A2m | GeneID:24153 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 24153 Official Symbol A2m
Locus N/A Gene Type protein-coding
Synonyms A2MAC1; A2m1; A2maa; MGC114358; Mam; RATA2MAC1
Full Name alpha-2-macroglobulin
Description alpha-2-macroglobulin
Chromosome 4q42
Also Known As
Summary plays a role in acute phase response; activated form induces a decrease in N-methyl-D-aspartate (NMDA) mediated calcium signaling [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37248

ID Symbol Protein Species
GeneID:2 A2M NP_000005.2 Homo sapiens
GeneID:24153 A2m NP_036620.1 Rattus norvegicus
GeneID:232345 A2m NP_783327.1 Mus musculus
GeneID:418251 A2M XP_416476.2 Gallus gallus
GeneID:465372 A2M XP_001139819.1 Pan troglodytes
GeneID:477699 A2M XP_534893.2 Canis lupus familiaris
GeneID:513856 A2M XP_591612.3 Bos taurus
GeneID:562067 LOC562067 XP_001922903.1 Danio rerio
GeneID:569025 LOC569025 XP_697477.3 Danio rerio
GeneID:793035 zgc:171445 NP_001107101.1 Danio rerio
GeneID:793100 LOC793100 XP_001332356.1 Danio rerio
GeneID:100003785 LOC100003785 XP_001921519.1 Danio rerio
GeneID:100006782 LOC100006782 XP_001345438.2 Danio rerio
GeneID:100006895 LOC100006895 XP_001923676.1 Danio rerio
GeneID:100006925 LOC100006925 XP_001921577.1 Danio rerio
GeneID:100006947 sb:cb37 XP_001345541.2 Danio rerio
GeneID:100006972 LOC100006972 XP_001345556.2 Danio rerio
GeneID:100006993 wu:fb68b01 XP_001345569.2 Danio rerio
GeneID:100101650 zgc:165518 NP_001093623.1 Danio rerio
GeneID:100136837 zgc:171446 NP_001108028.1 Danio rerio
GeneID:100137103 zgc:171426 NP_001108172.1 Danio rerio
GeneID:100137119 si:dkey-46g23.3 NP_001108188.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab58703 alpha 2 Macroglobulin antibody (ab58703); Rabbit polyclonal to alpha 2 Macroglobulin
2 abcam ab52651 alpha 2 Macroglobulin antibody (ab52651); Mouse polyclonal to alpha 2 Macroglobulin

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005576 Component extracellular region
GO:0005615 Component extracellular space
GO:0005634 Component nucleus
GO:0031093 Component platelet alpha granule lumen
GO:0019899 Function enzyme binding
GO:0019966 Function interleukin-1 binding
GO:0019959 Function interleukin-8 binding
GO:0030414 Function peptidase inhibitor activity
GO:0005102 Function receptor binding
GO:0004867 Function serine-type endopeptidase inhibitor activity
GO:0043120 Function tumor necrosis factor binding
GO:0006953 Process acute-phase response
GO:0006954 Process inflammatory response
GO:0001869 Process negative regulation of complement activation, lectin pathway
GO:0010037 Process response to carbon dioxide
GO:0042221 Process response to chemical stimulus
GO:0051384 Process response to glucocorticoid stimulus
GO:0007584 Process response to nutrient
GO:0009611 Process response to wounding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_012488  UCSC Browser NP_036620

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000044374 MI0003167 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENSRNOT00000044374 MI0003172 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENSRNOT00000044374 MI0003583 hsa-miR-576-3p AAGAUGUGGAAAAAUUGGAAUC
ENSRNOT00000044374 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSRNOT00000044374 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENSRNOT00000044374 MI0000922 rno-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSRNOT00000044374 MI0000861 rno-miR-28* CACUAGAUUGUGAGCUCCUGGA
ENSRNOT00000044374 MI0000863 rno-miR-29a* ACUGAUUUCUUUUGGUGUUCAG
ENSRNOT00000044374 MI0000865 rno-miR-29c* UGACCGAUUUCUCCUGGUGUUC
ENSRNOT00000044374 MI0000596 rno-miR-325-3p UUUAUUGAGCACCUCCUAUCAA
ENSRNOT00000044374 MI0006144 rno-miR-411 UAGUAGACCGUAUAGCGUACG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AY887133   AY919611   AY921651   BC098922   J02635   M11793   M84370   NM_012488  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAA40636   AAA40638   AAA41592   AAA41595   AAA77658   AAH98922   AAW65786   AAX11376   AAX12488   EDM02007   EDM02008   EDM02009   NP_036620   P06238   Q5D178   Q5D1M8   Q5FX35   Q63335   Q6LDG8   Q6LDR4  

