Grin2a | GeneID:24409 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 24409 Official Symbol Grin2a
Locus N/A Gene Type protein-coding
Synonyms NMDAR2A; NR2A
Full Name glutamate receptor, ionotropic, N-methyl D-aspartate 2A
Description glutamate receptor, ionotropic, N-methyl D-aspartate 2A
Chromosome 10q11
Also Known As N-methyl-D-aspartate receptor subunit 2A
Summary may play a role in synaptic transmission, learning and memory [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 645

ID Symbol Protein Species
GeneID:2903 GRIN2A NP_000824.1 Homo sapiens
GeneID:14811 Grin2a NP_032196.2 Mus musculus
GeneID:24409 Grin2a NP_036705.2 Rattus norvegicus
GeneID:427678 GRIN2A XP_425252.2 Gallus gallus
GeneID:454396 GRIN2A NP_001029361.1 Pan troglodytes
GeneID:490012 GRIN2A XP_547132.2 Canis lupus familiaris
GeneID:563297 CH211-13C14.1 XP_691754.2 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab16647 NMDAR2A (phospho Y1387) antibody (ab16647); Rabbit polyclonal to NMDAR2A (phospho Y1387)
2 abcam ab65799 NMDAR2A antibody - Carboxyterminal end (ab65799); Rabbit polyclonal to NMDAR2A - Carboxyterminal end
3 abcam ab16644 NMDAR2A (phospho Y1292) antibody (ab16644); Rabbit polyclonal to NMDAR2A (phospho Y1292)
4 abcam ab16646 NMDAR2A (phospho Y1325) antibody (ab16646); Rabbit polyclonal to NMDAR2A (phospho Y1325)
5 abcam ab14596 NMDAR2A antibody (ab14596); Rabbit polyclonal to NMDAR2A
6 abcam ab73000 NMDAR2A antibody (ab73000); Rabbit polyclonal to NMDAR2A
7 sigma M264 Anti-Glutamate Receptor NMDAR2A (NR2A) antibody produced in rabbit ;
8 sigma G9038 Anti-Glutamate Receptor NMDAR2A (NR2A) antibody produced in rabbit ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0030054 Component cell junction
GO:0005737 Component cytoplasm
GO:0016021 Component integral to membrane
GO:0005624 Component membrane fraction
GO:0043005 Component neuron projection
GO:0017146 Component N-methyl-D-aspartate selective glutamate receptor complex
GO:0005886 Component plasma membrane
GO:0014069 Component postsynaptic density
GO:0045211 Component postsynaptic membrane
GO:0042734 Component presynaptic membrane
GO:0045202 Component synapse
GO:0019717 Component synaptosome
GO:0005262 Function calcium channel activity
GO:0005509 Function calcium ion binding
GO:0005261 Function cation channel activity
GO:0050839 Function cell adhesion molecule binding
GO:0005234 Function extracellular-glutamate-gated ion channel activity
GO:0016595 Function glutamate binding
GO:0004970 Function ionotropic glutamate receptor activity
GO:0000287 Function magnesium ion binding
GO:0042165 Function neurotransmitter binding
GO:0004972 Function N-methyl-D-aspartate selective glutamate receptor activity
GO:0005515 Function protein binding
GO:0004872 Function receptor activity
GO:0022843 Function voltage-gated cation channel activity
GO:0006816 Process calcium ion transport
GO:0050966 Process detection of mechanical stimulus involved in sensory perception of pain
GO:0033058 Process directional locomotion
GO:0042417 Process dopamine metabolic process
GO:0035235 Process ionotropic glutamate receptor signaling pathway
GO:0006811 Process ion transport
GO:0007612 Process learning
GO:0007611 Process learning or memory
GO:0040011 Process locomotion
GO:0007613 Process memory
GO:0042177 Process negative regulation of protein catabolic process
GO:0022008 Process neurogenesis
