FRK | GeneID:2444 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2444 Official Symbol FRK
Locus N/A Gene Type protein-coding
Synonyms GTK; PTK5; RAK
Full Name fyn-related kinase
Description fyn-related kinase
Chromosome 6q21-q22.3
Also Known As OTTHUMP00000017048; PTK5 protein tyrosine kinase 5; nuclear tyrosine protein kinase RAK; tyrosine-protein kinase FRK
Summary The protein encoded by this gene belongs to the TYR family of protein kinases. This tyrosine kinase is a nuclear protein and may function during G1 and S phase of the cell cycle and suppress growth. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 48065

ID Symbol Protein Species
GeneID:2444 FRK NP_002022.1 Homo sapiens
GeneID:14302 Frk NP_034367.2 Mus musculus
GeneID:35524 Src42A NP_724441.1 Drosophila melanogaster
GeneID:79209 Frk NP_077344.1 Rattus norvegicus
GeneID:173296 src-2 NP_493502.1 Caenorhabditis elegans
GeneID:421747 FRK XP_419779.2 Gallus gallus
GeneID:462953 FRK XP_518702.2 Pan troglodytes
GeneID:481970 FRK XP_539091.2 Canis lupus familiaris
GeneID:509227 FRK XP_586141.3 Bos taurus
GeneID:567549 LOC567549 XP_695937.3 Danio rerio
GeneID:1276925 AgaP_AGAP006270 XP_316335.1 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab70426 FRK antibody [1A8H2C12] (ab70426); Mouse monoclonal [1A8H2C12] to FRK
2 abcam ab64914 FRK antibody (ab64914); Rabbit polyclonal to FRK
3 abgent AP7708a FRK Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
4 acris AP14466PU-N FRK (N-term); antibody Ab
5 acris AP06691PU-N FRK / RAK / PTK5; antibody Ab
6 scbt FRK FRK Antibody / FRK Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of FRK Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FRK Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005622 Component intracellular
GO:0005634 Component nucleus
GO:0005524 Function ATP binding
GO:0004715 Function non-membrane spanning protein tyrosine kinase activity
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0016740 Function transferase activity
GO:0008285 Process negative regulation of cell proliferation
GO:0006468 Process protein amino acid phosphorylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_002031  UCSC Browser NP_002022

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000368626 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000368626 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000368626 MI0000810 hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENST00000368626 MI0000458 hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
ENST00000368626 MI0000463 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000368626 MI0000464 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000368626 MI0000075 hsa-miR-19b-2* AGUUUUGCAGGUUUGCAUUUCA
ENST00000368626 MI0000285 hsa-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENST00000368626 MI0000288 hsa-miR-212 UAACAGUCUCCAGUCACGGCC
ENST00000368626 MI0000294 hsa-miR-218 UUGUGCUUGAUCUAACCAUGU
ENST00000368626 MI0000295 hsa-miR-218 UUGUGCUUGAUCUAACCAUGU
ENST00000368626 MI0000079 hsa-miR-23a AUCACAUUGCCAGGGAUUUCC
ENST00000368626 MI0000439 hsa-miR-23b AUCACAUUGCCAGGGAUUACC
ENST00000368626 MI0000773 hsa-miR-302c* UUUAACAUGGGGGUACCUGCUG
ENST00000368626 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENST00000368626 MI0000777 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENST00000368626 MI0000777 hsa-miR-369-5p AGAUCGACCGUGUUAUAUUCGC
ENST00000368626 MI0000780 hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU
ENST00000368626 MI0000782 hsa-miR-374a UUAUAAUACAACCUGAUAAGUG
ENST00000368626 MI0002466 hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU
ENST00000368626 MI0003675 hsa-miR-411 UAGUAGACCGUAUAGCGUACG
ENST00000368626 MI0001721 hsa-miR-431* CAGGUCGUCUUGCAGGGCUUCU
ENST00000368626 MI0001652 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000368626 MI0003187 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000368626 MI0005531 hsa-miR-450b-5p UUUUGCAAUAUGUUCCUGAAUA
ENST00000368626 MI0003198 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000368626 MI0003199 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000368626 MI0003200 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000368626 MI0003595 hsa-miR-587 UUUCCAUAGGUGAUGAGUCAC
ENST00000368626 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENST00000368626 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENST00000368626 MI0005714 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AK302264   AK313314   BC012916   DQ894643   NM_002031   U00803   U22322  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.579C>A1
Primary Site / Histology (Top 10)Mutations (sites * observations)
lung / carcinoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
arsenic trioxide
  • arsenic trioxide results in decreased expression of FRK mRNA
15761015
pirinixic acid
  • pirinixic acid results in increased expression of FRK mRNA
17426115