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Shi Z, et al. (2008) "Alpha2-macroglobulin is a mediator of retinal ganglion cell death in glaucoma." J Biol Chem. 283(43):29156-29165. PMID:18701465
  2. [ + ] Mihailovic M, et al. (2007) "Nuclear localization and binding affinity of STAT5b for the alpha(2)-macroglobulin gene promoter during rat liver development and the acute-phase response." Acta Biochim Pol. 54(2):331-340. PMID:17565389
  3. [ + ] Uskokovic A, et al. (2007) "STAT3/NFkappaB interplay in the regulation of alpha2-macroglobulin gene expression during rat liver development and the acute phase response." IUBMB Life. 59(3):170-178. PMID:17487688
  4. [ + ] van Westrhenen R, et al. (2006) "Alpha-2-macroglobulin and albumin are useful serum proteins to detect subclinical peritonitis in the rat." Perit Dial Int. 26(1):101-107. PMID:16538883
  5. [ + ] Zhang Y, et al. (2006) "Inhibition of bone morphogenetic protein 1 by native and altered forms of alpha2-macroglobulin." J Biol Chem. 281(51):39096-39104. PMID:17071617
  6. [ + ] Dasu MR, et al. (2004) "Gene expression profiles of livers from thermally injured rats." Gene. 327(1):51-60. PMID:14960360
  7. [ + ] Sukata T, et al. (2004) "alpha(2)-Macroglobulin: a novel cytochemical marker characterizing preneoplastic and neoplastic rat liver lesions negative for hitherto established cytochemical markers." Am J Pathol. 165(5):1479-1488. PMID:15509519
  8. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  9. [ + ] Ranganathan S, et al. (2004) "Serine and threonine phosphorylation of the low density lipoprotein receptor-related protein by protein kinase Calpha regulates endocytosis and association with adaptor molecules." J Biol Chem. 279(39):40536-40544. PMID:15272003
  10. [ + ] Rajan S, et al. (2003) "Direct injection and expression in vivo of full-length cDNA of the cardiac isoform of alpha-2 macroglobulin induces cardiac hypertrophy in the rat heart." Basic Res Cardiol. 98(1):39-49. PMID:12494268
  11. [ + ] Bhanushali AA, et al. (2002) "Cancer-related anemia in a rat model: alpha2-macroglobulin from Yoshida sarcoma shortens erythrocyte survival." Eur J Haematol. 68(1):42-48. PMID:11952820
  12. [ + ] Tygstrup N, et al. (2002) "Messenger RNA profiles in liver injury and stress: a comparison of lethal and nonlethal rat models." Biochem Biophys Res Commun. 290(1):518-525. PMID:11779202
  13. [ + ] Qiu Z, et al. (2002) "alpha 2-Macroglobulin exposure reduces calcium responses to N-methyl-D-aspartate via low density lipoprotein receptor-related protein in cultured hippocampal neurons." J Biol Chem. 277(17):14458-14466. PMID:11839752
  14. [ + ] Are C, et al. (2002) "Carbon dioxide pneumoperitoneum alters acute-phase response induced by lipopolysaccharide." Surg Endosc. 16(10):1464-1467. PMID:12042906
  15. [ + ] Shimizu M, et al. (2002) "Transplacental transport of alpha 2-macroglobulin (alpha 2M) and induction of alpha 2M in maternal and neonatal rats with acute inflammation." Exp Anim. 51(4):361-365. PMID:12221929
  16. [ + ] Milosavljevic TS, et al. (2002) "DNA binding activity of C/EBPbeta and C/EBPdelta for the rat alpha2-macroglobulin gene promoter is regulated in an acute-phase dependent manner." Biochemistry (Mosc). 67(8):918-926. PMID:12223092
  17. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  18. [ + ] Schweer D, et al. (2001) "No association of three polymorphisms in the alpha-2-macroglobulin and lipoprotein related receptor genes with multiple sclerosis." J Neuroimmunol. 118(2):300-303. PMID:11498265
  19. [ + ] Andrejko KM, et al. (1998) "Intrahepatic STAT-3 activation and acute phase gene expression predict outcome after CLP sepsis in the rat." Am J Physiol. 275(6 Pt 1):G1423-G1429. PMID:9843780
  20. [ + ] Blacker D, et al. (1998) "Alpha-2 macroglobulin is genetically associated with Alzheimer disease." Nat Genet. 19(4):357-360. PMID:9697696
  21. [ + ] Lyoumi S, et al. (1998) "Induction and modulation of acute-phase response by protein malnutrition in rats: comparative effect of systemic and localized inflammation on interleukin-6 and acute-phase protein synthesis." J Nutr. 128(2):166-174. PMID:9446838
  22. [ + ] Eggertsen G, et al. (1991) "Sequence of rat alpha 1-macroglobulin, a broad-range proteinase inhibitor from the alpha-macroglobulin-complement family." Mol Biol Med. 8(2):287-302. PMID:1725450
  23. [ + ] Kunz D, et al. (1989) "Identification of the promoter sequences involved in the interleukin-6 dependent expression of the rat alpha 2-macroglobulin gene." Nucleic Acids Res. 17(3):1121-1138. PMID:2466233
  24. [ + ] Northemann W, et al. (1988) "Structure and acute-phase regulation of the rat alpha 2-macroglobulin gene." Biochemistry. 27(26):9194-9203. PMID:2468362
  25. [ + ] Kurokawa S, et al. (1987) "Kupffer cell stimulation of alpha 2-macroglobulin synthesis in rat hepatocytes and the role of glucocorticoid." Cell Struct Funct. 12(1):35-42. PMID:2436819
  26. [ + ] Tsuchiya Y, et al. (1987) "Sequence analysis of the putative regulatory region of rat alpha 2-macroglobulin gene." Gene. 57(1):73-80. PMID:2448189
  27. [ + ] Gehring MR, et al. (1987) "Sequence of rat liver alpha 2-macroglobulin and acute phase control of its messenger RNA." J Biol Chem. 262(1):446-454. PMID:2432068
  28. [ + ] Northemann W, et al. (1985) "Molecular cloning of cDNA sequences for rat alpha 2-macroglobulin and measurement of its transcription during experimental inflammation." J Biol Chem. 260(10):6200-6205. PMID:2581948
  29. [ + ] Hayashida K, et al. (1985) "Molecular cloning of DNA complementary to rat alpha 2-macroglobulin mRNA." J Biol Chem. 260(26):14224-14229. PMID:2414291