GO:0043065 Process positive regulation of apoptosis
GO:0008104 Process protein localization
GO:0001508 Process regulation of action potential
GO:0060079 Process regulation of excitatory postsynaptic membrane potential
GO:0048169 Process regulation of long-term neuronal synaptic plasticity
GO:0042391 Process regulation of membrane potential
GO:0060078 Process regulation of postsynaptic membrane potential
GO:0051930 Process regulation of sensory perception of pain
GO:0048167 Process regulation of synaptic plasticity
GO:0001975 Process response to amphetamine
GO:0042493 Process response to drug
GO:0045471 Process response to ethanol
GO:0009611 Process response to wounding
GO:0048511 Process rhythmic process
GO:0019233 Process sensory perception of pain
GO:0042428 Process serotonin metabolic process
GO:0030431 Process sleep
GO:0001964 Process startle response
GO:0007268 Process synaptic transmission
GO:0008542 Process visual learning

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_012573  UCSC Browser NP_036705

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000044626 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENSRNOT00000044626 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENSRNOT00000044626 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENSRNOT00000044626 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENSRNOT00000044626 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENSRNOT00000044626 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENSRNOT00000044626 MI0003584 hsa-miR-577 UAGAUAAAAUAUUGGUACCUG
ENSRNOT00000044626 MI0003644 hsa-miR-630 AGUAUUCUGUACCAGGGAAGGU
ENSRNOT00000044626 MI0003655 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU
ENSRNOT00000044626 MI0003763 hsa-miR-767-5p UGCACCAUGGUUGUCUGAGCAUG
ENSRNOT00000044626 MI0000763 mmu-miR-362-5p AAUCCUUGGAACCUAGGUGUGAAU
ENSRNOT00000044626 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSRNOT00000044626 MI0003493 mmu-miR-486 UCCUGUACUGAGCUGCCCCGAG
ENSRNOT00000044626 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENSRNOT00000044626 MI0004690 mmu-miR-706 AGAGAAACCCUGUCUCAAAAAA
ENSRNOT00000044626 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU
ENSRNOT00000044626 MI0000897 rno-miR-125b* ACAAGUCAGGCUCUUGGGACCU
ENSRNOT00000044626 MI0000909 rno-miR-136* CAUCAUCGUCUCAAAUGAGUCU
ENSRNOT00000044626 MI0000910 rno-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENSRNOT00000044626 MI0000913 rno-miR-139-5p UCUACAGUGCACGUGUCUCCAG
ENSRNOT00000044626 MI0000915 rno-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
ENSRNOT00000044626 MI0000845 rno-miR-17-3p ACUGCAGUGAAGGCACUUGUGG
ENSRNOT00000044626 MI0000953 rno-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENSRNOT00000044626 MI0000847 rno-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENSRNOT00000044626 MI0000848 rno-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENSRNOT00000044626 MI0000596 rno-miR-325-5p CCUAGUAGGUGCUCAGUAAGUGU
ENSRNOT00000044626 MI0000626 rno-miR-342-5p AGGGGUGCUAUCUGUGAUUGAG
ENSRNOT00000044626 MI0006154 rno-miR-532-5p CAUGCCUUGAGUGUAGGACUGU
ENSRNOT00000044626 MI0006120 rno-miR-878 GCAUGACACCAUACUGGGUAGA
ENSRNOT00000044626 MI0006123 rno-miR-881 AACUGUGGCAUUUCUGAAUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

D13211   M91561   NM_012573  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAC03565   AAN76450   BAA02498   CAB58540   CAC83648   EDL96236   NP_036705   Q00959   Q8CGM3   Q8VDA3  

