Aard | GeneID:246323 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 246323 Official Symbol Aard
Locus N/A Gene Type protein-coding
Synonyms A5D3
Full Name alanine and arginine rich domain containing protein
Description alanine and arginine rich domain containing protein
Chromosome 7q31
Also Known As A5D3 protein
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 17041

ID Symbol Protein Species
GeneID:239435 Aard NP_780712.2 Mus musculus
GeneID:246323 Aard NP_659561.1 Rattus norvegicus
GeneID:441376 LOC441376 NP_001020528.1 Homo sapiens
GeneID:464347 LOC464347 XP_519917.2 Pan troglodytes
GeneID:616184 LOC616184 XP_873245.1 Bos taurus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0030324 Process lung development

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_145093  UCSC Browser NP_659561

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000006257 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENSRNOT00000006257 MI0003630 hsa-miR-548c-5p AAAAGUAAUUGCGGUUUUUGCC
ENSRNOT00000006257 MI0003668 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSRNOT00000006257 MI0003671 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSRNOT00000006257 MI0003565 hsa-miR-559 UAAAGUAAAUAUGCACCAAAA
ENSRNOT00000006257 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENSRNOT00000006257 MI0005756 hsa-miR-934 UGUCUACUACUGGAGACACUGG
ENSRNOT00000006257 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU
ENSRNOT00000006257 MI0000177 mmu-miR-155 UUAAUGCUAAUUGUGAUAGGGGU
ENSRNOT00000006257 MI0005555 mmu-miR-544 AUUCUGCAUUUUUAGCAAGCUC
ENSRNOT00000006257 MI0000832 rno-let-7e* CUAUACGGCCUCCUAGCUUUCC
ENSRNOT00000006257 MI0000915 rno-miR-142-5p CAUAAAGUAGAAAGCACUACU
ENSRNOT00000006257 MI0000843 rno-miR-15b UAGCAGCACAUCAUGGUUUACA
ENSRNOT00000006257 MI0000850 rno-miR-21* CAACAGCAGUCGAUGGGCUGUC
ENSRNOT00000006257 MI0000959 rno-miR-219-1-3p AGAGUUGCGUCUGGACGUCCCG
ENSRNOT00000006257 MI0000854 rno-miR-24-1* GUGCCUACUGAGCUGAUAUCAG
ENSRNOT00000006257 MI0000855 rno-miR-24-2* GUGCCUACUGAGCUGAAACAGU
ENSRNOT00000006257 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU
ENSRNOT00000006257 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA
ENSRNOT00000006257 MI0001731 rno-miR-451 AAACCGUUACCAUUACUGAGUU
ENSRNOT00000006257 MI0000838 rno-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSRNOT00000006257 MI0000839 rno-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSRNOT00000006257 MI0000840 rno-miR-9 UCUUUGGUUAUCUAGCUGUAUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Blomberg LA, et al. (2002) "Molecular cloning and characterization of a novel gene upregulated early during postnatal rat lung development." Biochim Biophys Acta. 1574(3):391-398. PMID:11997109