Grin2a | GeneID:24409 | Rattus norvegicus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 24409 | Official Symbol | Grin2a |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | NMDAR2A; NR2A | ||
| Full Name | glutamate receptor, ionotropic, N-methyl D-aspartate 2A | ||
| Description | glutamate receptor, ionotropic, N-methyl D-aspartate 2A | ||
| Chromosome | 10q11 | ||
| Also Known As | N-methyl-D-aspartate receptor subunit 2A | ||
| Summary | may play a role in synaptic transmission, learning and memory [RGD] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 645
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:2903 | GRIN2A | NP_000824.1 | Homo sapiens |
| GeneID:14811 | Grin2a | NP_032196.2 | Mus musculus |
| GeneID:24409 | Grin2a | NP_036705.2 | Rattus norvegicus |
| GeneID:427678 | GRIN2A | XP_425252.2 | Gallus gallus |
| GeneID:454396 | GRIN2A | NP_001029361.1 | Pan troglodytes |
| GeneID:490012 | GRIN2A | XP_547132.2 | Canis lupus familiaris |
| GeneID:563297 | CH211-13C14.1 | XP_691754.2 | Danio rerio |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | abcam | ab16647 | NMDAR2A (phospho Y1387) antibody (ab16647); Rabbit polyclonal to NMDAR2A (phospho Y1387) |
| 2 | abcam | ab65799 | NMDAR2A antibody - Carboxyterminal end (ab65799); Rabbit polyclonal to NMDAR2A - Carboxyterminal end |
| 3 | abcam | ab16644 | NMDAR2A (phospho Y1292) antibody (ab16644); Rabbit polyclonal to NMDAR2A (phospho Y1292) |
| 4 | abcam | ab16646 | NMDAR2A (phospho Y1325) antibody (ab16646); Rabbit polyclonal to NMDAR2A (phospho Y1325) |
| 5 | abcam | ab14596 | NMDAR2A antibody (ab14596); Rabbit polyclonal to NMDAR2A |
| 6 | abcam | ab73000 | NMDAR2A antibody (ab73000); Rabbit polyclonal to NMDAR2A |
| 7 | sigma | M264 | Anti-Glutamate Receptor NMDAR2A (NR2A) antibody produced in rabbit ; |
| 8 | sigma | G9038 | Anti-Glutamate Receptor NMDAR2A (NR2A) antibody produced in rabbit ; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0030054 | Component | cell junction |
| GO:0005737 | Component | cytoplasm |
| GO:0016021 | Component | integral to membrane |
| GO:0005624 | Component | membrane fraction |
| GO:0043005 | Component | neuron projection |
| GO:0017146 | Component | N-methyl-D-aspartate selective glutamate receptor complex |
| GO:0005886 | Component | plasma membrane |
| GO:0014069 | Component | postsynaptic density |
| GO:0045211 | Component | postsynaptic membrane |
| GO:0042734 | Component | presynaptic membrane |
| GO:0045202 | Component | synapse |
| GO:0019717 | Component | synaptosome |
| GO:0005262 | Function | calcium channel activity |
| GO:0005509 | Function | calcium ion binding |
| GO:0005261 | Function | cation channel activity |
| GO:0050839 | Function | cell adhesion molecule binding |
| GO:0005234 | Function | extracellular-glutamate-gated ion channel activity |
| GO:0016595 | Function | glutamate binding |
| GO:0004970 | Function | ionotropic glutamate receptor activity |
| GO:0000287 | Function | magnesium ion binding |
| GO:0042165 | Function | neurotransmitter binding |
| GO:0004972 | Function | N-methyl-D-aspartate selective glutamate receptor activity |
| GO:0005515 | Function | protein binding |
| GO:0004872 | Function | receptor activity |
| GO:0022843 | Function | voltage-gated cation channel activity |
| GO:0006816 | Process | calcium ion transport |
| GO:0050966 | Process | detection of mechanical stimulus involved in sensory perception of pain |
| GO:0033058 | Process | directional locomotion |
| GO:0042417 | Process | dopamine metabolic process |
| GO:0035235 | Process | ionotropic glutamate receptor signaling pathway |
| GO:0006811 | Process | ion transport |
| GO:0007612 | Process | learning |
| GO:0007611 | Process | learning or memory |
| GO:0040011 | Process | locomotion |
| GO:0007613 | Process | memory |
| GO:0042177 | Process | negative regulation of protein catabolic process |
| GO:0022008 | Process | neurogenesis |
| GO:0043065 | Process | positive regulation of apoptosis |
| GO:0008104 | Process | protein localization |
| GO:0001508 | Process | regulation of action potential |
| GO:0060079 | Process | regulation of excitatory postsynaptic membrane potential |
| GO:0048169 | Process | regulation of long-term neuronal synaptic plasticity |
| GO:0042391 | Process | regulation of membrane potential |
| GO:0060078 | Process | regulation of postsynaptic membrane potential |
| GO:0051930 | Process | regulation of sensory perception of pain |
| GO:0048167 | Process | regulation of synaptic plasticity |
| GO:0001975 | Process | response to amphetamine |
| GO:0042493 | Process | response to drug |
| GO:0045471 | Process | response to ethanol |
| GO:0009611 | Process | response to wounding |
| GO:0048511 | Process | rhythmic process |
| GO:0019233 | Process | sensory perception of pain |
| GO:0042428 | Process | serotonin metabolic process |
| GO:0030431 | Process | sleep |
| GO:0001964 | Process | startle response |
| GO:0007268 | Process | synaptic transmission |
| GO:0008542 | Process | visual learning |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSRNOT00000044626 | MI0003165 | hsa-miR-517b | UCGUGCAUCCCUUUAGAGUGUU |
| ENSRNOT00000044626 | MI0003162 | hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUG |
| ENSRNOT00000044626 | MI0003145 | hsa-miR-519e | AAGUGCCUCCUUUUAGAGUGUU |
| ENSRNOT00000044626 | MI0003149 | hsa-miR-520a-3p | AAAGUGCUUCCCUUUGGACUGU |
| ENSRNOT00000044626 | MI0003153 | hsa-miR-523 | GAACGCGCUUCCCUAUAGAGGGU |
| ENSRNOT00000044626 | MI0003563 | hsa-miR-557 | GUUUGCACGGGUGGGCCUUGUCU |
| ENSRNOT00000044626 | MI0003584 | hsa-miR-577 | UAGAUAAAAUAUUGGUACCUG |
| ENSRNOT00000044626 | MI0003644 | hsa-miR-630 | AGUAUUCUGUACCAGGGAAGGU |
| ENSRNOT00000044626 | MI0003655 | hsa-miR-640 | AUGAUCCAGGAACCUGCCUCU |
| ENSRNOT00000044626 | MI0003763 | hsa-miR-767-5p | UGCACCAUGGUUGUCUGAGCAUG |
| ENSRNOT00000044626 | MI0000763 | mmu-miR-362-5p | AAUCCUUGGAACCUAGGUGUGAAU |
| ENSRNOT00000044626 | MI0002402 | mmu-miR-467a | UAAGUGCCUGCAUGUAUAUGCG |
| ENSRNOT00000044626 | MI0003493 | mmu-miR-486 | UCCUGUACUGAGCUGCCCCGAG |
| ENSRNOT00000044626 | MI0004638 | mmu-miR-679 | GGACUGUGAGGUGACUCUUGGU |
| ENSRNOT00000044626 | MI0004690 | mmu-miR-706 | AGAGAAACCCUGUCUCAAAAAA |
| ENSRNOT00000044626 | MI0004310 | mmu-miR-764-5p | GGUGCUCACAUGUCCUCCU |
| ENSRNOT00000044626 | MI0000897 | rno-miR-125b* | ACAAGUCAGGCUCUUGGGACCU |
| ENSRNOT00000044626 | MI0000909 | rno-miR-136* | CAUCAUCGUCUCAAAUGAGUCU |
| ENSRNOT00000044626 | MI0000910 | rno-miR-137 | UUAUUGCUUAAGAAUACGCGUAG |
| ENSRNOT00000044626 | MI0000913 | rno-miR-139-5p | UCUACAGUGCACGUGUCUCCAG |
| ENSRNOT00000044626 | MI0000915 | rno-miR-142-3p | UGUAGUGUUUCCUACUUUAUGGA |
| ENSRNOT00000044626 | MI0000845 | rno-miR-17-3p | ACUGCAGUGAAGGCACUUGUGG |
| ENSRNOT00000044626 | MI0000953 | rno-miR-181a* | ACCAUCGACCGUUGAUUGUACC |
| ENSRNOT00000044626 | MI0000847 | rno-miR-19b | UGUGCAAAUCCAUGCAAAACUGA |
| ENSRNOT00000044626 | MI0000848 | rno-miR-19b | UGUGCAAAUCCAUGCAAAACUGA |
| ENSRNOT00000044626 | MI0000596 | rno-miR-325-5p | CCUAGUAGGUGCUCAGUAAGUGU |
| ENSRNOT00000044626 | MI0000626 | rno-miR-342-5p | AGGGGUGCUAUCUGUGAUUGAG |
| ENSRNOT00000044626 | MI0006154 | rno-miR-532-5p | CAUGCCUUGAGUGUAGGACUGU |
| ENSRNOT00000044626 | MI0006120 | rno-miR-878 | GCAUGACACCAUACUGGGUAGA |
| ENSRNOT00000044626 | MI0006123 | rno-miR-881 | AACUGUGGCAUUUCUGAAUAGA |
Gene Interactions
[
] BioGRID Gene Product Interaction Database
| Symbol | Interaction Binary | Experiment | Source |
|---|---|---|---|
| DNCL1 | DNCL1 / Grin2a | Affinity Capture-MS | Navarro-Lerida I (2004) |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Tai DJ, et al. (2009) "SGK1 phosphorylation of IkappaB Kinase alpha and p300 Up-regulates NF-kappaB activity and increases N-Methyl-D-aspartate receptor NR2A and NR2B expression." J Biol Chem. 284(7):4073-4089. PMID:19088076 - [
] Liu Y, et al. (2009) "Exposure to cyclic intermittent hypoxia increases expression of functional NMDA receptors in the rat carotid body." J Appl Physiol. 106(1):259-267. PMID:18927268 - [
] Chen M, et al. (2008) "Differential roles of NMDA receptor subtypes in ischemic neuronal cell death and ischemic tolerance." Stroke. 39(11):3042-3048. PMID:18688011 - [
] Nunez-Jaramillo L, et al. (2008) "Taste novelty induces intracellular redistribution of NR2A and NR2B subunits of NMDA receptor in the insular cortex." Brain Res. 1215():116-122. PMID:18468585 - [
] Walker DL, et al. (2008) "Amygdala infusions of an NR2B-selective or an NR2A-preferring NMDA receptor antagonist differentially influence fear conditioning and expression in the fear-potentiated startle test." Learn Mem. 15(2):67-74. PMID:18230675 - [
] Li YH, et al. (2008) "Glycine modulates synaptic NR2A- and NR2B-containing NMDA receptor-mediated responses in the rat visual cortex." Brain Res. 1190():49-55. PMID:18048007 - [
] Wrighton DC, et al. (2008) "Mg2+ and memantine block of rat recombinant NMDA receptors containing chimeric NR2A/2D subunits expressed in Xenopus laevis oocytes." J Physiol. 586(1):211-225. PMID:17962329 - [
] Liu P, et al. (2008) "Glutamate receptor subunits expression in memory-associated brain structures: regional variations and effects of aging." Synapse. 62(11):834-841. PMID:18720514 - [
] Gascon S, et al. (2008) "Excitotoxicity and focal cerebral ischemia induce truncation of the NR2A and NR2B subunits of the NMDA receptor and cleavage of the scaffolding protein PSD-95." Mol Psychiatry. 13(1):99-114. PMID:17486105 - [
