ABCA4 | GeneID:24 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 24 Official Symbol ABCA4
Locus N/A Gene Type protein-coding
Synonyms ABC10; ABCR; ARMD2; CORD3; DKFZp781N1972; FFM; FLJ17534; RMP; RP19; STGD; STGD1
Full Name ATP-binding cassette, sub-family A (ABC1), member 4
Description ATP-binding cassette, sub-family A (ABC1), member 4
Chromosome 1p22.1-p21
Also Known As ATP binding cassette transporter; ATP-binding cassette, sub-family A member 4; ATP-binding transporter, retina-specific; OTTHUMP00000012366; photoreceptor rim protein; retina-specific ABC transporter
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is a retina-specific ABC transporter with N-retinylidene-PE as a substrate. It is expressed exclusively in retina photoreceptor cells, indicating the gene product mediates transport of an essental molecule across the photoreceptor cell membrane. Mutations in this gene are found in patients diagnosed with Stargardt disease, a form of juvenile-onset macular degeneration. Mutations in this gene are also associated with retinitis pigmentosa-19, cone-rod dystrophy type 3, early-onset severe retinal dystrophy, fundus flavimaculatus, and macular degeneration age-related 2. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 298

ID Symbol Protein Species
GeneID:24 ABCA4 NP_000341.2 Homo sapiens
GeneID:11304 Abca4 NP_031404.1 Mus musculus
GeneID:171782 abt-2 NP_490949.3 Caenorhabditis elegans
GeneID:281584 ABCA4 NP_776646.1 Bos taurus
GeneID:310836 Abca4 XP_241525.3 Rattus norvegicus
GeneID:424490 ABCA4 XP_422330.2 Gallus gallus
GeneID:444852 ABCA4 NP_001003360.2 Canis lupus familiaris
GeneID:555506 LOC555506 XP_683123.3 Danio rerio
GeneID:745972 ABCA4 XP_001152577.1 Pan troglodytes

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 acris AM08246PU-N ABCA4; antibody Ab
2 scbt ABCA4 ABCA4 Antibody / ABCA4 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCA4 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCA4 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0005624 Component membrane fraction
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0004012 Function phospholipid-translocating ATPase activity
GO:0005548 Function phospholipid transporter activity
GO:0005215 Function transporter activity
GO:0006649 Process phospholipid transfer to membrane
GO:0045494 Process photoreceptor cell maintenance
GO:0007603 Process phototransduction, visible light
GO:0050896 Process response to stimulus
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000350  UCSC Browser NP_000341

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000361520 MI0004999 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENST00000361520 MI0005000 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENST00000361520 MI0000469 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENST00000361520 MI0000252 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENST00000361520 MI0000473 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENST00000361520 MI0000459 hsa-miR-143 UGAGAUGAAGCACUGUAGCUC
ENST00000361520 MI0000461 hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENST00000361520 MI0000480 hsa-miR-154* AAUCAUACACGGUUGACCUAUU
ENST00000361520 MI0000071 hsa-miR-17* ACUGCAGUGAAGGCACUUGUAG
ENST00000361520 MI0000271 hsa-miR-181c* AACCAUCGACCGUUGAGUGGAC
ENST00000361520 MI0003137 hsa-miR-193b* CGGGGUUUUGAGGGCGAGAUGA
ENST00000361520 MI0001519 hsa-miR-20b* ACUGUAGUAUGGGCACUUCCAG
ENST00000361520 MI0000078 hsa-miR-22 AAGCUGCCAGUUGAAGAACUGU
ENST00000361520 MI0000300 hsa-miR-223 UGUCAGUUUGUCAAAUACCCCA
ENST00000361520 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENST00000361520 MI0000105 hsa-miR-29b-1* GCUGGUUUCAUAUGGUGGUUUAGA
ENST00000361520 MI0000107 hsa-miR-29b-2* CUGGUUUCACAUGGUGGCUUAG
ENST00000361520 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENST00000361520 MI0000805 hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU