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
DNCL1 DNCL1 / Grin2a Affinity Capture-MS Navarro-Lerida I (2004)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Tai DJ, et al. (2009) "SGK1 phosphorylation of IkappaB Kinase alpha and p300 Up-regulates NF-kappaB activity and increases N-Methyl-D-aspartate receptor NR2A and NR2B expression." J Biol Chem. 284(7):4073-4089. PMID:19088076
  2. [ + ] Liu Y, et al. (2009) "Exposure to cyclic intermittent hypoxia increases expression of functional NMDA receptors in the rat carotid body." J Appl Physiol. 106(1):259-267. PMID:18927268
  3. [ + ] Chen M, et al. (2008) "Differential roles of NMDA receptor subtypes in ischemic neuronal cell death and ischemic tolerance." Stroke. 39(11):3042-3048. PMID:18688011
  4. [ + ] Nunez-Jaramillo L, et al. (2008) "Taste novelty induces intracellular redistribution of NR2A and NR2B subunits of NMDA receptor in the insular cortex." Brain Res. 1215():116-122. PMID:18468585
  5. [ + ] Walker DL, et al. (2008) "Amygdala infusions of an NR2B-selective or an NR2A-preferring NMDA receptor antagonist differentially influence fear conditioning and expression in the fear-potentiated startle test." Learn Mem. 15(2):67-74. PMID:18230675
  6. [ + ] Li YH, et al. (2008) "Glycine modulates synaptic NR2A- and NR2B-containing NMDA receptor-mediated responses in the rat visual cortex." Brain Res. 1190():49-55. PMID:18048007
  7. [ + ] Wrighton DC, et al. (2008) "Mg2+ and memantine block of rat recombinant NMDA receptors containing chimeric NR2A/2D subunits expressed in Xenopus laevis oocytes." J Physiol. 586(1):211-225. PMID:17962329
  8. [ + ] Liu P, et al. (2008) "Glutamate receptor subunits expression in memory-associated brain structures: regional variations and effects of aging." Synapse. 62(11):834-841. PMID:18720514
  9. [ + ] Gascon S, et al. (2008) "Excitotoxicity and focal cerebral ischemia induce truncation of the NR2A and NR2B subunits of the NMDA receptor and cleavage of the scaffolding protein PSD-95." Mol Psychiatry. 13(1):99-114. PMID:17486105
  10. [ + ] Bartlett TE, et al. (2007) "Differential roles of NR2A and NR2B-containing NMDA receptors in LTP and LTD in the CA1 region of two-week old rat hippocampus." Neuropharmacology. 52(1):60-70. PMID:16904707
  11. [ + ] Andin J, et al. (2007) "Influence of environmental enrichment on steady-state mRNA levels for EAAC1, AMPA1 and NMDA2A receptor subunits in rat hippocampus." Brain Res. 1174():18-27. PMID:17854777
  12. [ + ] Alilain WJ, et al. (2007) "MK-801 upregulates NR2A protein levels and induces functional recovery of the ipsilateral hemidiaphragm following acute C2 hemisection in adult rats." J Spinal Cord Med. 30(4):346-354. PMID:17853656
  13. [ + ] Harris AZ, et al. (2007) "Extrasynaptic and synaptic NMDA receptors form stable and uniform pools in rat hippocampal slices." J Physiol. 584(Pt 2):509-519. PMID:17717018
  14. [ + ] Li R, et al. (2007) "Role of NMDA receptor subtypes in different forms of NMDA-dependent synaptic plasticity." BMC Neurosci. 8():55. PMID:17655746
  15. [ + ] Chen Q, et al. (2007) "Differential roles of NR2A- and NR2B-containing NMDA receptors in activity-dependent brain-derived neurotrophic factor gene regulation and limbic epileptogenesis." J Neurosci. 27(3):542-552. PMID:17234586