] Bartlett TE, et al. (2007) "Differential roles of NR2A and NR2B-containing NMDA receptors in LTP and LTD in the CA1 region of two-week old rat hippocampus." Neuropharmacology. 52(1):60-70. PMID:16904707 - [
] Andin J, et al. (2007) "Influence of environmental enrichment on steady-state mRNA levels for EAAC1, AMPA1 and NMDA2A receptor subunits in rat hippocampus." Brain Res. 1174():18-27. PMID:17854777 - [
] Alilain WJ, et al. (2007) "MK-801 upregulates NR2A protein levels and induces functional recovery of the ipsilateral hemidiaphragm following acute C2 hemisection in adult rats." J Spinal Cord Med. 30(4):346-354. PMID:17853656 - [
] Harris AZ, et al. (2007) "Extrasynaptic and synaptic NMDA receptors form stable and uniform pools in rat hippocampal slices." J Physiol. 584(Pt 2):509-519. PMID:17717018 - [
] Li R, et al. (2007) "Role of NMDA receptor subtypes in different forms of NMDA-dependent synaptic plasticity." BMC Neurosci. 8():55. PMID:17655746 - [
] Chen Q, et al. (2007) "Differential roles of NR2A- and NR2B-containing NMDA receptors in activity-dependent brain-derived neurotrophic factor gene regulation and limbic epileptogenesis." J Neurosci. 27(3):542-552. PMID:17234586 - [
] Gascon S, et al. (2007) "Endoplasmic reticulum-associated degradation of the NR1 but not the NR2 subunits of the N-methyl-D-aspartate receptor induced by inhibition of the N-glycosylation in cortical neurons." J Neurosci Res. 85(8):1713-1723. PMID:17455306 - [
] Rossbach UL, et al. (2007) "Nandrolone-induced hippocampal phosphorylation of NMDA receptor subunits and ERKs." Biochem Biophys Res Commun. 357(4):1028-1033. PMID:17451646 - [
] Yang W, et al. (2007) "A three amino acid tail following the TM4 region of the N-methyl-D-aspartate receptor (NR) 2 subunits is sufficient to overcome endoplasmic reticulum retention of NR1-1a subunit." J Biol Chem. 282(12):9269-9278. PMID:17255096 - [
] Fantin M, et al. (2007) "NR2A and NR2B subunit containing NMDA receptors differentially regulate striatal output pathways." J Neurochem. 103(6):2200-2211. PMID:17986236 - [
] Zhou M, et al. (2006) "Developmental changes in NMDA neurotoxicity reflect developmental changes in subunit composition of NMDA receptors." J Neurosci. 26(11):2956-2963. PMID:16540573 - [
] Xing GG, et al. (2006) "Postnatal switching of NMDA receptor subunits from NR2B to NR2A in rat facial motor neurons." Eur J Neurosci. 24(11):2987-2992. PMID:17156360 - [
] Groc L, et al. (2006) "NMDA receptor surface mobility depends on NR2A-2B subunits." Proc Natl Acad Sci U S A. 103(49):18769-18774. PMID:17124177 - [
] Qian A, et al. (2006) "Permeant ion effects on external Mg2+ block of NR1/2D NMDA receptors." J Neurosci. 26(42):10899-10910. PMID:17050728 - [
] Lebel D, et al. (2006) "Learning in the absence of experience-dependent regulation of NMDAR composition." Learn Mem. 13(5):566-570. PMID:16980547 - [
] Wyllie DJ, et al. (2006) "Single-channel analysis of a point mutation of a conserved serine residue in the S2 ligand-binding domain of the NR2A NMDA receptor subunit." J Physiol. 574(Pt 2):477-489. PMID:16709630 - [
] Gardoni F, et al. (2006) "A critical interaction between NR2B and MAGUK in L-DOPA induced dyskinesia." J Neurosci. 26(11):2914-2922. PMID:16540568 - [
] Ishihama K, et al. (2005) "Prenatal development of NMDA receptor composition and function in trigeminal neurons." Arch Histol Cytol. 68(4):321-335. PMID:16477151 - [
] Kurko D, et al. (2005) "Inducible expression and pharmacological characterization of recombinant rat NR1a/NR2A NMDA receptors." Neurochem Int. 46(5):369-379. PMID:15737435 - [
] Wu HY, et al. (2005) "Regulation of N-methyl-D-aspartate receptors by calpain in cortical neurons." J Biol Chem. 280(22):21588-21593. PMID:15790561 - [
] Sutcu R, et al. (2005) "Effects of ischemia-reperfusion on NMDA receptor subunits 2a and 2b level in rat hippocampus." Int J Neurosci. 115(3):305-314. PMID:15804717 - [
] Qiu S, et al. (2005) "Subunit assembly of N-methyl-d-aspartate receptors analyzed by fluorescence resonance energy transfer." J Biol Chem. 280(26):24923-24930. PMID:15888440 - [
] Cahusac PM, et al. (2005) "Are unconventional NMDA receptors involved in slowly adapting type I mechanoreceptor responses?" Neuroscience. 133(3):763-773. PMID:15908129 - [
] Kim MJ, et al. (2005) "Differential roles of NR2A- and NR2B-containing NMDA receptors in Ras-ERK signaling and AMPA receptor trafficking." Neuron. 46(5):745-760. PMID:15924861 - [
] Waxman EA, et al. (2005) "N-methyl-D-aspartate receptor subtype mediated bidirectional control of p38 mitogen-activated protein kinase." J Biol Chem. 280(32):29322-29333. PMID:15967799 - [
] Furukawa H, et al. (2005) "Subunit arrangement and function in NMDA receptors." Nature. 438(7065):185-192. PMID:16281028 - [
] Mallon AP, et al. (2005) "Selective subunit antagonists suggest an inhibitory relationship between NR2B and NR2A-subunit containing N-methyl-D: -aspartate receptors in hippocampal slices." Exp Brain Res. 162(3):374-383. PMID:15580338 - [
] Erreger K, et al. (2005) "Subunit-specific gating controls rat NR1/NR2A and NR1/NR2B NMDA channel kinetics and synaptic signalling profiles." J Physiol. 563(Pt 2):345-358. PMID:15649985 - [
] Nagy GG, et al. (2004) "Synaptic distribution of the NR1, NR2A and NR2B subunits of the N-methyl-d-aspartate receptor in the rat lumbar spinal cord revealed with an antigen-unmasking technique." Eur J Neurosci. 20(12):3301-3312. PMID:15610162 - [
] Papadakis M, et al. (2004) "Appropriate NR1-NR1 disulfide-linked homodimer formation is requisite for efficient expression of functional, cell surface N-methyl-D-aspartate NR1/NR2 receptors." J Biol Chem. 279(15):14703-14712. PMID:14732708 - [
] Navarro-Lerida I, et al. (2004) "Proteomic identification of brain proteins that interact with dynein light chain LC8." Proteomics. 4(2):339-346. PMID:14760703 - [
] Schulz D, et al. (2004) "Behavioural parameters in aged rats are related to LTP and gene expression of ChAT and NMDA-NR2 subunits in the striatum." Eur J Neurosci. 19(5):1373-1383. PMID:15016095 - [
] Liu L, et al. (2004) "Role of NMDA receptor subtypes in governing the direction of hippocampal synaptic plasticity." Science. 304(5673):1021-1024. PMID:15143284 - [
] Lee MC, et al. (2004) "Upregulation of glutamate receptors in rat cerebral cortex with neuronal migration disorders." J Korean Med Sci. 19(3):419-425. PMID:15201510 - [
] Popescu G, et al. (2004) "Reaction mechanism determines NMDA receptor response to repetitive stimulation." Nature. 430(7001):790-793. PMID:15306812 - [
] Massey PV, et al. (2004) "Differential roles of NR2A and NR2B-containing NMDA receptors in cortical long-term potentiation and long-term depression." J Neurosci. 24(36):7821-7828. PMID:15356193 - [
] Yang L, et al. (2004) "A novel Ca2+-independent signaling pathway to extracellular signal-regulated protein kinase by coactivation of NMDA receptors and metabotropic glutamate receptor 5 in neurons." J Neurosci. 24(48):10846-10857. PMID:15574735 - [
] Moon IS, et al. (2003) "Relative extent of tyrosine phosphorylation of the NR2A and NR2B subunits in the rat forebrain postsynaptic density fraction." Mol Cells. 16(1):28-33. PMID:14503841 - [
] Nagy J, et al. (2003) "Differential alterations in the expression of NMDA receptor subunits following chronic ethanol treatment in primary cultures of rat cortical and hippocampal neurones." Neurochem Int. 42(1):35-43. PMID:12441166 - [
] Gardoni F, et al. (2003) "CaMKII-dependent phosphorylation regulates SAP97/NR2A interaction." J Biol Chem. 278(45):44745-44752. PMID:12933808 - [
] Dalby NO, et al. (2003) "Activation of NMDA receptors in rat dentate gyrus granule cells by spontaneous and evoked transmitter release." J Neurophysiol. 90(2):786-797. PMID:12904493
Serum- and glucocorticoid-inducible kinase 1 (SGK1) is a downstream target of phosphatidylinositol 3-kinase signaling, and it regulates various cellular and physiological functions, but the SGK1 substrate proteins and genes regulated by SGK1 are less known. Here we have identified IkappaB kinase alpha (IKKalpha) as a novel substrate of SGK1 by using biochemical and bioinformatic approaches. SGK1 directly phosphorylates IKKalpha at Thr-23 and indirectly activates IKKalpha at Ser-180. Furthermore, SGK1 enhanced nuclear factor kappaB (NF-kappaB) activity and up-regulated N-methyl-d-aspartate receptor NR2A and NR2B expression through activation of IKKalpha at Thr-23 and Ser-180, and these two residues play an equally important role in mediating these effects of SGK1. Although SGK1 does not phosphorylate IKKbeta, IKKbeta activity is still required for IKK complex activation and for SGK1 phosphorylation and activation of NF-kappaB. In addition, SGK1 increased the acetylation of NF-kappaB through phosphorylation of p300 at Ser-1834, and this also leads to NF-kappaB activation and NR2A and NR2B expression. Moreover, an endogenous stimulus of SGK1, insulin, increased IKKalpha and NF-kappaB phosphorylation as well as NF-kappaB acetylation and NF-kappaB activity, but SGK1 small interfering RNA transfection blocked these effects of insulin. In examination of the functional significance of the SGK1-IKKalpha-NF-kappaB signaling pathway, we found that transfection of the IKKalpha double mutant (IKKalphaT23A/S180A) to rat hippocampus antagonized SGK-1-mediated spatial memory facilitation. Our results together demonstrated novel substrate proteins of SGK1 and novel SGK1 signaling pathways. Activation of these signaling pathways enhances NR2A and NR2B expression that is implicated in neuronal plasticity.