ENST00000361520 MI0000776 hsa-miR-376c AACAUAGAGGAAAUUCCACGU
ENST00000361520 MI0000785 hsa-miR-377 AUCACACAAAGGCAACUUUUGU
ENST00000361520 MI0000788 hsa-miR-380* UGGUUGACCAUAGAACAUGCGC
ENST00000361520 MI0003513 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC
ENST00000361520 MI0002468 hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENST00000361520 MI0002469 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
ENST00000361520 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENST00000361520 MI0003530 hsa-miR-487b AAUCGUACAGGGUCAUCCACUU
ENST00000361520 MI0003123 hsa-miR-488 UUGAAAGGCUAUUUCUUGGUC
ENST00000361520 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENST00000361520 MI0005539 hsa-miR-541* AAAGGAUUCUGCUGUCGGUCCCACU
ENST00000361520 MI0003515 hsa-miR-544 AUUCUGCAUUUUUAGCAAGUUC
ENST00000361520 MI0003581 hsa-miR-574-3p CACGCUCAUGCACACACCCACA
ENST00000361520 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENST00000361520 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENST00000361520 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENST00000361520 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENST00000361520 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENST00000361520 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENST00000361520 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENST00000361520 MI0003834 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU
ENST00000361520 MI0005564 hsa-miR-873 GCAGGAACUUGUGAGUCUCCU
ENST00000361520 MI0000098 hsa-miR-96* AAUCAUGUGCAGUGCCAAUAUG
ENST00000361520 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENST00000361520 MI0002398 mmu-miR-463 UGAUAGACACCAUAUAAGGUAG
ENST00000361520 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENST00000361520 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENST00000361520 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENST00000361520 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000361520 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000361520 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000361520 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000361520 MI0002404 mmu-miR-469 UGCCUCUUUCAUUGAUCUUGGUGUCC
ENST00000361520 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENST00000361520 MI0004647 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENST00000361520 MI0004648 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENST00000361520 MI0004653 mmu-miR-688 UCGCAGGCGACUACUUAUUC
ENST00000361520 MI0004664 mmu-miR-694 CUGAAAAUGUUGCCUGAAG
ENST00000361520 MI0005470 mmu-miR-743b-3p GAAAGACAUCAUGCUGAAUAGA
ENST00000361520 MI0004310 mmu-miR-764-3p AGGAGGCCAUAGUGGCAACUGU
ENST00000370225 MI0004999 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENST00000370225 MI0005000 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENST00000370225 MI0000459 hsa-miR-143 UGAGAUGAAGCACUGUAGCUC
ENST00000370225 MI0000461 hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENST00000370225 MI0000480 hsa-miR-154* AAUCAUACACGGUUGACCUAUU
ENST00000370225 MI0000071 hsa-miR-17* ACUGCAGUGAAGGCACUUGUAG
ENST00000370225 MI0000271 hsa-miR-181c* AACCAUCGACCGUUGAGUGGAC
ENST00000370225 MI0003137 hsa-miR-193b* CGGGGUUUUGAGGGCGAGAUGA
ENST00000370225 MI0001519 hsa-miR-20b* ACUGUAGUAUGGGCACUUCCAG
ENST00000370225 MI0000300 hsa-miR-223 UGUCAGUUUGUCAAAUACCCCA
ENST00000370225 MI0000107 hsa-miR-29b-2* CUGGUUUCACAUGGUGGCUUAG
ENST00000370225 MI0000805 hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU
ENST00000370225 MI0000785 hsa-miR-377 AUCACACAAAGGCAACUUUUGU
ENST00000370225 MI0000788 hsa-miR-380* UGGUUGACCAUAGAACAUGCGC
ENST00000370225 MI0003513 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC
ENST00000370225 MI0002468 hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENST00000370225 MI0002469 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
