 rno-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSRNOT00000037712 MI0000839 rno-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSRNOT00000037712 MI0000840 rno-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSRNOT00000037712 MI0000881 rno-miR-96 UUUGGCACUAGCACAUUUUUGCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AY082609   BC107560   M81855   NM_012623  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAI07561   AAL92458   NP_036755   P43245   Q3B7L2   Q8R427  

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Yu C, et al. (2008) "Neuroinflammation activates Mdr1b efflux transport through NFkappaB: promoter analysis in BBB endothelia." Cell Physiol Biochem. 22(5-6):745-756. PMID:19088456
  2. [ + ] Akanuma S, et al. (2008) "Expression of nuclear receptor mRNA and liver X receptor-mediated regulation of ABC transporter A1 at rat blood-brain barrier." Neurochem Int. 52(4-5):669-674. PMID:17919779
  3. [ + ] Westerlund M, et al. (2008) "Expression of multi-drug resistance 1 mRNA in human and rodent tissues: reduced levels in Parkinson patients." Cell Tissue Res. 334(2):179-185. PMID:18855017
  4. [ + ] Bansal T, et al. (2008) "Pre-clinical evidence for altered absorption and biliary excretion of irinotecan (CPT-11) in combination with quercetin: possible contribution of P-glycoprotein." Life Sci. 83(7-8):250-259. PMID:18619980
  5. [ + ] Nassar T, et al. (2008) "A novel nanocapsule delivery system to overcome intestinal degradation and drug transport limited absorption of P-glycoprotein substrate drugs." Pharm Res. 25(9):2019-2029. PMID:18581211
  6. [ + ] Ogura J, et al. (2008) "Alteration of Mrp2 and P-gp expression, including expression in remote organs, after intestinal ischemia-reperfusion." Life Sci. 82(25-26):1242-1248. PMID:18538350
  7. [ + ] Barakat S, et al. (2008) "Regulation of brain endothelial cells migration and angiogenesis by P-glycoprotein/caveolin-1 interaction." Biochem Biophys Res Commun. 372(3):440-446. PMID:18485890
  8. [ + ] Kameyama N, et al. (2008) "Increase in P-glycoprotein accompanied by activation of protein kinase Calpha and NF-kappaB p65 in the livers of rats with streptozotocin-induced diabetes." Biochim Biophys Acta. 1782(5):355-360. PMID:18346469
  9. [ + ] Thews O, et al. (2008) "Activity of drug efflux transporters in tumor cells under hypoxic conditions." Adv Exp Med Biol. 614():157-164. PMID:18290326
  10. [ + ] Zhang Z, et al. (2008) "Chemosensitization effects of simultaneous suppression of MDR1 and XIAP in multidrug resistant glioma cells." Med Oncol. 25(4):367-373. PMID:18213456
  11. [ + ] Bauer B, et al. (2008) "Seizure-induced up-regulation of P-glycoprotein at the blood-brain barrier through glutamate and cyclooxygenase-2 signaling." Mol Pharmacol. 73(5):1444-1453. PMID:18094072
  12. [ + ] Valente RC, et al. (2008) "ABCB1 (P-glycoprotein) but not ABCC1 (MRP1) is downregulated in peripheral blood mononuclear cells of spontaneously hypertensive rats." Pflugers Arch. 456(2):359-368. PMID:18057958
  13. [ + ] Babakhanian K, et al. (2007) "Localization of P-glycoprotein at the nuclear envelope of rat brain cells." Biochem Biophys Res Commun. 361(2):301-306. PMID:17651695
  14. [ + ] Yu C, et al. (2007) "TNF activates P-glycoprotein in cerebral microvascular endothelial cells." Cell Physiol Biochem. 20(6):853-858. PMID:17982267