  16. [ + ] Gascon S, et al. (2007) "Endoplasmic reticulum-associated degradation of the NR1 but not the NR2 subunits of the N-methyl-D-aspartate receptor induced by inhibition of the N-glycosylation in cortical neurons." J Neurosci Res. 85(8):1713-1723. PMID:17455306
  17. [ + ] Rossbach UL, et al. (2007) "Nandrolone-induced hippocampal phosphorylation of NMDA receptor subunits and ERKs." Biochem Biophys Res Commun. 357(4):1028-1033. PMID:17451646
  18. [ + ] Yang W, et al. (2007) "A three amino acid tail following the TM4 region of the N-methyl-D-aspartate receptor (NR) 2 subunits is sufficient to overcome endoplasmic reticulum retention of NR1-1a subunit." J Biol Chem. 282(12):9269-9278. PMID:17255096
  19. [ + ] Fantin M, et al. (2007) "NR2A and NR2B subunit containing NMDA receptors differentially regulate striatal output pathways." J Neurochem. 103(6):2200-2211. PMID:17986236
  20. [ + ] Zhou M, et al. (2006) "Developmental changes in NMDA neurotoxicity reflect developmental changes in subunit composition of NMDA receptors." J Neurosci. 26(11):2956-2963. PMID:16540573
  21. [ + ] Xing GG, et al. (2006) "Postnatal switching of NMDA receptor subunits from NR2B to NR2A in rat facial motor neurons." Eur J Neurosci. 24(11):2987-2992. PMID:17156360
  22. [ + ] Groc L, et al. (2006) "NMDA receptor surface mobility depends on NR2A-2B subunits." Proc Natl Acad Sci U S A. 103(49):18769-18774. PMID:17124177
  23. [ + ] Qian A, et al. (2006) "Permeant ion effects on external Mg2+ block of NR1/2D NMDA receptors." J Neurosci. 26(42):10899-10910. PMID:17050728
  24. [ + ] Lebel D, et al. (2006) "Learning in the absence of experience-dependent regulation of NMDAR composition." Learn Mem. 13(5):566-570. PMID:16980547
  25. [ + ] Wyllie DJ, et al. (2006) "Single-channel analysis of a point mutation of a conserved serine residue in the S2 ligand-binding domain of the NR2A NMDA receptor subunit." J Physiol. 574(Pt 2):477-489. PMID:16709630
  26. [ + ] Gardoni F, et al. (2006) "A critical interaction between NR2B and MAGUK in L-DOPA induced dyskinesia." J Neurosci. 26(11):2914-2922. PMID:16540568
  27. [ + ] Ishihama K, et al. (2005) "Prenatal development of NMDA receptor composition and function in trigeminal neurons." Arch Histol Cytol. 68(4):321-335. PMID:16477151
  28. [ + ] Kurko D, et al. (2005) "Inducible expression and pharmacological characterization of recombinant rat NR1a/NR2A NMDA receptors." Neurochem Int. 46(5):369-379. PMID:15737435
  29. [ + ] Wu HY, et al. (2005) "Regulation of N-methyl-D-aspartate receptors by calpain in cortical neurons." J Biol Chem. 280(22):21588-21593. PMID:15790561
  30. [ + ] Sutcu R, et al. (2005) "Effects of ischemia-reperfusion on NMDA receptor subunits 2a and 2b level in rat hippocampus." Int J Neurosci. 115(3):305-314. PMID:15804717
  31. [ + ] Qiu S, et al. (2005) "Subunit assembly of N-methyl-d-aspartate receptors analyzed by fluorescence resonance energy transfer." J Biol Chem. 280(26):24923-24930. PMID:15888440
  32. [ + ] Cahusac PM, et al. (2005) "Are unconventional NMDA receptors involved in slowly adapting type I mechanoreceptor responses?" Neuroscience. 133(3):763-773. PMID:15908129
  33. [ + ] Kim MJ, et al. (2005) "Differential roles of NR2A- and NR2B-containing NMDA receptors in Ras-ERK signaling and AMPA receptor trafficking." Neuron. 46(5):745-760. PMID:15924861