ENST00000370225 MI0003530 hsa-miR-487b AAUCGUACAGGGUCAUCCACUU
ENST00000370225 MI0003123 hsa-miR-488 UUGAAAGGCUAUUUCUUGGUC
ENST00000370225 MI0005539 hsa-miR-541* AAAGGAUUCUGCUGUCGGUCCCACU
ENST00000370225 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENST00000370225 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENST00000370225 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENST00000370225 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENST00000370225 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENST00000370225 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENST00000370225 MI0003834 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU
ENST00000370225 MI0005564 hsa-miR-873 GCAGGAACUUGUGAGUCUCCU
ENST00000370225 MI0000098 hsa-miR-96* AAUCAUGUGCAGUGCCAAUAUG
ENST00000370225 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENST00000370225 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENST00000370225 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENST00000370225 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENST00000370225 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000370225 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000370225 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000370225 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000370225 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENST00000370225 MI0004653 mmu-miR-688 UCGCAGGCGACUACUUAUUC
ENST00000370225 MI0005470 mmu-miR-743b-3p GAAAGACAUCAUGCUGAAUAGA
ENST00000370225 MI0004310 mmu-miR-764-3p AGGAGGCCAUAGUGGCAACUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Retinaldehyde
  • ABCA4 protein affects the transport of Retinaldehyde
16968212

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
CNGB1 ABCA4 / CNGB1 Affinity Capture-Western Korschen HG (1999)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Roberts LJ, et al. (2009) "Clinical utility of the ABCR400 microarray: basing a genetic service on a commercial gene chip." Arch Ophthalmol. 127(4):549-554. PMID:19365039
  2. [ + ] Hwang JC, et al. (2009) "Peripapillary atrophy in Stargardt disease." Retina. 29(2):181-186. PMID:18854780
  3. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  4. [ + ] Cideciyan AV, et al. (2009) "ABCA4 disease progression and a proposed strategy for gene therapy." Hum Mol Genet. 18(5):931-941. PMID:19074458
  5. [ + ] Zhong M, et al. (2009) "Role of the C terminus of the photoreceptor ABCA4 transporter in protein folding, function, and retinal degenerative diseases." J Biol Chem. 284(6):3640-3649. PMID:19056738
  6. [ + ] Aguirre-Lamban J, et al. (2009) "Molecular analysis of the ABCA4 gene for reliable detection of allelic variations in Spanish patients: identification of 21 novel variants." Br J Ophthalmol. 93(5):614-621. PMID:19028736
  7. [ + ] Jamieson SE, et al. (2009) "Host genetic and epigenetic factors in toxoplasmosis." Mem Inst Oswaldo Cruz. 104(2):162-169. PMID:19430638
  8. [ + ] Westerfeld C, et al. (2008) "Stargardt's disease and the ABCR gene." Semin Ophthalmol. 23(1):59-65. PMID:18214793
  9. [ + ] Kitiratschky VB, et al. (2008) "ABCA4 gene analysis in patients with autosomal recessive cone and cone rod dystrophies." Eur J Hum Genet. 16(7):812-819. PMID:18285826
  10. [ + ] Francis PJ, et al. (2008) "Polymorphisms in C2, CFB and C3 are associated with progression to Advanced Age-Related Macular Degeneration associated with visual loss." J Med Genet. ():. PMID:19015224
  11. [ + ] Riveiro-Alvarez R, et al. (2008) "Frequency of ABCA4 mutations in 278 Spanish controls: an insight into the prevalence of autosomal recessive Stargardt disease (arSTGD)." Br J Ophthalmol. ():. PMID:18977788
  12. [ + ] Ng D, et al. (2008) "Replication of a genome-wide case-control study of esophageal squamous cell carcinoma." Int J Cancer. 123(7):1610-1615. PMID:18649358