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Adenocarcinoma inferred via arsenic trioxide 11798837
Blood Coagulation Disorders inferred via arsenic trioxide 16206674
Burkitt Lymphoma inferred via arsenic trioxide 11589617
Carcinoma, Hepatocellular inferred via arsenic trioxide 16217749, 15073043, 11135700, 14691202, 15553829
Carcinoma, Small Cell inferred via arsenic trioxide 12490120
Coronary Restenosis inferred via arsenic trioxide 12609071
Death, Sudden, Cardiac inferred via arsenic trioxide 15213294
Esophageal Neoplasms inferred via arsenic trioxide 12903497
Fatty Liver inferred via arsenic trioxide 15073043
Gallbladder Neoplasms inferred via arsenic trioxide 16904648
Leukemia inferred via arsenic trioxide 15070760
Leukemia-Lymphoma, Adult T-Cell inferred via arsenic trioxide 12560223, 17077332
Leukemia, Monocytic, Acute inferred via arsenic trioxide 16972261
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via arsenic trioxide 14633726
Leukemia, Myeloid, Acute inferred via arsenic trioxide 16467208, 16968895, 17050201
Leukemia, Promyelocytic, Acute inferred via arsenic trioxide 16891316, 11161223, 16331271, 17217047, 17107899, 15748426, 15336539, 15213294, 12679006, 11468182, 12712474, 16823087, 16330433, 15622746, 16966277
Leukemia, T-Cell inferred via arsenic trioxide 16882451
Liver Neoplasms inferred via arsenic trioxide 14682389
Long QT Syndrome inferred via arsenic trioxide 15213294
Lung Neoplasms inferred via arsenic trioxide 11798837
Multiple Myeloma inferred via arsenic trioxide 15949261, 11468182, 14977855
Myelodysplastic Syndromes inferred via arsenic trioxide 16105982, 16882451
Neoplasm Invasiveness inferred via arsenic trioxide 16624393
Ovarian Neoplasms inferred via arsenic trioxide 16624393, 12452020
Pancreatic Neoplasms inferred via arsenic trioxide 15580305
Sarcoma, Ewing's inferred via arsenic trioxide 16646077
Stomach Neoplasms inferred via arsenic trioxide 17007042
Torsades de Pointes inferred via arsenic trioxide 15213294
Urinary Bladder Neoplasms inferred via arsenic trioxide 12973940, 11780464, 12845720

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
RB1 FRK / RB1 Affinity Capture-Western Craven RJ (1995)
RB1 FRK / RB1 Reconstituted Complex Craven RJ (1995)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Yim EK, et al. (2009) "Rak functions as a tumor suppressor by regulating PTEN protein stability and function." Cancer Cell. 15(4):304-314. PMID:19345329
  2. [ + ] Zhang Y, et al. (2005) "Time-resolved mass spectrometry of tyrosine phosphorylation sites in the epidermal growth factor receptor signaling network reveals dynamic modules." Mol Cell Proteomics. 4(9):1240-1250. PMID:15951569
  3. [ + ] Watanabe T, et al. (2004) "No genetic association between Fyn kinase gene polymorphisms (-93A/G, IVS10+37T/C and Ex12+894T/G) and Japanese sporadic Alzheimer's disease." Neurosci Lett. 360(1-2):109-111. PMID:15082191
  4. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  5. [ + ] Serfas MS, et al. (2003) "Brk, Srm, Frk, and Src42A form a distinct family of intracellular Src-like tyrosine kinases." Oncol Res. 13(6-10):409-419. PMID:12725532
  6. [ + ] Meyer T, et al. (2003) "Breast cancer cell line proliferation blocked by the Src-related Rak tyrosine kinase." Int J Cancer. 104(2):139-146. PMID:12569567
  7. [ + ] Ohnuma T, et al. (2003) "No genetic association between polymorphisms in the Fyn kinase gene and age of schizophrenic onset." Neurosci Lett. 343(1):70-72. PMID:12750000
  8. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  9. [ + ] Craven RJ, et al. (1995) "The nuclear tyrosine kinase Rak associates with the retinoblastoma protein pRb." Cancer Res. 55(18):3969-3972. PMID:7664264
  10. [ + ] Cance WG, et al. (1994) "Rak, a novel nuclear tyrosine kinase expressed in epithelial cells." Cell Growth Differ. 5(12):1347-1355. PMID:7696183
  11. [ + ] Lee J, et al. (1994) "Cloning of FRK, a novel human intracellular SRC-like tyrosine kinase-encoding gene." Gene. 138(1-2):247-251. PMID:7510261
  12. [ + ] Cance WG, et al. (1993) "Novel protein kinases expressed in human breast cancer." Int J Cancer. 54(4):571-577. PMID:8099900