Although large quantities of glutamate are found in the carotid body, to date this excitatory neurotransmitter has not been assigned a role in chemoreception. To examine the possibility that glutamate and its N-methyl-d-aspartate (NMDA) receptors play a role in acclimatization after exposure to cyclic intermittent hypoxia (CIH), we exposed male Sprague-Dawley rats to cyclic hypoxia or to room air sham (Sham) for 8 h/day for 3 wk. Using RT-PCR, Western blot analysis, and immunohistochemistry, we found that ionotropic NMDA receptors, including NMDAR1, NMDAR2A, NMDAR2A/2B, are strongly expressed in the carotid body and colocalize with tyrosine hydroxylase in glomus cells. CIH exposure enhanced the expression of NMDAR1 and NMDAR2A/2B but did not substantially change the level of NMDAR2A. We assessed in vivo carotid sinus nerve activity (CSNA) at baseline, in response to acute hypoxia, in response to infused NMDA, and in response to infused endothelin-1 (ET-1) with and without MK-801, an NMDA receptor blocker. Infusion of NMDA augmented CSNA in CIH rats (124.61 +/- 2.64% of baseline) but not in sham-exposed rats. Administration of MK-801 did not alter baseline activity or response to acute hypoxia, in either CIH or sham animals but did reduce the effect of ET-1 infusion on CSNA (CSNA after ET-1 = 160.96 +/- 8.05% of baseline; ET-1 after MK-801 = 118.56 +/- 9.12%). We conclude that 3-wk CIH exposure increases expression of NMDA functional receptors in rats, suggesting glutamate and its receptors may play a role in hypoxic acclimatization to CIH.
BACKGROUND AND PURPOSE: Activation of NMDA subtypes of glutamate receptors is implicated in cell damage induced by ischemia as well as for the establishment of ischemic tolerance after ischemic preconditioning in animal models. We investigated the contributions of NR2A- and NR2B-containing NMDA receptors to ischemic cell death and ischemic tolerance in a rat model of transient global ischemia. METHODS: Transient global ischemia was produced in rats by 4-vessel occlusion. Neuronal injury was analyzed by Fluoro-Jade B and Nissl staining. Phosphorylation of CREB was detected by Western blotting and immunohistochemistry. In situ hybridization and reverse transcriptase-polymerase chain reaction were used to evaluate the mRNA level of cpg15 and bdnf. RESULTS: NR2A subtype-specific antagonist NVP-AAM077 enhanced neuronal death after transient global ischemia and abolished the induction of ischemic tolerance. In contrast, NR2B subtype-specific antagonist ifenprodil attenuated ischemic cell death and enhanced preconditioning-induced neuroprotection. Furthermore, selectively blocking NR2A-, but not NR2B-, containing NMDA receptors inhibited ischemia-induced phosphorylation of CREB and the subsequent upregulation of CREB target genes such as cpg15 and bdnf. CONCLUSIONS: We found that NR2A- and NR2B-containing NMDA receptor subtypes play differential roles in ischemic neuronal death and ischemic tolerance, suggesting attractive new strategies for the development of drugs for patients with stroke.
Taste recognition memory is a process by which animals associate a taste previously experienced with its gastric consequences. Novel taste presentation induces in the insular cortex biochemical modifications that decrease after the taste becomes familiar. Here we show that, in this cortex, consumption of a novel taste produces an increase of the NR2A and NR2B subunits of the NMDA receptor in the detergent resistant membrane (DRM) fraction. This increase did not occur in the adjacent parietal cortex, was not due to a change in the total amount of protein, and is related with the novelty of the stimulus since it was reduced after the taste became familiar. Furthermore, NR2A and NR2B subunits increase in the DRM was blocked by the injection of a muscarinic acetylcholine receptor antagonist. These results suggest that modulation of NMDA receptors in the insular cortex through the increase of its NR2A and NR2B subunits in the DRM is involved in the taste memory formation via a cholinergic process.
Within the amygdala, most N-methyl-D-aspartic acid (NMDA) receptors consist of NR1 subunits in combination with either NR2A or NR2B subunits. Because the particular subunit composition greatly influences the receptors' properties, we investigated the contribution of both subtypes to fear conditioning and expression. To do so, we infused the NR1/NR2B receptor antagonist CP101,606 (0.5, 1.5, or 4.5 microg/amygdala) or the NR1/NR2A-preferring antagonist NVP-AAM077 (0.075, 0.25, 0.75, or 2.5 microg/amygdala) into the amygdala prior to either fear conditioning (i.e., light-shock pairings) or fear-potentiated startle testing. CP101,606 nonmonotonically disrupted fear conditioning but did not disrupt fear expression. NVP-AAM077 dose-dependently disrupted fear conditioning as well as fear expression. The results suggest that amygdala NR1/NR2B receptors play a special role in fear memory formation, whereas NR1/NR2A receptors participate more generally in synaptic transmission.
In the central nervous system, activation of N-methyl-d-aspartate receptor (NMDA-R) glycine binding sites is a prerequisite for activation of synaptic NMDA-Rs by the excitatory neurotransmitter glutamate. Here we used patch-clamp recordings in transverse slice preparations to study whether the glycine binding site of the NMDA-R saturates and to determine their subunit composition in layer II/III pyramidal neurons of the rat visual cortex. We found that the NMDA-R-mediated component of miniature excitatory postsynaptic currents (mEPSCs) could be potentiated by exogenously applied glycine. Similar results were obtained by exogenously applied d-serine. A specific antagonist for NR2B-NMDA-Rs, Ro 25-6981, reduced NMDA-R-mediated mEPSCs, and glycine with Ro 25-6981 enhanced NMDA-R-mediated mEPSCs. Moreover, Zn2+, an NR2A-NMDA-R antagonist, also reduced NMDA-mediated mEPSCs and glycine with Zn2+ enhanced the NMDA-mediated mEPSCs. Our data indicate that the glycine binding site of synaptic NR2A-containing and NR2B-containing NMDA-Rs does not saturate and that glycine may act as a modulator of NMDA-R-mediated transmission in layer II/III pyramidal neurons of the rat visual cortex.
N-methyl-d-aspartate receptors (NMDARs) display differences in their sensitivity to the channel blockers Mg(2+) and memantine that are dependent on the identity of the NR2 subunit present in the receptor-channel complex. This study used two-electrode voltage-clamp recordings from Xenopus laevis oocytes expressing recombinant NMDARs to investigate the actions of Mg(2+) and memantine at the two NMDARs displaying the largest differences in sensitivity to these blockers, namely NR1/NR2A and NR1/NR2D NMDARs. In addition, NR2A/2D chimeric subunits have been employed to examine the effects of pore-forming elements and ligand-binding domains (LBD) on the potency of the block produced by each of these inhibitors. Our results show that, as previously documented, NR2D-containing NMDARs are less sensitive to voltage-dependent Mg(2+) block than their NR2A-containing counterparts. The reduced sensitivity is determined by the M1M2M3 membrane-associated regions, as replacing these regions in NR2A subunits with those found in NR2D subunits results in a approximately 10-fold reduction in Mg(2+) potency. Intriguingly, replacing the NR2A LBD with that from NR2D subunits results in a approximately 2-fold increase in Mg(2+) potency. Moreover, when responses mediated by NR1/NR2A NMDARs are evoked by the partial agonist homoquinolinate, rather than glutamate, Mg(2+) also displays an increased potency. Memantine block of glutamate-evoked currents is most potent at NR1/NR2D NMDARs, but no differences are observed in its ability to inhibit NR2A-containing or NR2A/2D chimeric NMDARs. We suggest that the potency of block of NMDARs by Mg(2+) is influenced not only by pore-forming regions but also the LBD and the resulting conformational changes that occur following agonist binding.
We investigated regional variations and the effects of aging on the expression of the N-methyl-D-aspartate (NMDA) and alpha-amino-3-hydroxy-5-methyl-4-isoxazole (AMPA) receptor subunits in several memory-associated structures using Western blotting. In young adult rats, NR1, NR2A, and GluR2 levels varied between the hippocampus and parahippocampal region and between the subregions of the hippocampus. When a comparison was made between young (4-month-old) and aged (24-month-old) rats, significant decreases in NR1 expression were found in the aged ventral hippocampus and the entorhinal and postrhinal cortices. There were significant decreases in NR2A expression in the aged parahippocampal region, but not in the hippocampus. The expression of the GluR2 subunit was significantly reduced in the ventral hippocampus and the postrhinal cortex. A dramatic decrease in NR1 and GluR2 expression was found in the aged CA2/3 and CA1, respectively, but there were no significant age-related changes in NR2A expression. All three subunits were expressed at a similar level in the two age groups in the prefrontal cortex. These results suggest differential expression and effects of aging on NMDA and AMPA receptor subunits in memory-associated brain structures.
The N-methyl-D-aspartate receptor (NMDAR) is central to physiological and pathological functioning of neurons. Although promising results are beginning to be obtained in the treatment of dementias, clinical trials with NMDAR antagonists for stroke, trauma and neurodegenerative disorders, such as Hungtinton's disease, have failed before. In order to design effective therapies to prevent excitotoxic neuronal death, it is critical to characterize the consequences of excessive NMDAR activation on its expression and function. Previous data have reported partial downregulation of the NR1 and NR2B receptor subunits in response to excitotoxicity and cerebral ischemia. However, the effect of NMDAR overactivation on NR2A, a subunit fundamental to synaptic transmission and neuronal survival, is still elusive. In this study, we report the rapid and extensive proteolytic processing of NR2A, together with the scaffolding protein postsynaptic density-95 (PSD-95), induced by excitotoxic stimulation of cortical neurons in vitro and by transient focal cerebral ischemia. Processing of the C terminus of NR2A is irreversibly induced by brief agonist exposure of NR2B-containing receptors, and requires calcium influx and the activity of calpain, also responsible for PSD-95 cleavage. The outcome is a truncated NR2A subunit that is stable and capable to interact with NR1 at the surface of neurons, but lacking the structural domains required for association with scaffolding, downstream signaling and cytoskeletal proteins. Therefore, a rapid and significant uncoupling of synaptic NMDARs from downstream survival pathways is expected to occur during ischemia. This novel mechanism induced by excitotoxicity helps to explain the failure of most therapies based on NMDAR antagonists.