  13. [ + ] Jamieson SE, et al. (2008) "Genetic and epigenetic factors at COL2A1 and ABCA4 influence clinical outcome in congenital toxoplasmosis." PLoS ONE. 3(6):e2285. PMID:18523590
  14. [ + ] Shastry BS, et al. (2008) "Evaluation of the common variants of the ABCA4 gene in families with Stargardt disease and autosomal recessive retinitis pigmentosa." Int J Mol Med. 21(6):715-720. PMID:18506364
  15. [ + ] Riveiro-Alvarez R, et al. (2008) "Molecular analysis of ABCA4 and CRB1 genes in a Spanish family segregating both Stargardt disease and autosomal recessive retinitis pigmentosa." Mol Vis. 14():262-267. PMID:18334942
  16. [ + ] Valverde D, et al. (2007) "Spectrum of the ABCA4 gene mutations implicated in severe retinopathies in Spanish patients." Invest Ophthalmol Vis Sci. 48(3):985-990. PMID:17325136
  17. [ + ] Michaelides M, et al. (2007) "ABCA4 mutations and discordant ABCA4 alleles in patients and siblings with bull's-eye maculopathy." Br J Ophthalmol. 91(12):1650-1655. PMID:18024811
  18. [ + ] Bini A, et al. (2007) "Retinal astrocytic hamartoma and Stargardt's disease: unusual association in a patient with ABCR mutation without phacomatosis." Clin Experiment Ophthalmol. 35(8):777-779. PMID:17997789
  19. [ + ] Rosenberg T, et al. (2007) "N965S is a common ABCA4 variant in Stargardt-related retinopathies in the Danish population." Mol Vis. 13():1962-1969. PMID:17982420
  20. [ + ] Stenirri S, et al. (2007) "Molecular scanning of the ABCA4 gene in Spanish patients with retinitis pigmentosa and Stargardt disease: identification of novel mutations." Eur J Ophthalmol. 17(5):749-754. PMID:17932850
  21. [ + ] Beit-Ya'acov A, et al. (2007) "Homozygosity for a novel ABCA4 founder splicing mutation is associated with progressive and severe Stargardt-like disease." Invest Ophthalmol Vis Sci. 48(9):4308-4314. PMID:17724221
  22. [ + ] Roni V, et al. (2007) "Mapping of transcription start sites of human retina expressed genes." BMC Genomics. 8():42. PMID:17286855
  23. [ + ] Singh HP, et al. (2006) "Homozygous null mutations in the ABCA4 gene in two families with autosomal recessive retinal dystrophy." Am J Ophthalmol. 141(5):906-913. PMID:16546111
  24. [ + ] Valverde D, et al. (2006) "Microarray-based mutation analysis of the ABCA4 gene in Spanish patients with Stargardt disease: evidence of a prevalent mutated allele." Mol Vis. 12():902-908. PMID:16917483
  25. [ + ] Stenirri S, et al. (2006) "De novo deletion removes a conserved motif in the C-terminus of ABCA4 and results in cone-rod dystrophy." Clin Chem Lab Med. 44(5):533-537. PMID:16681420
  26. [ + ] Fukui T, et al. (2006) "Null ABCA4 gene mutations found in Japanese patients with panretinal degeneration." Jpn J Ophthalmol. 50(2):179-181. PMID:16604398
  27. [ + ] Biswas-Fiss EE, et al. (2006) "Interaction of the nucleotide binding domains and regulation of the ATPase activity of the human retina specific ABC transporter, ABCR." Biochemistry. 45(11):3813-3823. PMID:16533065
  28. [ + ] Hargitai J, et al. (2005) "Correlation of clinical and genetic findings in Hungarian patients with Stargardt disease." Invest Ophthalmol Vis Sci. 46(12):4402-4408. PMID:16303926
  29. [ + ] MacDonald IM, et al. (2005) "Genetic aspects of age-related macular degeneration." Can J Ophthalmol. 40(3):288-292. PMID:15947798
  30. [ + ] Kang Derwent JJ, et al. (2004) "Dark adaptation of rod photoreceptors in normal subjects, and in patients with Stargardt disease and an ABCA4 mutation." Invest Ophthalmol Vis Sci. 45(7):2447-2456. PMID:15223829
  31. [ + ] Klevering BJ, et al. (2004) "Microarray-based mutation analysis of the ABCA4 (ABCR) gene in autosomal recessive cone-rod dystrophy and retinitis pigmentosa." Eur J Hum Genet. 12(12):1024-1032. PMID:15494742