  15. [ + ] Maeng HJ, et al. (2007) "Functional induction of P-glycoprotein in the blood-brain barrier of streptozotocin-induced diabetic rats: evidence for the involvement of nuclear factor-kappaB, a nitrosative stress-sensitive transcription factor, in the regulation." Drug Metab Dispos. 35(11):1996-2005. PMID:17664251
  16. [ + ] Naud J, et al. (2007) "Down-regulation of intestinal drug transporters in chronic renal failure in rats." J Pharmacol Exp Ther. 320(3):978-985. PMID:17135344
  17. [ + ] Nishimura M, et al. (2006) "Regulation of mRNA expression of MDR1, MRP1, MRP2 and MRP3 by prototypical microsomal enzyme inducers in primary cultures of human and rat hepatocytes." Drug Metab Pharmacokinet. 21(4):297-307. PMID:16946557
  18. [ + ] Schmitt U, et al. (2006) "Cyclosporine A (CsA) affects the pharmacodynamics and pharmacokinetics of the atypical antipsychotic amisulpride probably via inhibition of P-glycoprotein (P-gp)." J Neural Transm. 113(7):787-801. PMID:16252067
  19. [ + ] Kojima C, et al. (2006) "Chronic exposure to methylated arsenicals stimulates arsenic excretion pathways and induces arsenic tolerance in rat liver cells." Toxicol Sci. 91(1):70-81. PMID:16436460
  20. [ + ] Suzuki T, et al. (2006) "Gender-related differences in expression and function of hepatic P-glycoprotein and multidrug resistance-associated protein (Mrp2) in rats." Life Sci. 79(5):455-461. PMID:16483613
  21. [ + ] Christiansen H, et al. (2006) "Identification of genes responsive to gamma radiation in rat hepatocytes and rat liver by cDNA array gene expression analysis." Radiat Res. 165(3):318-325. PMID:16494520
  22. [ + ] Yu DS, et al. (2006) "Modulation of MDR-1 gene by MIF and GSTpi with drug resistance generation in hormone independent prostate cancer." Arch Androl. 52(4):283-291. PMID:16728344
  23. [ + ] Ronaldson PT, et al. (2006) "HIV-1 viral envelope glycoprotein gp120 triggers an inflammatory response in cultured rat astrocytes and regulates the functional expression of P-glycoprotein." Mol Pharmacol. 70(3):1087-1098. PMID:16790532
  24. [ + ] Cutler L, et al. (2006) "Development of a P-glycoprotein knockout model in rodents to define species differences in its functional effect at the blood-brain barrier." J Pharm Sci. 95(9):1944-1953. PMID:16850390
  25. [ + ] Brandt C, et al. (2006) "The multidrug transporter hypothesis of drug resistance in epilepsy: Proof-of-principle in a rat model of temporal lobe epilepsy." Neurobiol Dis. 24(1):202-211. PMID:16928449
  26. [ + ] Tramonti G, et al. (2006) "Expression and functional characteristics of tubular transporters: P-glycoprotein, PEPT1, and PEPT2 in renal mass reduction and diabetes." Am J Physiol Renal Physiol. 291(5):F972-F980. PMID:17028260
  27. [ + ] Liu H, et al. (2006) "Impaired function and expression of P-glycoprotein in blood-brain barrier of streptozotocin-induced diabetic rats." Brain Res. 1123(1):245-252. PMID:17074306
  28. [ + ] Lee CH, et al. (2005) "Identification of in vivo P-glycoprotein mRNA decay intermediates in normal liver but not in liver tumors." J Cell Physiol. 204(2):638-645. PMID:15744753
  29. [ + ] Berezowski V, et al. (2004) "Contribution of glial cells and pericytes to the mRNA profiles of P-glycoprotein and multidrug resistance-associated proteins in an in vitro model of the blood-brain barrier." Brain Res. 1018(1):1-9. PMID:15262198
  30. [ + ] Ramos AJ, et al. (2004) "Transient expression of MDR-1/P-glycoprotein in a model of partial cortical devascularization." Cell Mol Neurobiol. 24(1):101-107. PMID:15049514