The role of NMDA receptors in the induction of long-term potentiation (LTP) and long-term depression (LTD) is well established but which particular NR2 subunits are involved in these plasticity processes is still a matter of controversy. We have studied the effects of subtype selective NMDA receptor antagonists on LTP induced by high frequency stimulation (100 Hz for 1s) and LTD induced by low frequency stimulation (1 Hz for 15 min) in the CA1 region of hippocampal slices from 14 day old Wistar rats. Against recombinant receptors in HEK293 cells NVP-AAM077 (NVP) was approximately 14-fold selective for NR2A vs NR2B receptors, whilst Ro 25-6981 (Ro) was highly selective for NR2B receptors. On NMDA receptor-mediated EPSCs from Schaffer collaterals in CA1 neurones, NVP and Ro both reduced the amplitude but differentially affected the time constant of decay. The data are compatible with the selective effect of NVP (0.1 microM) and Ro (4 microM) on native NR2A and NBR2B receptors, respectively. NVP reduced both LTP and LTD whereas Ro reduced only LTP. Thus, LTP was reduced by 63% at 0.1 microM NVP and almost completely at 0.4 microM whereas 5 microM Ro reduced LTP by 45%. These data are consistent with a role for both NR2A and NR2B in the induction of LTP, under our experimental conditions. In comparison, LTD was unaffected by Ro (5 microM) even in the presence of a glutamate uptake inhibitor threo-beta-benzylaspartic acid (TBOA) to increase the concentration of glutamate at NR2B containing receptors. NVP (0.2-0.4 microM), however, produced a concentration dependent inhibition of LTD which was complete at 0.4 microM. The lack of effect of 0.1 microM NVP on LTD contrasts with its marked effect on LTP and raises the possibility that different NVP-sensitive NR2 subunit-containing NMDA receptors are required for LTP and LTD in this preparation.
Interaction with the environment has a key role in refining the neuronal circuitry required for normal brain function throughout life. Profound effects of enriched environment have been shown on neuronal structure and chemistry in experimental animals. Epidemiological studies imply that this is true also in man, thus cognitive stimulation has a protective effect on neurodegeneration, e.g., in Alzheimer's disease. Glutamatergic pathways are imperative for cognitive functions, such as memory, learning and long-term potentiation, and relies on the AMPA and NMDA glutamate receptors and the hippocampus, with its specific subregions, is an important anatomical substrate in this. The glutamate signalling is also dependent on a fine-tuned transport system, in the hippocampus primarily achieved by the glutamate transporter EAAC1. In this study we show how environmental enrichment modulates these parts of the glutamatergic system using quantitative in situ hybridisation. This work demonstrates for the first time that environmental enrichment modulates the mRNA expression of EAAC1 which is significantly and region specifically decreased in the hippocampus. We also provide evidence for regional and hemisphere-specific upregulation of NMDA mRNA in the hippocampus after environmental enrichment. The current work also shows that AMPA mRNA of the hippocampus is not per se changed by environmental enrichment in adult animals. Taken together, our results extend the knowledge of the glutamatergic system of specific regions of the hippocampus and its modulation by environmental enrichment and could contribute to the development of strategies aimed at limiting pathological changes associated with glutamatergic dysfunctions.
BACKGROUND: C2 hemisection results in paralysis of the ipsilateral hemidiaphragm. Recent data indicate that an upregulation of the N-methyl-D-aspartate (NMDA) receptor 2A subunit following chronic C2 hemisection is associated with spontaneous hemidiaphragmatic recovery following injury. MK-801, an antagonist of the NMDA receptor, upregulates the NR2A subunit in neonatal rats. HYPOTHESIS: We hypothesized that administration of MK-801 to adult, acute C2-hemisected rats would result in an increase of NR2A in the spinal cord. Furthermore, we hypothesized that upregulation of NR2A would be associated with recovery of the ipsilateral hemidiaphragm as in the chronic studies. DESIGN: To develop a dose-response curve, adult rats were treated with varying doses of MK-801 and their spinal cords harvested and assessed for NR2A as well as AMPA GluR1 and GluR2 subunit protein levels. In the second part of this study, C2-hemisected animals received MK-801. Following treatment, the animals were assessed for recovery of the hemidiaphragm through electromyographic recordings and their spinal cords assessed for NR2A, GluR1, and GluR2. RESULTS: Treatment with MK-801 leads to an increase of the NR2A subunit in the spinal cords of adult noninjured rats. There were no changes in the expression of GluR1 and GluR2 in these animals. Administration of MK-801 to C2-hemisected rats resulted in recovery of the ipsilateral hemidiaphragm, an increase of NR2A, and a decrease of GluR2. CONCLUSION: Our findings strengthen the evidence that the NR2A subunit plays a substantial role in mediating recovery of the paralyzed hemidiaphragm following C2 spinal cord hemisection.
N-methyl-d-aspartate receptor (NMDAR) activation can trigger both long- and short-term plasticity, promote cell survival, and initiate cell death. A number of studies suggest that the consequences of NMDAR activation can vary widely depending on whether synaptic or extrasynaptic receptors are activated. Here we have examined the spatial distribution of NMDARs of CA1 pyramidal neurons in acutely dissected hippocampal slices. Using a physiological definition of extrasynaptic receptors as those not accessible to single release events, we find that extrasynaptic NMDARs comprise a substantial proportion of the dendritic NMDAR pool (36%). This pool of extrasynaptic NMDARs is stable and does not shuttle into the synaptic receptor pool, as we observe no recovery of synaptic current after MK-801 synaptic blockade and washout. The subunit composition of synaptic and extrasynaptic NMDA receptor pools is similar at 3 weeks of age, with NR2B subunits present in both compartments. NR2B receptors are not enriched in the extrasynaptic compartment. Our data suggest that any role played by extrasynaptic NMDARs in synaptic transmission is dictated by their subcellular location rather than their subunit composition or mobility.
BACKGROUND: The involvement of different NMDA receptor (NMDAR) subunits has been implicated in several forms of synaptic plasticity. However, it is still controversial to what extent the involvement is specific, and little is known about the role of NMDAR subunits in certain "non-conventional" forms of plasticity. In this study we used subunit-specific blockers to test the roles of NR2A- and NR2B-containing NMDARs in a type of chemical long-term depression (LTD) induced by brief bath application of the NMDAR agonist NMDA to hippocampal slices from 12-18 days old rats. For comparison, we also examined other forms of plasticity, including a "slow LTD" induced by 0.1 Hz stimulation under low Mg2+ conditions as well as long-term potentiation (LTP). RESULTS: A blocker of NR2A-containing NMDARs, NVP-AAM077 (NVP), substantially reduced the two forms of studied depression whereas blockers of NR2B-containing NMDARs, Ro25-6981 (Ro) or Ifenprodil (Ife), had no significant effect on them. LTP appeared to be more sensitive as it was fully blocked by NVP and partially blocked by Ro or Ife. However, the blocking effects of NVP could be counteracted by general amplification of NMDA responses by lowering Mg2+ concentration in the perfusion solution. Applying NVP or Ro/Ife on isolated NMDA-EPSPs recorded in low Mg2+ solution reduced responses to about 70% and 20% of initial size, respectively, whereas coapplication of both blockers almost completely abolished the responses. Additionally, NMDA application caused depotentiation of a pathway with prior tetanus-induced LTP, and NVP but not Ro/Ife substantially prevented that depotentiation as well as the chemical LTD of the control pathway. A second tetanus on the LTP pathway induced repotentiation which was fully blocked by NVP but partially blocked by Ro/Ife. CONCLUSION: All of these results on hippocampal slices from young rats can be explained by a simple model, in which NR2A subunits dominate over NR2B subunits with respect to both plasticity and NMDAR-mediated responses. The model suggests that Ca2+ influx into the postsynaptic spine via different subtypes of NMDARs makes up a "final common pathway", controlling synaptic plasticity by its magnitude and temporal pattern regardless of the source.
Fleeting activation of NMDA receptors (NMDARs) induces long-term modification of synaptic connections and refinement of neuronal circuits, which may underlie learning and memory and contribute to pathogenesis of a diversity of neurological diseases, including epilepsy. Here, we found that NR2A and NR2B subunit-containing NMDARs were coupled to distinct intracellular signaling, resulting in differential BDNF expression and extracellular signal-regulated kinase 1/2 (ERK1/2) activation. Selective activation of NR2A-containing NMDARs increased BDNF gene expression. Activation of NR2B-containing NMDARs led to ERK1/2 phosphorylation. Furthermore, selectively blocking NR2A-containing NMDARs impaired epileptogenesis and the development of mossy fiber sprouting in the kindling and pilocarpine rat models of limbic epilepsy, whereas inhibiting NR2B-containing NMDARs had no effects in epileptogenesis and mossy fiber sprouting. Interestingly, blocking either NR2A- or NR2B-containing NMDARs decreased status epilepticus-induced neuronal cell death. The specific requirement of NR2A and its downstream signaling for epileptogenesis implicates attractive new targets for the development of drugs that prevent epilepsy in patients with brain injury.
The N-methyl-D-aspartate receptor (NMDAR) is fundamental to normal and pathological functioning of neurons. The receptor subunits are N-glycosylated proteins synthesized in the endoplasmic reticulum (ER) that fold, mature, and oligomerize as they transit through the secretory pathway. Although the early processes of biogenesis are fundamental to NMDAR expression and function, our knowledge of them is nevertheless limited. Additionally, the investigation of NMDAR synthesis is highly relevant, in that ER dysfunction, frequently associated with acute and degenerative brain diseases, might alter this process. We characterize here the effect of ER stress produced by inhibition of N-glycosylation on NMDAR synthesis and function. We use first heterologous systems of NMDAR expression in which NR1 and NR2A subunits are synthesized in nonneuronal cells. The function of these NMDARs as Ca2+ channels is repressed by tunicamycin, because of the inhibition of NR1, but no NR2A, synthesis. The regulation of NR1 is relevant to the central nervous system, in that a dramatic decrease in synthesis of this subunit and assembly of NMDARs is observed in cortical neurons treated with tunicamycin. The inhibition of NR1 synthesis is not due to changes in levels of mRNA but associated with the earliest stages in NMDAR biogenesis. The inhibition of N-glycosylation activates ER-specific stress responses in neurons, which include the ER-associated degradation (ERAD) mechanism responsible for differential and extremely efficient degradation of nonglycosylated NR1 by the proteasome after ubiquitination. Because this is an obligatory NMDAR component, the significant sensitivity of NR1 to ER stress will have important consequences on receptor function.
The age-related decline in gonadal steroids is associated with changes in mood and memory function. It appears that normal physiological concentrations of the steroids are required for adequate synaptic plasticity. However, the effects of high levels of androgens subsequent to misuse of anabolic androgenic steroids (AAS) are largely unknown. In this study, rats were given i.m. nandrolone as a single dose or daily for 14 days and the effects on synaptic components in hippocampal synaptoneurosomes were measured 24h after the last injection. Western blot analysis revealed that a single injection of AAS increased phosphorylation of the NMDA receptor subunits NR2A and NR2B and ERK1/2, while the levels of phosphorylated CaMKIIalpha were unaltered. No changes were seen in other synaptic proteins tested, i.e., BDNF, Arc, TUC-4, and beta-tubulin III. Daily administration of nandrolone for 2 weeks did not affect the content of any of the proteins tested. From this in vivo study, it is concluded that important synaptic components respond to a single high dose of nandrolone, an effect that may influence synapse function.