  32. [ + ] Shastry BS, et al. (2004) "Evaluation of the ABCR and glutathione peroxidase-3 genes in familial and sporadic cases of exudative age-related macular degeneration." Int J Mol Med. 14(4):753-757. PMID:15375613
  33. [ + ] Simonelli F, et al. (2004) "Association of a homozygous nonsense mutation in the ABCA4 (ABCR) gene with cone-rod dystrophy phenotype in an Italian family." Ophthalmic Res. 36(2):82-88. PMID:15017103
  34. [ + ] Yatsenko AN, et al. (2003) "An ABCA4 genomic deletion in patients with Stargardt disease." Hum Mutat. 21(6):636-644. PMID:12754711
  35. [ + ] Ahn J, et al. (2003) "Functional interaction between the two halves of the photoreceptor-specific ATP binding cassette protein ABCR (ABCA4). Evidence for a non-exchangeable ADP in the first nucleotide binding domain." J Biol Chem. 278(41):39600-39608. PMID:12888572
  36. [ + ] Schmidt S, et al. (2003) "Detailed analysis of allelic variation in the ABCA4 gene in age-related maculopathy." Invest Ophthalmol Vis Sci. 44(7):2868-2875. PMID:12824224
  37. [ + ] Fishman GA, et al. (2003) "ABCA4 gene sequence variations in patients with autosomal recessive cone-rod dystrophy." Arch Ophthalmol. 121(6):851-855. PMID:12796258
  38. [ + ] Baum L, et al. (2003) "ABCA4 sequence variants in Chinese patients with age-related macular degeneration or Stargardt's disease." Ophthalmologica. 217(2):111-114. PMID:12592048
  39. [ + ] Iida A, et al. (2002) "Catalog of 605 single-nucleotide polymorphisms (SNPs) among 13 genes encoding human ATP-binding cassette transporters: ABCA4, ABCA7, ABCA8, ABCD1, ABCD3, ABCD4, ABCE1, ABCF1, ABCG1, ABCG2, ABCG4, ABCG5, and ABCG8." J Hum Genet. 47(6):285-310. PMID:12111378
  40. [ + ] Suarez T, et al. (2002) "Biochemical defects in retina-specific human ATP binding cassette transporter nucleotide binding domain 1 mutants associated with macular degeneration." J Biol Chem. 277(24):21759-21767. PMID:11919200
  41. [ + ] Maugeri A, et al. (2002) "The ABCA4 2588G>C Stargardt mutation: single origin and increasing frequency from South-West to North-East Europe." Eur J Hum Genet. 10(3):197-203. PMID:11973624
  42. [ + ] Fukui T, et al. (2002) "ABCA4 gene mutations in Japanese patients with Stargardt disease and retinitis pigmentosa." Invest Ophthalmol Vis Sci. 43(9):2819-2824. PMID:12202497
  43. [ + ] Paloma E, et al. (2002) "Analysis of ABCA4 in mixed Spanish families segregating different retinal dystrophies." Hum Mutat. 20(6):476. PMID:12442277
  44. [ + ] Ducroq D, et al. (2002) "The ABCA4 gene in autosomal recessive cone-rod dystrophies." Am J Hum Genet. 71(6):1480-1482. PMID:12515255
  45. [ + ] Bungert S, et al. (2001) "Membrane topology of the ATP binding cassette transporter ABCR and its relationship to ABC1 and related ABCA transporters: identification of N-linked glycosylation sites." J Biol Chem. 276(26):23539-23546. PMID:11320094
  46. [ + ] Shroyer NF, et al. (2001) "Cosegregation and functional analysis of mutant ABCR (ABCA4) alleles in families that manifest both Stargardt disease and age-related macular degeneration." Hum Mol Genet. 10(23):2671-2678. PMID:11726554
  47. [ + ] Eksandh L, et al. (2001) "Different clinical expressions in two families with Stargardt's macular dystrophy (STGD1)." Acta Ophthalmol Scand. 79(5):524-530. PMID:11594993
  48. [ + ] Briggs CE, et al. (2001) "Mutations in ABCR (ABCA4) in patients with Stargardt macular degeneration or cone-rod degeneration." Invest Ophthalmol Vis Sci. 42(10):2229-2236. PMID:11527935
  49. [ + ] Biswas EE, et al. (2001) "Nucleotide binding domain 1 of the human retinal ABC transporter functions as a general ribonucleotidase." Biochemistry. 40(28):8181-8187. PMID:11444963
  50. [ + ] Paloma E, et al. (2001) "Spectrum of ABCA4 (ABCR) gene mutations in Spanish patients with autosomal recessive macular dystrophies." Hum Mutat. 17(6):504-510. PMID:11385708