  34. [ + ] Waxman EA, et al. (2005) "N-methyl-D-aspartate receptor subtype mediated bidirectional control of p38 mitogen-activated protein kinase." J Biol Chem. 280(32):29322-29333. PMID:15967799
  35. [ + ] Furukawa H, et al. (2005) "Subunit arrangement and function in NMDA receptors." Nature. 438(7065):185-192. PMID:16281028
  36. [ + ] Mallon AP, et al. (2005) "Selective subunit antagonists suggest an inhibitory relationship between NR2B and NR2A-subunit containing N-methyl-D: -aspartate receptors in hippocampal slices." Exp Brain Res. 162(3):374-383. PMID:15580338
  37. [ + ] Erreger K, et al. (2005) "Subunit-specific gating controls rat NR1/NR2A and NR1/NR2B NMDA channel kinetics and synaptic signalling profiles." J Physiol. 563(Pt 2):345-358. PMID:15649985
  38. [ + ] Nagy GG, et al. (2004) "Synaptic distribution of the NR1, NR2A and NR2B subunits of the N-methyl-d-aspartate receptor in the rat lumbar spinal cord revealed with an antigen-unmasking technique." Eur J Neurosci. 20(12):3301-3312. PMID:15610162
  39. [ + ] Papadakis M, et al. (2004) "Appropriate NR1-NR1 disulfide-linked homodimer formation is requisite for efficient expression of functional, cell surface N-methyl-D-aspartate NR1/NR2 receptors." J Biol Chem. 279(15):14703-14712. PMID:14732708
  40. [ + ] Navarro-Lerida I, et al. (2004) "Proteomic identification of brain proteins that interact with dynein light chain LC8." Proteomics. 4(2):339-346. PMID:14760703
  41. [ + ] Schulz D, et al. (2004) "Behavioural parameters in aged rats are related to LTP and gene expression of ChAT and NMDA-NR2 subunits in the striatum." Eur J Neurosci. 19(5):1373-1383. PMID:15016095
  42. [ + ] Liu L, et al. (2004) "Role of NMDA receptor subtypes in governing the direction of hippocampal synaptic plasticity." Science. 304(5673):1021-1024. PMID:15143284
  43. [ + ] Lee MC, et al. (2004) "Upregulation of glutamate receptors in rat cerebral cortex with neuronal migration disorders." J Korean Med Sci. 19(3):419-425. PMID:15201510
  44. [ + ] Popescu G, et al. (2004) "Reaction mechanism determines NMDA receptor response to repetitive stimulation." Nature. 430(7001):790-793. PMID:15306812
  45. [ + ] Massey PV, et al. (2004) "Differential roles of NR2A and NR2B-containing NMDA receptors in cortical long-term potentiation and long-term depression." J Neurosci. 24(36):7821-7828. PMID:15356193
  46. [ + ] Yang L, et al. (2004) "A novel Ca2+-independent signaling pathway to extracellular signal-regulated protein kinase by coactivation of NMDA receptors and metabotropic glutamate receptor 5 in neurons." J Neurosci. 24(48):10846-10857. PMID:15574735
  47. [ + ] Moon IS, et al. (2003) "Relative extent of tyrosine phosphorylation of the NR2A and NR2B subunits in the rat forebrain postsynaptic density fraction." Mol Cells. 16(1):28-33. PMID:14503841
  48. [ + ] Nagy J, et al. (2003) "Differential alterations in the expression of NMDA receptor subunits following chronic ethanol treatment in primary cultures of rat cortical and hippocampal neurones." Neurochem Int. 42(1):35-43. PMID:12441166
  49. [ + ] Gardoni F, et al. (2003) "CaMKII-dependent phosphorylation regulates SAP97/NR2A interaction." J Biol Chem. 278(45):44745-44752. PMID:12933808
  50. [ + ] Dalby NO, et al. (2003) "Activation of NMDA receptors in rat dentate gyrus granule cells by spontaneous and evoked transmitter release." J Neurophysiol. 90(2):786-797. PMID:12904493