The cytoplasmic C-terminal domains of NR2 subunits have been proposed to modulate the assembly and trafficking of NMDA receptors. However, questions remain concerning which domains in the C terminus of NR2 subunits control the assembly of receptor complexes and how the assembled complexes are selectively trafficked through the various cellular compartments such as endoplasmic reticulum (ER) to the cell surface. In the present study, we found that the three amino acid tail after the TM4 region of NR2 subunits is necessary for surface expression of functional NMDA receptors, while truncations with only two amino acids following the TM4 region (NR2Delta2) completely eliminated surface expression of the NMDA receptor on co-expression with NR1-1a in HEK293 cells. FRET (fluorescence resonance energy transfer) analysis showed that these NR2Delta2 truncations are able to form homomers and heteromers on co-expression with NR1-1a. Furthermore, when NR2Delta2 subunits were cotransfected with either the NR1-4a or NR1-1a(AAA) mutant, lacking the ER retention motif (RRR), functional NMDA receptors were detected in the transfected HEK293 cells. Unexpectedly, we found that the replacement of five residues after TM4 with alanines gave results indistinguishable from those of NR2BDelta5 (EHLFY), demonstrating the short tail following the TM4 of NR2 subunits is not sequence-specific-dependent. Taken together, our results show that the C terminus of the NR2 subunits is not necessary for the assembly of NMDA receptor complexes, whereas a three amino acid long cytoplasmic tail following the TM4 of NR2 subunits is sufficient to overcome the ER retention existing in the C terminus of NR1, allowing the assembled NMDA receptors to reach the cell surface.
Triple probe microdialysis was employed to investigate whether striatal NR2A and NR2B subunit containing NMDA receptors regulate the activity of striato-pallidal and striato-nigral projection neurons. Probes were implanted in the striatum, ipsilateral globus pallidus and substantia nigra reticulata. Intrastriatal perfusion with the NR2A subunit selective antagonist (R)-[(S)-1-(4-bromo-phenyl)-ethylamino]-(2,3-dioxo-1,2,3,4-tetrahydroquinoxalin-5 -yl)-methyl]-phosphonic acid (NVP-AAM077) reduced pallidal GABA and increased nigral glutamate (GLU) release whereas perfusion with the NR2B subunit selective antagonist (R-(R*,S*)-alpha-(4-hydroxyphenyl)-beta-methyl-4-(phenylmethyl)-1-piperidinepropa nol (Ro 25-6981) reduced nigral GABA and elevated striatal and pallidal GLU release. To confirm that changes in GABA levels were because of blockade of (GLUergic-driven) tonic activity of striatofugal neurons, tetrodotoxin was perfused in the striatum. Tetrodotoxin reduced both pallidal and nigral GABA release without changing GLU levels. To investigate whether striatal NR2A and NR2B subunits were also involved in phasic activation of striatofugal neurons, NVP-AAM077 and Ro 25-6981 were challenged against a NMDA concentration able to evoke GABA release in the three areas. Both antagonists prevented the NMDA-induced striatal GABA release. NVP-AAM077 also prevented the NMDA-induced surge in GABA release in the globus pallidus, whereas Ro 25-6981 attenuated it in the substantia nigra. We conclude that striatal NMDA receptors containing NR2A and NR2B subunits preferentially regulate the striato-pallidal and striato-nigral projection neurons, respectively.
Excitotoxicity is generally studied in dissociated neurons, cultured hippocampal slices, or intact animals. However, the requirements of dissociated neurons or cultured slices to use prenatal or juvenile rats seriously limit the advantages of these systems, whereas the complexity of intact animals prevents detailed molecular investigations. In the present experiments, we studied developmental changes in NMDA neurotoxicity in acute hippocampal slices with lactate dehydrogenase (LDH) release in medium, propidium iodide (PI) uptake, and Nissl staining as markers of cell damage. Calpain-mediated spectrin degradation was used to test calpain involvement in NMDA neurotoxicity. NMDA treatment produced increased LDH release, PI uptake, and spectrin degradation in slices from juvenile rats but not adult rats. NMDA-induced changes in slices from young rats were blocked completely by the NMDA receptor antagonist (+)-5-methyl-10,11-dihydro-5H-dibenzo [a,d] cyclohepten-5,10-imine maleate (MK-801) and by the antagonists of NR2B receptor ifenprodil and R-(R, S)-alpha-(4-hydroxyphenyl)-beta-methyl-4-(phenylmethyl)-1-piperidine propranol and were partly blocked by calpain inhibitor III but were not affected by the NR2A-specific antagonist [(R)-[(S)-1-(4-bromo-phenyl)-ethylamino]-(2,3-dioxo-1,2,3,4-tetrahydroquinoxalin- 5-yl)-methyl]-phosphonic acid. NMDA-induced changes in Nissl staining were also different in slices from young and adult rats and blocked by NR2B but not NR2A antagonists. In contrast to NMDA treatment, oxygen/glucose deprivation (OGD) induced neurotoxicity in slices from both young and adult rats, although OGD-induced toxicity was attenuated by MK-801 only in slices from young rats. Our results are consistent with the idea that NMDA-mediated toxicity is caused by activation of NR2B- but not NR2A-containing NMDA receptors leading to calpain activation and that developmental changes in NMDA toxicity reflect developmental changes in NMDA receptor subunit composition.
The subunit composition of N-methyl-D-aspartate (NMDA) receptors affects their function under normal and pathological conditions. Functional NMDA receptors are expressed in lower motor neurons, but their subunit composition has not been defined. Here, we employed electrophysiology, quantitative PCR, and immunohistochemistry to investigate the subunit composition of NMDA receptors in postnatal motor neurons of the Wistar rat facial nucleus (FN). Whole-cell patch clamp recordings of acutely dissociated motor neurons from postnatal days 3 and 4 (P3-P4) showed that ifenprodil, a specific antagonist of the NMDA receptor 2B (NR2B) subunit, inhibited 91.62%+/-2.02% of NMDA-induced current, whereas NVP-AAM007, a specific antagonist of the NMDA receptor 2A (NR2A) subunit, inhibited much less of the current (16.69%+/-3.28%). Starting from P5, the inhibitory effects of ifenprodil and NVP-AAM007 gradually decreased and increased, respectively, such that the effect of NVP-AAM007 exceeded that of ifenprodil by P10. At P14, most of the NMDA-induced current was inhibited by NVP-AAM007 (84.59%+/-3.35%). Consistent with this, NR2B mRNA and protein were expressed highly at P3 and then gradually decreased by more than 75% by P14 in FN motor neurons, while NR1 was expressed stably over the same ages. However, NR2A mRNA and protein showed relatively constant levels between P3-P10 and decreased to 45% and 75% of the P3 level, respectively, by P14. Thus, analysis of functional NMDA receptors is critical to revealing subunit switching, which may be an important step in postnatal development of FN motor neurons.
The NR2 subunit composition of NMDA receptors (NMDARs) varies during development, and this change is important in NMDAR-dependent signaling. In particular, synaptic NMDAR switch from containing mostly NR2B subunit to a mixture of NR2B and NR2A subunits. The pathways by which neurons differentially traffic NR2A- and NR2B-containing NMDARs are poorly understood. Using single-particle and -molecule approaches and specific antibodies directed against NR2A and NR2B extracellular epitopes, we investigated the surface mobility of native NR2A and NR2B subunits at the surface of cultured neurons. The surface mobility of NMDARs depends on the NR2 subunit subtype, with NR2A-containing NMDARs being more stable than NR2B-containing ones, and NR2A subunit overexpression stabilizes surface NR2B-containing NMDARs. The developmental change in the synaptic surface content of NR2A and NR2B subunits was correlated with a developmental change in the time spent by the subunits within synapses. This suggests that the switch in synaptic NMDAR subtypes depends on the regulation of the receptor surface trafficking.
Voltage-dependent channel block by external Mg2+ (Mg2+(o)) of NMDA receptors is an essential determinant of synaptic function. The resulting Mg2+(o) inhibition of NMDA responses depends strongly on receptor subunit composition: NR1/2A and NR1/2B receptors are more strongly inhibited by Mg2+(o) than are NR1/2C or NR1/2D receptors. Previous work showed that permeant ions have profound effects on Mg2+(o) block of NMDA receptors composed of NR1, NR2A, and NR2B subunits. Whether permeant ions affect Mg2+(o) inhibition of NR1/2C or NR1/2D receptors is unknown. We investigated the effects of permeant ions on Mg2+(o) block of NR1/2D receptors by integrating results from whole-cell recordings, single-channel recordings, and kinetic modeling. Lowering internal [Cs+] caused a voltage-dependent decrease in the Mg2+(o) IC50 and in the apparent Mg2+(o) unblocking rate, and increase in the apparent Mg2+(o) blocking rate (k(+,app)) of NR1/2D receptors. Lowering external [Na+] caused modest voltage-dependent changes in the Mg2+(o) IC50 and k(+,app). These data can be explained by a kinetic model in which occupation of either of two external permeant ion binding sites prevents Mg2+(o) entry into the channel. Occupation of an internal permeant ion binding site prevents Mg2+(o) permeation and accelerates Mg2+(o) unblock to the external solution. We conclude that variations in permeant ion site properties shape the NR2 subunit dependence of Mg2+(o) block. Furthermore, the external channel entrance varies little among NMDA receptor subtypes. Differences in the Mg2+(o) blocking site, and particularly in the selectivity filter and internal channel entrance, are principally responsible for the subunit dependence of Mg2+(o) block.
Olfactory discrimination (OD) learning consists of two phases: an initial N-methyl-D-aspartate (NMDA) receptor-sensitive rule-learning phase, followed by an NMDA receptor (NMDAR)-insensitive pair-learning phase. The rule-learning phase is accompanied by changes in the composition and function of NMDARs at synapses in the piriform cortex, resulting in a high level of the NR2a subunit relative to NR2b. Here we show that the learning-induced changes in NMDAR composition in the adult piriform cortex are due to a decrease in the level of the NR2b subunit protein, rather than an increase in the level of NR2a. Chronic administration of an NMDAR open channel blocker during training delays OD learning and blocks learning-induced changes in NMDAR subunit composition. However, the animals still learn the OD task. Our data demonstrate that learning can occur in the absence of activity-dependent regulation of NMDAR composition, suggesting differences in the mechanism for long-term maintenance of NMDAR-dependent and NMDAR-independent learning.
We have examined the function of a conserved serine residue (Ser670) in the S2 ligand-binding region of the NR2A N-methyl-d-aspartate (NMDA) receptor subunit, using recombinant NR1/NR2A receptors expressed in Xenopus laevis oocytes. Mutation of Ser670 to glycine (S670G) in NR2A reduced the potency of glutamate by 124-fold. Single-channel conductance and the duration of apparent open periods of NR2A(S670G) receptor mutants were, however, indistinguishable from wild-type NMDA receptors. NR1/NR2A(S670G) shut-time distributions were best described by a mixture of six exponential components, and the four shortest shut intervals of each distribution were considered to occur within a channel activation (burst). Bursts of single-channel openings were fitted with a mixture of four exponential components. The longest two components carried the majority of the charge transfer and had mean durations of 9.6 +/- 0.5 and 29.6 +/- 1.5 ms. The overall channel open probability during a burst was high (mean, 0.83 +/- 0.06). Consistent with a shortening of NMDA receptor-channel burst lengths was the observation of an increased deactivation rate of macroscopic currents evoked by brief applications of glutamate to outside-out membrane patches. Correlations between shut times and adjacent open times were observed in all data records. Noticeably, shorter than average openings tended to occur next to long closed periods, whereas longer than average openings tended to occur next to short closings. Our single-channel data, together with modelling using a kinetic scheme to describe channel activations, support our hypothesis that the S670G point mutation reduces the dwell time of glutamate in its binding site.