  31. [ + ] Lazarowski A, et al. (2004) "Neuronal and glial expression of the multidrug resistance gene product in an experimental epilepsy model." Cell Mol Neurobiol. 24(1):77-85. PMID:15049512
  32. [ + ] Warrington JS, et al. (2004) "The effect of age on P-glycoprotein expression and function in the Fischer-344 rat." J Pharmacol Exp Ther. 309(2):730-736. PMID:14757850
  33. [ + ] van Vliet E, et al. (2004) "Selective and persistent upregulation of mdr1b mRNA and P-glycoprotein in the parahippocampal cortex of chronic epileptic rats." Epilepsy Res. 60(2-3):203-213. PMID:15380564
  34. [ + ] Mercier C, et al. (2004) "Expression of P-glycoprotein (ABCB1) and Mrp1 (ABCC1) in adult rat brain: focus on astrocytes." Brain Res. 1021(1):32-40. PMID:15328029
  35. [ + ] Frota ML Jr, et al. (2004) "Retinol-induced mdr1 and mdr3 modulation in cultured rat Sertoli cells is attenuated by free radical scavengers." Redox Rep. 9(3):161-165. PMID:15327746
  36. [ + ] Ortiz DF, et al. (2004) "Identification of HAX-1 as a protein that binds bile salt export protein and regulates its abundance in the apical membrane of Madin-Darby canine kidney cells." J Biol Chem. 279(31):32761-32770. PMID:15159385
  37. [ + ] Pavek P, et al. (2003) "Examination of the functional activity of P-glycoprotein in the rat placental barrier using rhodamine 123." J Pharmacol Exp Ther. 305(3):1239-1250. PMID:12626638
  38. [ + ] Al-Shawi MK, et al. (2003) "Transition state analysis of the coupling of drug transport to ATP hydrolysis by P-glycoprotein." J Biol Chem. 278(52):52629-52640. PMID:14551217
  39. [ + ] Mercier C, et al. (2003) "P-glycoprotein (ABCB1) but not multidrug resistance-associated protein 1 (ABCC1) is induced by doxorubicin in primary cultures of rat astrocytes." J Neurochem. 87(4):820-830. PMID:14622113
  40. [ + ] Tygstrup N, et al. (2002) "Messenger RNA profiles in liver injury and stress: a comparison of lethal and nonlethal rat models." Biochem Biophys Res Commun. 290(1):518-525. PMID:11779202
  41. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  42. [ + ] Yang Z, et al. (2002) "Cloning and characterization of the rat multidrug resistance-associated protein 1." AAPS PharmSci. 4(3):E15. PMID:12423064
  43. [ + ] Patel VA, et al. (2002) "Regulation of MDR-1 (P-glycoprotein) by cyclooxygenase-2." J Biol Chem. 277(41):38915-38920. PMID:12138126
  44. [ + ] Walentinsson A, et al. (2001) "A dual-color FISH gene map of the proximal region of rat Chromosome 4 and comparative analysis in human and mouse." Mamm Genome. 12(12):900-908. PMID:11707776
  45. [ + ] Walentinsson A, et al. (2001) "Independent amplification of two gene clusters on chromosome 4 in rat endometrial cancer: identification and molecular characterization." Cancer Res. 61(22):8263-8273. PMID:11719459
  46. [ + ] Kipp H, et al. (2000) "Newly synthesized canalicular ABC transporters are directly targeted from the Golgi to the hepatocyte apical domain in rat liver." J Biol Chem. 275(21):15917-15925. PMID:10748167
  47. [ + ] Trezise AE, et al. (1992) "The multidrug resistance and cystic fibrosis genes have complementary patterns of epithelial expression." EMBO J. 11(12):4291-4303. PMID:1385112
  48. [ + ] Deuchars KL, et al. (1992) "Identification of distinct P-glycoprotein gene sequences in rat." Biochim Biophys Acta. 1130(2):157-165. PMID:1348630
  49. [ + ] Silverman JA, et al. (1991) "Cloning and characterization of a member of the rat multidrug resistance (mdr) gene family." Gene. 106(2):229-236. PMID:1682220