Abnormal function of NMDA receptor has been suggested to be correlated with the pathogenesis of Parkinson's disease (PD) as well as with the development of l-3,4-dihydroxyphenylalanine (L-DOPA)-induced dyskinesia. Here we show that NMDA receptor NR2 subunits display specific alterations of their subcellular distribution in striata from unilateral 6-hydroxydopamine-lesioned, L-DOPA-treated dyskinetic, and L-DOPA-treated nondyskinetic rats. Dyskinetic animals have significantly higher levels of NR2A subunit in the postsynaptic compartment than all other experimental groups, whereas NR2B subunit shows a significant reduction in both dopamine-denervated and dyskinetic rats. These events are paralleled by profound modifications of NMDA receptor NR2B subunit association with interacting elements, i.e., members of the membrane-associated guanylate kinase (MAGUK) protein family postsynaptic density-95, synapse-associated protein-97 and synapse-associated protein-102. Treatment of nondyskinetic animals with a synthetic peptide (TAT2B) able to affect NR2B binding to MAGUK proteins as well as synaptic localization of this subunit in nondyskinetic rats was sufficient to induce a shift of treated rats toward a dyskinetic motor behavior. These data indicate abnormal NR2B redistribution between synaptic and extrasynaptic membranes as an important molecular disturbance of the glutamatergic synapse involved in L-DOPA-induced dyskinesia.
The prenatal development of neural circuits for rhythmical oral-motor behaviors used for feeding is essential for the survival of the newborn mammal. The N-methyl-D-aspartate (NMDA) receptor plays a critical role in brainstem circuits underlying postnatal oral-motor behaviors. To understand a role for the NMDA receptor in the emergence of sucking behavior we conducted physiological and immunohistochemical experiments using fetal rats. Physiology experiments examined the development of the NMDA dose response of the brainstem circuit responsible for generating rhythmical trigeminal activity by recording trigeminal motor outputs using an in vitro preparation. The high dose of NMDA agonist bath application affected the mean cycle duration of rhythmical trigeminal activity (RTA) at both embryonic day (E) 18-19 and E20-21 in comparison with standard concentration of NMDA agonist. NMDA receptor immunohistochemistry studies, using antibodies directed against subunits NR1, NR2A, NR2B, NR3A and NR3B were performed to determine the prenatal regulation of NMDA subunits in trigeminal motoneurons (Mo5), and mesencephalic trigeminal neurons (Me5) between E17 to E20. In Mo5, NR1, NR2A, NR2B and NR3A immunoreactivity was observed throughout the time frame sampled. NR3B immunoreactivity was not observed in Mo5 or Me5. In Mo5, there was a significant decrease in the percentage of NR2B immunoreactive neurons between E17 and E20, and a concurrent increase in the NR2A/NR2B ratio between E17 and E20. In Me5, NR1, NR2A and NR3A immunoreactivity was observed throughout the time frame sampled; a significant decrease in the percentage of NR2A immunoreactive neurons between E17 and E20, and NR3A immunoreactive neurons between E17 and E18 occurred. The timing of subunit changes between E17 and E18 is coincident with the prenatal emergence of rhythmical jaw movements, and in vitro rhythmical trigeminal activity, shown in earlier studies. Our data suggest that NMDA receptor plays an important role in the development and function of prenatal oral-motor circuits.
In this study, we have established a non-neuronal cell line stably and inducibly expressing recombinant NMDA receptors (NRs) composed of rat NR1a/NR2A subunits. EcR-293 cells were transfected with rat NR1a and NR2A cDNAs using the inducible mammalian expression vector pIND. Cell colonies resistant for the selecting agents were picked and tested for NR2A mRNA as well as protein expression using quantitative RT-PCR and flow cytometry based immunocytochemistry. Clonal cells expressing functional NMDA receptors were identified by measuring NMDA-evoked ion currents, and NMDA-induced increase in cytosolic free calcium concentration in whole-cell patch-clamp and fluorimetric calcium measurements, respectively. One clone named D5/H3, which exhibited the highest response to NMDA, was chosen to examine inducibility of the expression and for pharmacological profiling of recombinant NR1a/NR2A NMDA receptors. To check inducibility, NR2A subunit expression in D5/H3 cells treated with the inducing agent muristerone A (MuA) was compared with that in non-induced cells. Both NR2A mRNA and protein expression was several folds higher in cells treated with the inducing agent. As part of the pharmacological characterization, we examined the activation of the expressed NR1a/NR2A receptors as a function of increasing concentration of NMDA. NMDA-evoked concentration-dependent increases in cytosolic [Ca2+] with an EC50 value of 41 +/- 1 microM. In addition, whereas the NMDA response was concentration-dependently inhibited by the channel blocker MK-801 (IC50 = 58 +/- 6 nM), NR2B subunit selective NMDA receptor antagonists were ineffective. Thus, this cell line, which stably and inducibly expresses recombinant NR1a/NR2A NMDA receptors, can be a useful tool for testing NMDA receptor antagonists and studying their subunit selectivity.
The N-methyl-D-aspartate (NMDA) receptor is a cation channel highly permeable to calcium and plays critical roles in governing normal and pathologic functions in neurons. Calcium entry through NMDA receptors (NMDARs) can lead to the activation of the Ca2+-dependent protease, calpain. Here we investigated the involvement of calpain in regulation of NMDAR channel function. After prolonged (5-min) treatment with NMDA or glutamate, the whole-cell NMDAR-mediated current was significantly reduced in both acutely dissociated and cultured cortical pyramidal neurons. The down-regulation of NMDAR current was blocked by bath application of selective calpain inhibitors. Intracellular injection of a specific calpain inhibitory peptide also eliminated the down-regulation of NMDAR current induced by prolonged NMDA treatment. In contrast, dynamin inhibitory peptide had no effect on the depression of NMDAR current, suggesting the lack of involvement of dynamin/clathrin-mediated NMDAR internalization in this process. Immunoblotting analysis showed that the NR2A and NR2B subunits of NMDARs were markedly degraded in cultured cortical neurons treated with glutamate, and the degradation of NR2 subunits was prevented by calpain inhibitors. Taken together, our results suggest that prolonged activation of NMDARs in neurons activates calpain, and activated calpain in turn down-regulates the function of NMDARs, which provides a neuroprotective mechanism against NMDAR overstimulation accompanying ischemia and stroke.
The authors investigated the effects of ischemia and reperfusion on the N-methyl-D-aspartate receptor (NMDAR) subunits 2A and 2B concentration in rat hippocampus. At the protein level, significant increase in the amounts of NMDAR 2A and NMIDAR 2B in the rat hippocampus was observed at 1 h after reperfusion compared with control group. These results suggested that the alteration in hippocampal NMDAR2 subunit concentrations after ischemia-reperfusion might be invovlved in cognitive dysfunction and excitotoxicity.
N-methyl-d-aspartate (NMDA) receptors play major roles in synaptic transmission and plasticity, as well as excitotoxicity. NMDA receptors are thought to be tetrameric complexes mainly composed of NMDA receptor (NR)1 and NR2 subunits. The NR1 subunits are required for the formation of functional NMDA receptor channels, whereas the NR2 subunits modify channel properties. Biochemical and functional studies indicate that subunits making up NMDA receptors are organized into a dimer of dimers, and the N termini of the subunits are major determinants for receptor assembling. Here we used a biophysical approach, fluorescence resonance energy transfer, to analyze the assembly of intact, functional NMDA receptors in living cells. The results showed that NR1, NR2A, and NR2B subunits could form homodimers when they were expressed alone in HEK293 cells. Subunit homodimers were also found existing in heteromeric NMDA receptors formed between NR1 and NR2 subunits. These findings are consistent with functional NMDA receptors being arranged as a dimer of dimers. In addition, our data indicated that the conformation of NR1 subunit homodimers was affected by the partner NR2 subunits during the formation of heteromeric receptor complexes, which might underlie the mechanism by which NR2 subunits modify NMDA receptor function.
Specific immunohistochemical staining for NMDA receptor NR2A/B subunits was found in the outer root sheath layer of rat sinus hair (whisker) follicle. Co-localization with CK 20 confirmed that Merkel cells were stained. The NR2A/B staining seen on Merkel cells was pericellular. In addition it appeared that NF70-positive staining was in close proximity to, but did not colocalise with NR2A/B immunoreactivity, indicating that NR2A/B was only expressed by Merkel cells and not their adjacent nerve terminals. Merkel cells and the nerve terminals have previously been associated with electrophysiological recordings from slowly adapting type I (St I) mechanoreceptor unit activity. Pharmacological experiments with isolated sinus hairs using a wide range of ionotropic glutamate receptor antagonists found that only certain NMDA receptor blockers depressed St I unit responses to mechanical stimuli. AMPA/kainate receptor antagonists (CNQX and NBQX, 100 microM) had no effect, nor did classical competitive NMDA receptor antagonists, D-AP5 (600 microM) and R-CPP (100 microM), nor the NMDA glycine site antagonist 5,7-dichlorokynurenic acid (100 microM). The only effective NMDA receptor blockers were those selective for the polyamine site: ifenprodil (IC50 20 microM) and Ro 25-6981 (IC50 approximately 50 microM), and the associated ion channel: MK 801, ketamine and (+/-)-1-(1,2-diphenylethyl)piperidine (IC50 < 100 microM). The two enantiomers of MK 801 were equipotent. All effects were long lasting, consistent with their non-/uncompetitive actions. The most potent drug tested, ifenprodil, at an effective dose of 30 microM, had a mean recovery time of 74 min. A three-fold increase in drug concentration was required to depress St II units (associated with non-synaptic lanceolate endings). Changes in Zn2+ did not affect St I unit responses. These data suggest that unconventional NMDA receptors are involved in St I unit responses, but question the notion of a glutamatergic synapse between the Merkel cell and nerve terminal.
NMDA receptors (NMDARs) control bidirectional synaptic plasticity by regulating postsynaptic AMPA receptors (AMPARs). Here we show that NMDAR activation can have differential effects on AMPAR trafficking, depending on the subunit composition of NMDARs. In mature cultured neurons, NR2A-NMDARs promote, whereas NR2B-NMDARs inhibit, the surface expression of GluR1, primarily by regulating its surface insertion. In mature neurons, NR2B is coupled to inhibition rather than activation of the Ras-ERK pathway, which drives surface delivery of GluR1. Moreover, the synaptic Ras GTPase activating protein (GAP) SynGAP is selectively associated with NR2B-NMDARs in brain and is required for inhibition of NMDAR-dependent ERK activation. Preferential coupling of NR2B to SynGAP could explain the subtype-specific function of NR2B-NMDARs in inhibition of Ras-ERK, removal of synaptic AMPARs, and weakening of synaptic transmission.
N-methyl-d-aspartate receptor (NMDAR) stimulation activates many downstream mechanisms involved in both cell survival and cell death. The manner in which the NMDAR regulates one of these pathways, the p38 mitogen-activated protein kinase (p38) pathway, is currently unknown. In the present study, we have defined a developmental-, concentration-, and time-dependent phosphorylation and subsequent dephosphorylation of p38. In cultured hippocampal neurons 7-8 days in vitro (DIV7-8), NMDAR stimulation leads to a concentration-dependent increase in p38 phosphorylation (phospho-p38). However, in more mature neurons (>DIV17) application of NMDA produces concentration-dependent effects, such that low concentrations result in sustained increases in phospho-p38 levels, and high concentrations dephosphorylate p38 within 5 min. Conantokin G, an antagonist of NR1/2A/2B and NR1/2B receptors, inhibits p38 phosphorylation, while NR1/2B-specific antagonists prevent the rapid dephosphorylation of p38 without affecting p38 activation. Furthermore, inhibition of calcineurin prevents the activation of p38, whereas inhibition of phosphoinositide 3-kinase (PI3K) prevents the rapid dephosphorylation of p38. Our results support the presence of subtype-dependent pathways regulating p38 activation and deactivation: one involves NR1/2A/2B receptors activating calcineurin and resulting in p38 phosphorylation, and the other utilizes NR1/2B receptors binding to and activating PI3K and leading to the dephosphorylation of p38 in a manner involving both NR1/2A/2B receptor activation and tyrosine phosphorylation of NR2B. The ability of NMDAR subtype-specific mechanisms to regulate p38 has implications for NMDAR-mediated synaptic plasticity, gene regulation, and excitotoxicity.
Excitatory neurotransmission mediated by NMDA (N-methyl-D-aspartate) receptors is fundamental to the physiology of the mammalian central nervous system. These receptors are heteromeric ion channels that for activation require binding of glycine and glutamate to the NR1 and NR2 subunits, respectively. NMDA receptor function is characterized by slow channel opening and deactivation, and the resulting influx of cations initiates signal transduction cascades that are crucial to higher functions including learning and memory. Here we report crystal structures of the ligand-binding core of NR2A with glutamate and that of the NR1-NR2A heterodimer with glutamate and glycine. The NR2A-glutamate complex defines the determinants of glutamate and NMDA recognition, and the NR1-NR2A heterodimer suggests a mechanism for ligand-induced ion channel opening. Analysis of the heterodimer interface, together with biochemical and electrophysiological experiments, confirms that the NR1-NR2A heterodimer is the functional unit in tetrameric NMDA receptors and that tyrosine 535 of NR1, located in the subunit interface, modulates the rate of ion channel deactivation.
Glutamate receptors responding to N-methyl-D: -aspartate (NMDA) are involved in neural development, excitotoxicity and neuronal plasticity. Each receptor includes at least two NR2 subunits. Here, we have examined the effects of selective antagonists of NR2A and NR2B subunits (NVP-AAM07 and Ro25-6981 respectively) on the effects of NMDA in the CA1 field of rat hippocampal slices. We have observed that Ro25-6981 potentiates, rather than blocks, the effects of NMD on field EPSPs and paired-pulse interactions (indicators of presynaptic effects) and on postsynaptic depolarisation in hippocampal slices. The NR2A subunit antagonist NVP-AAM077 blocks the effects of NMDA alone, or after potentiation by Ro25-6981. The potentiation of NMDA by Ro25-6981 was not prevented by staurosporine (protein kinase inhibitor), okadaic acid (an inhibitor of serine/threonine protein phosphatases) or anisomycin (protein synthesis inhibitor), but was prevented by cyclosporin A, which inhibits Ca2+/calmodulin-dependent phosphatase 2B [calcineurin]. NMDA-dependent long-term potentiation (LTP) induced by electrical stimulation was not prevented by Ro25-6981 but was prevented by selective blockade of the NR2A subunit. The results suggest that, at both presynaptic and postsynaptic sites in the rat hippocampus, NR2B-subunit-containing receptors limit NMDA receptor function by inhibitory restraint over NR2A-subunit-containing receptors, via calcineurin activation, and that LTP induction critically involves primarily receptors containing the NR2A subunit. Endogenous factors or drugs that modify this NR2B/NR2A interaction could have a major influence on synaptic transmission and plasticity in the brain.
NR2A and NR2B are the predominant NR2 NMDA receptor subunits expressed in cortex and hippocampus. The relative expression level of NR2A and NR2B is regulated developmentally and these two subunits have been suggested to play distinct roles in long-term synaptic plasticity. We have used patch-clamp recording of recombinant NMDA receptors expressed in HEK293 cells to characterize the activation properties of both NR1/NR2A and NR1/NR2B receptors. Recordings from outside-out patches that contain a single active channel show that NR2A-containing receptors have a higher probability of opening at least once in response to a brief synaptic-like pulse of glutamate than NR2B-containing receptors (NR2A, 0.80; NR2B, 0.56), a higher peak open probability (NR2A, 0.50; NR2B, 0.12), and a higher open probability within an activation (NR2A, 0.67; NR2B, 0.37). Analysis of the sequence of single-channel open and closed intervals shows that both NR2A- and NR2B-containing receptors undergo multiple conformational changes prior to opening of the channel, with at least one of these steps being faster for NR2A than NR2B. These distinct properties produce profoundly different temporal signalling profiles for NR2A- and NR2B-containing receptors. Simulations of synaptic responses demonstrate that at low frequencies typically used to induce long-term depression (LTD; 1 Hz), NR1/NR2B makes a larger contribution to total charge transfer and therefore calcium influx than NR1/NR2A. However, under high-frequency tetanic stimulation (100 Hz; > 100 ms) typically used to induce long-term potentiation (LTP), the charge transfer mediated by NR1/NR2A considerably exceeds that of NR1/NR2B.
Glutamate is the main excitatory neurotransmitter in the spinal cord and acts on several types of receptor, including N-methyl-d-aspartate (NMDA) receptors, which play an important role in synaptic plasticity and chronic pain. Three families of NMDA receptor subunit have been identified: NR1, NR2 (A-D) and NR3 (A and B). NMDA receptors are heteromeric channels that contain NR1 with at least one NR2 subunit. There is extensive evidence that NMDA receptors are present in spinal cord but little is known about their synaptic distribution. We have used an antigen-unmasking method involving pepsin treatment to reveal NR1, NR2A and NR2B subunits and have compared their distribution with that of the alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptor GluR2 subunit, which is thought to be present at most glutamatergic synapses throughout the spinal cord. After pepsin treatment, punctate labelling was seen with antibodies against each of these subunits. Although NR1 puncta were present throughout the grey matter, NR2A was concentrated in laminae III-IV and NR2B in laminae I-II. The majority of puncta labelled with each NMDA receptor antibody were GluR2-immunoreactive, which suggests that they were present at synapses, and this was confirmed with electron microscopy for the NR1 and NR2A antibodies. However, many GluR2-immunoreactive puncta did not show NMDA receptor immunoreactivity. In laminae I-II, most NR2B puncta were also NR1-immunoreactive and a similar arrangement was found for NR2A/NR1 in laminae III-IV. These results suggest that many, but not all, glutamatergic synapses in the spinal cord possess NMDA receptors and that subunit composition varies in different regions.
A c-Myc epitope-tagged N-methyl-D-aspartate receptor NR1-2a subunit was generated, NR1-2a(c-Myc), where the tag was inserted after amino acid 81. NR1-2a(c-Myc) /NR2A receptors when expressed in mammalian cells are not trafficked to the cell surface nor do they yield cell cytotoxicity post-transfection. NR1-2a(c-Myc) was, however, shown to assemble with NR2A subunits by immunoprecipitation and [(3)H]MK801 radioligand binding assays. Immunoblots of cells co-transfected with wild-type NR1-2a/NR2A subunits yielded two NR1-2a immunoreactive species with molecular masses of 115 and 226 kDa. Two-dimensional electrophoresis under non-reducing and reducing conditions revealed that the 226-kDa band contained disulfide-linked NR1-2a subunits. Only the 115-kDa NR1-2a species was detected for NR1-2a(c-Myc)/NR2A. The c-Myc epitope is inserted adjacent to cysteine 79 of the NR1-2a subunit; therefore, it is possible that the tag may prevent the formation of NR1 disulfide bridges. A series of cysteine --> alanine NR1-2a mutants was generated, and the NR1-2a mutants were co-expressed with NR2A or NR2B subunits in mammalian cells and characterized with respect to cell surface expression, cell cytotoxicity post-transfection, co-association by immunoprecipitation, and immunoblotting following SDS-PAGE under both reducing and non-reducing conditions. When co-expressed with NR2A in mammalian cells, NR1-2a(C79A)/NR2A displayed similar properties to NR1-2a(c-Myc)/NR2A in that the 226-kDa NR1 immunoreactive species was not detectable, and trafficking to the cell surface was impaired compared with wild-type NR1/NR2 receptors. These results provide the first biochemical evidence for the formation of NR1-NR1 intersubunit disulfide-linked homodimers involving cysteine 79. They suggest that disulfide bridging and structural integrity within the NR1 N-terminal domain is requisite for cell surface N-methyl-D-aspartate receptor expression.
Cytoplasmic dynein is a large minus end-directed microtubule motor that translocates cargos towards the minus end of microtubules. Light chain 8 of the dynein machinery (LC8) has been reported to interact with a large variety of proteins that possess K/RSTQT or GIQVD motifs in their sequence, hence permitting their transport in a retrograde manner. Yeast two-hybrid analysis has revealed that in brain, LC8 associates directly with several proteins such as neuronal nitric oxide synthase, guanylate kinase domain-associated protein and gephyrin. In this work, we report the identification of over 40 polypeptides, by means of a proteomic approach, that interact with LC8 either directly or indirectly. Many of the neuronal proteins that we identified cluster at the post-synaptic terminal, and some of them such as phosphofructokinase, lactate dehydrogenase or aldolase are directly involved in glutamate metabolism. Other pool of proteins identified displayed the LC8 consensus binding motif. Finally, recombinant LC8 was produced and a library of overlapping dodecapeptides (pepscan) was employed to map the LC8 binding site of some of the proteins that were previously identified using the proteomic approach, hence confirming binding to the consensus binding sites.
Striatal parameters were assessed for their relevance to age-related behavioural decline. Forty aged rats (28-30 months) were tested in the water maze and open field. Of these, seven superior and seven inferior learners were compared with each other in terms of levels of in vitro short- and long-term potentiation (STP and LTP), and gene expression of choline acetyltransferase (ChAT) as well as of the NMDA-NR2A-C subunits assessed by quantitative RT-PCR. Results revealed that the superior as compared with the inferior learners had higher levels of ChAT mRNA in the striatum. For the superior group, ChAT mRNA was correlated with escape on to the cued platform in the water maze, whereas level of LTP was predictive of place learning in the water maze and rearing activity in the open field. For the inferior group, expression of NR2A and NR2B was positively correlated with place learning and probe trial performance in the water maze. The results show that individual differences in various behaviours of aged rats were accounted for by variability in striatal parameters, i.e. LTP, ChAT and NMDA-NR2 subunit mRNA. Notably, the correlations found were heterogeneous amid the groups, e.g. variability in place learning was explained by variability in levels of LTP in the superior learners, but in levels of NR2A-B mRNA in the inferior group.
Activation of N-methyl-d-aspartate subtype glutamate receptors (NMDARs) is required for long-term potentiation (LTP) and long-term depression (LTD) of excitatory synaptic transmission at hippocampal CA1 synapses, the proposed cellular substrates of learning and memory. However, little is known about how activation of NMDARs leads to these two opposing forms of synaptic plasticity. Using hippocampal slice preparations, we showed that selectively blocking NMDARs that contain the NR2B subunit abolishes the induction of LTD but not LTP. In contrast, preferential inhibition of NR2A-containing NMDARs prevents the induction of LTP without affecting LTD production. These results demonstrate that distinct NMDAR subunits are critical factors that determine the polarity of synaptic plasticity.
Neuronal migration disorders (NMDs) constitute the main pathologic substrate of medically intractable epilepsy in human. This study is designed to investigate the changes in expression of glutamate receptor subtypes on radiation-induced NMD in rats. The lesion was produced by intrauterine irradiation (240 cGy) on E17 rats, and then 10 weeks old rats were used for the study. The pathologic and immuno-histochemical findings for glutamate receptor subunit proteins on NMD cortex were correlated with development of behavioral seizures and EEG abnormality. Spontaneous seizures uncommonly occurred in NMD rats (5%); however, clinical stages of seizures were significantly increased in NMD rats by an administration of kainic acid. Brains taken from irradiated rats revealed gross and histopathologic features of NMD. Focal cortical dysplasia was identified by histopathology and immunohistochemistry with neurofilament protein (NF-M/H). Significantly strong NR1 and NR2A/B immunoreactivities were demonstrated in cytomegalic and heterotopic neurons of NMD rats. The results of the present study indicate that epileptogenesis of NMD might be caused by upregulation of glutamate receptor expression in dysplastic neurons of the rat cerebral cortex with NMDs.
At central excitatory synapses, N-methyl-D-aspartate (NMDA) receptors, which have a high affinity for glutamate, produce a slowly rising synaptic current in response to a single transmitter pulse and an additional current after a second, closely timed stimulus. Here we show, by examining the kinetics of transmitter binding and channel gating in single-channel currents from recombinant NR1/NR2A receptors, that the synaptic response to trains of impulses is determined by the molecular reaction mechanism of the receptor. The rate constants estimated for the activation reaction predict that, after binding neurotransmitter, receptors hesitate for approximately 4 ms in a closed high-affinity conformation before they either proceed towards opening or release neurotransmitter, with about equal probabilities. Because only about half of the initially fully occupied receptors become active, repetitive stimulation elicits currents with distinct waveforms depending on pulse frequency. This high-affinity/low-efficiency activation mechanism might serve as a link between stimulation frequency and the directionality of the ensuing synaptic plasticity.
It is widely believed that long-term depression (LTD) and its counterpart, long-term potentiation (LTP), involve mechanisms that are crucial for learning and memory. However, LTD is difficult to induce in adult cortex for reasons that are not known. Here we show that LTD can be readily induced in adult cortex by the activation of NMDA receptors (NMDARs), after inhibition of glutamate uptake. Interestingly there is no need to activate synaptic NMDARs to induce this LTD, suggesting that LTD is triggered primarily by extrasynaptic NMDA receptors. We also find that de novo LTD requires the activation of NR2B-containing NMDAR, whereas LTP requires activation of NR2A-containing NMDARs. Surprisingly another form of LTD, depotentiation, requires activation of NR2A-containing NMDARs. Therefore, NMDARs with different synaptic locations and subunit compositions are involved in various forms of synaptic plasticity in adult cortex.
The specification and organization of glutamatergic synaptic transmission require the coordinated interaction among glutamate receptors and their synaptic adaptor proteins closely assembled in the postsynaptic density (PSD). Here we investigated the interaction between NMDA receptors and metabotropic glutamate receptor 5 (mGluR5) in the integral regulation of extracellular signal-regulated protein kinase (ERK) and gene expression in cultured rat striatal neurons. We found that coapplication of NMDA and the mGluR5 agonist (S)-3,5-dihydroxyphenylglycine synergistically increased ERK phosphorylation. Interestingly, the synergistic increase in ERK phosphorylation was dependent on the cross talk between NMDA receptor-associated synaptic adaptor protein PSD-95 and the mGluR5-linked adaptor protein Homer1b/c but not on the conventional Ca2+ signaling derived from NMDA receptors (Ca2+ influx) and mGluR5 (intracellular Ca2+ release). This was demonstrated by the findings that the synergistic phosphorylation of ERK induced by coactivation of NMDA receptors and mGluR5 was blocked by either a Tat peptide that disrupts NMDA receptor/PSD-95 binding or small interfering RNAs that selectively reduce cellular levels of Homer1b/c. Furthermore, ERK activated through this PSD-95/Homer1b/c-dependent and Ca2+-independent pathway was able to phosphorylate the two key transcription factors Elk-1 and cAMP response element-binding protein, which further leads to facilitation of c-Fos expression. Together, we have identified a novel Ca2+-independent signaling pathway to ERK by the synergistic interaction of NMDA receptors and mGluR5 via their adaptor proteins in the PSD of neurons, which underlies a synapse-to-nucleus communication important for the transcriptional regulation.
The activity of the N-methyl-D-aspartate (NMDA) receptor, a subclass of ionotropic glutamate receptor, is modulated by a complex network of phosphorylation and dephosphorylation. I investigated the relative extent of tyrosine phosphorylation of NMDA receptor subunit 2A (NR2A) and 2B (NR2B) subunits in the rat forebrain postsynaptic density (PSD) fraction. Immunoblot analysis of immunoprecipitates with antiphosphotyrosine antibodies indicated that tyrosine phosphorylation of NR2A was only 28.6% of that of NR2B. When phosphotyrosine-containing peptides were isolated by affinity-purification or immunoprecipitation, and probed for the two subunits, NR2B was detected but not NR2A. Furthermore, depletion of NR2B removed the phosphotyrosine-containing 180 kDa peptide from the solution while the converse was not true. The small extent of tyrosine phosphorylation of NR2A in the unstimulated condition may explain the dramatic increase in tyrosine phosphorylation in various physiological and pathological conditions.
In our previous experiments, severe cellular damages and neuronal cell loss were observed following 24h of alcohol withdrawal in primary cultures of rat cortical neurones pre-treated with ethanol (50-200 mM) repeatedly for 3 days. Increased NMDA induced cytosolic calcium responses and excitotoxicity were also demonstrated in the ethanol pre-treated cultures. Thus, the enhancement in functions of NMDA receptors was supposed to be involved in the adaptive changes leading to the neurotoxic effect of alcohol-withdrawal. In this study, we investigated the effect of the 3-day repeated ethanol (100 mM) treatment on the function and subunit composition of the NMDA receptors. Here, we demonstrate that the maximal inhibitory effect of ethanol was significantly increased after ethanol pre-treatment. Similarly, the inhibitory activity of the NR2B subunit selective antagonists threo-ifenprodil, CP-101,606 and CI-1041 was also enhanced. On the contrary, the efficiency of the channel blocker agent MK-801 and the glycine-site selective antagonist 5,7-dichlorokynurenic acid was the same as in control cultures. According to these observations, a shift in subunit expression in favour for the NR2B subunit was suggested. Indeed, we provided evidence for increased expression of the NR2B and the C1 and C2' cassette containing splice variant forms of the NR1 subunit proteins in ethanol pre-treated cultures in further experiments using a flow cytometry based immunocytochemical method. These changes may constitute the basis of the increased NMDA receptor functions and subsequently the enhanced sensitivity of ethanol pre-treated cortical neurones to excitotoxic insults resulting in increased neuronal cell loss after ethanol withdrawal. Such alterations may play a role in the neuronal adaptation to ethanol as well as in the development of alcohol dependence, and might cause neuronal cell loss in certain areas of the brain during alcohol withdrawal.
Synapse-associated protein 97 (SAP97), a member of membrane-associated guanylate kinase protein family, has been implicated in the processes of targeting ionotropic glutamate receptors at postsynaptic sites. Here we show that SAP97 is enriched at the postsynaptic density where it co-localizes with both ionotropic glutamate receptors and downstream signaling proteins such as Ca2+/calmodulin-dependent protein kinase II (CaMKII). SAP97 and alphaCaMKII display a high co-localization pattern in hippocampal neurons as well as in transfected COS-7 cells. Metabolic labeling of hippocampal cultures reveals that N-methyl-D-aspartic acid (NMDA) receptor activation induces CaMKII-dependent phosphorylation of SAP97; co-incubation with the CaMKII-specific inhibitor KN-93 reduces SAP97 phosphorylation to basal levels. Our results show that SAP97 directly interacts with the NR2A subunit of NMDA receptor both in an in vitro "pull-out" assay and in co-immunoprecipitation experiments from homogenates and synaptosomes purified from hippocampal rat tissue. Interestingly, in the postsynaptic density fraction, SAP97 fails to co-precipitate with NR2A. We show here that SAP97 is directly associated with NR2A through its PDZ1 domain, and CaMKII-dependent phosphorylation of SAP97-Ser-232 disrupts NR2A interaction both in an in vitro pull-out assay and in transfected COS-7 cells. Moreover, expression of SAP97(S232D) mutant has effects similar to those observed upon constitutively activating CaMKII. Our findings suggest that SAP97/NR2A interaction is regulated by CaMKII-dependent phosphorylation and provide a novel mechanism for the regulation of synaptic targeting of NMDA receptor subunits.
Activation of N-methyl-D-aspartate (NMDA) receptors by synaptically released glutamate in the nervous system is usually studied using evoked events mediated by a complex mixture of AMPA, kainate, and NMDA receptors. Here we have characterized pharmacologically isolated spontaneous NMDA receptor-mediated synaptic events and compared them to stimulus evoked excitatory postsynaptic currents (EPSCs) in the same cell to distinguish between various modes of activation of NMDA receptors. Spontaneous NMDA receptor-mediated EPSCs recorded at 34 degrees C in dentate gyrus granule cells (DGGC) have a frequency of 2.5 +/- 0.3 Hz and an average peak amplitude of 13.2 +/- 0.8 pA, a 10-90% rise time of 5.4 +/- 0.3 ms, and a decay time constant of 42.1 +/- 2.1 ms. The single-channel conductance estimated by nonstationary fluctuation analysis was 60 +/- 5 pS. The amplitudes (46.5 +/- 6.4 pA) and 10-90% rise times (18 +/- 2.3 ms) of EPSCs evoked from the entorhinal cortex/subiculum border are significantly larger than the same parameters for spontaneous events (paired t-test, P < 0.05, n = 17). Perfusion of 50 microM D(-)-2-amino-5-phosphonopentanoic acid blocked all spontaneous activity and caused a significant baseline current shift of 18.8 +/- 3.0 pA, thus identifying a tonic conductance mediated by NMDA receptors. The NR2B antagonist ifenprodil (10 microM) significantly reduced the frequency of spontaneous events but had no effect on their kinetics or on the baseline current or variance. At the same time, the peak current and charge of stimulus-evoked events were significantly diminished by ifenprodil. Thus spontaneous NMDA receptor-mediated events in DGGC are predominantly mediated by NR2A or possibly NR2A/NR2B receptors while the activation of NR2B receptors reduces the excitability of entorhinal afferents either directly or through an effect on the entorhinal cells.