FXN | GeneID:2395 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2395 Official Symbol FXN
Locus N/A Gene Type protein-coding
Synonyms CyaY; FA; FARR; FRDA; MGC57199; X25
Full Name frataxin
Description frataxin
Chromosome 9q13-q21.1
Also Known As OTTHUMP00000021428
Summary This nuclear gene encodes a mitochondrial protein which belongs to FRATAXIN family. The protein functions in regulating mitochondrial iron transport and respiration. The expansion of intronic trinucleotide repeat GAA results in Friedreich ataxia. Alternative splicing results in multiple transcript variants. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 47908

ID Symbol Protein Species
GeneID:2395 FXN NP_000135.2 Homo sapiens
GeneID:14297 Fxn NP_032070.1 Mus musculus
GeneID:31845 fh NP_511094.1 Drosophila melanogaster
GeneID:174002 frh-1 NP_495183.1 Caenorhabditis elegans
GeneID:427244 FXN XP_424827.2 Gallus gallus
GeneID:499335 Fxn XP_574642.1 Rattus norvegicus
GeneID:505694 FXN XP_582022.3 Bos taurus
GeneID:556389 fxn NP_001076485.1 Danio rerio
GeneID:737660 FXN XP_001137864.1 Pan troglodytes
GeneID:828013 ATFH/FH NP_192233.2 Arabidopsis thaliana
GeneID:1272401 AgaP_AGAP000813 XP_311351.2 Anopheles gambiae
GeneID:2539143 SPCC1183.03c NP_587886.1 Schizosaccharomyces pombe

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab48281 Frataxin antibody (ab48281); Rabbit polyclonal to Frataxin
2 abcam ab55021 Frataxin antibody (ab55021); Mouse monoclonal to Frataxin
3 abgent AP6409c FXN Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
4 abgent AP6409b FXN Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
5 abnova H00002395-M01 FXN monoclonal antibody (M01), clone 1D9; Mouse monoclonal antibody raised against a partial recombinant FXN.
6 abnova H00002395-M03 FXN monoclonal antibody (M03), clone 3G9; Mouse monoclonal antibody raised against a partial recombinant FXN.
7 abnova H00002395-M04 FXN monoclonal antibody (M04), clone 3C3; Mouse monoclonal antibody raised against a partial recombinant FXN.
8 abnova H00002395-M02 FXN monoclonal antibody (M02), clone 3F3; Mouse monoclonal antibody raised against a partial recombinant FXN.
9 abnova H00002395-M05 FXN monoclonal antibody (M05), clone 3E7; Mouse monoclonal antibody raised against a partial recombinant FXN.
10 abnova H00002395-M06 FXN monoclonal antibody (M06), clone 5D4; Mouse monoclonal antibody raised against a partial recombinant FXN.
11 abnova H00002395-M07 FXN monoclonal antibody (M07), clone 5E3; Mouse monoclonal antibody raised against a partial recombinant FXN.
12 acris AP13487PU-N Frataxin (FXN) (C-term); antibody Ab
13 acris AP13488PU-N Frataxin (FXN) (Center); antibody Ab
14 scbt FXN FXN Antibody / FXN Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of FXN Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FXN Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005829 Component cytosol
GO:0005759 Component mitochondrial matrix
GO:0005739 Component mitochondrion
GO:0051537 Function 2 iron, 2 sulfur cluster binding
GO:0008199 Function ferric iron binding
GO:0008198 Function ferrous iron binding
GO:0034986 Function iron chaperone activity
GO:0005515 Function protein binding
GO:0007628 Process adult walking behavior
GO:0009060 Process aerobic respiration
GO:0006879 Process cellular iron ion homeostasis
GO:0009792 Process embryonic development ending in birth or egg hatching
GO:0006783 Process heme biosynthetic process
GO:0018283 Process iron incorporation into metallo-sulfur cluster
GO:0007005 Process mitochondrion organization
GO:0040015 Process negative regulation of multicellular organism growth
GO:0046621 Process negative regulation of organ growth
GO:0006119 Process oxidative phosphorylation
GO:0030307 Process positive regulation of cell growth
GO:0008284 Process positive regulation of cell proliferation
GO:0051349 Process positive regulation of lyase activity
GO:0048554 Process positive regulation of metalloenzyme activity
GO:0051353 Process positive regulation of oxidoreductase activity
GO:0051347 Process positive regulation of transferase activity
GO:0019230 Process proprioception
GO:0016540 Process protein autoprocessing
GO:0010722 Process regulation of ferrochelatase activity
GO:0010039 Process response to iron ion

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000144  UCSC Browser NP_000135
2 NM_181425  UCSC Browser NP_852090 Q16595   A8MXJ6  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000377270 MI0000066 hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENST00000377270 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENST00000377270 MI0000253 hsa-miR-148a UCAGUGCACUACAGAACUUUGU
ENST00000377270 MI0000811 hsa-miR-148b UCAGUGCAUCACAGAACUUUGU
ENST00000377270 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENST00000377270 MI0000480 hsa-miR-154* AAUCAUACACGGUUGACCUAUU
ENST00000377270 MI0000073 hsa-miR-19a* AGUUUUGCAUAGUUGCACUACA
ENST00000377270 MI0005570 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU
ENST00000377270 MI0000745 hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENST00000377270 MI0005568 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC
ENST00000377270 MI0000777 hsa-miR-369-5p AGAUCGACCGUGUUAUAUUCGC
ENST00000377270 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENST00000377270 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENST00000377270 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENST00000377270 MI0003198 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000377270 MI0003199 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000377270 MI0003200 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000377270 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENST00000377270 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENST00000377270 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENST00000377270 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENST00000377270 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENST00000377270 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENST00000377270 MI0003160 hsa-miR-524-5p CUACAAAGGGAAGCACUUUCUC
ENST00000377270 MI0003556 hsa-miR-551a GCGACCCACUCUUGGUUUCCA
ENST00000377270 MI0003634 hsa-miR-620 AUGGAGAUAGAUAUAGAAAU
ENST00000377270 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENST00000377270 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENST00000377270 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENST00000377270 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENST00000377270 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000377270 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000377270 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000377270 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000377270 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000377270 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000377270 MI0004687 mmu-miR-703 AAAACCUUCAGAAGGAAAGAA
ENST00000377270 MI0004651 mmu-miR-719 AUCUCGGCUACAGAAAAAUGUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Iron
  • FXN protein affects the metabolism of Iron
17194590
Iron
  • FXN protein results in increased metabolism of Iron
17101455
Iron
  • Iron binds to FXN protein
16911956
Lipopolysaccharides
  • Lipopolysaccharides results in increased expression of FXN mRNA
12057914
pirinixic acid
  • pirinixic acid results in increased expression of FXN mRNA
18301758
retinol acetate
  • retinol acetate results in increased expression of FXN mRNA
16772331

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Friedreich Ataxia marker 17101455, 16911956
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Hemolytic-Uremic Syndrome inferred via Lipopolysaccharides 16366002
Inflammation inferred via Lipopolysaccharides 17255318, 17963957
Iron Metabolism Disorders inferred via Lipopolysaccharides 17255318
Respiratory Hypersensitivity inferred via Lipopolysaccharides 10835634
alpha 1-Antitrypsin Deficiency inferred via Iron 16640825
Alzheimer Disease inferred via Iron 16640825, 16563566
Anemia inferred via Iron 16566752, 16434484
Anemia, Iron-Deficiency inferred via Iron 17162259, 17163184, 17375513, 16569441, 17147795
Anemia, Sideroblastic inferred via Iron 16910769
Arrhythmias, Cardiac inferred via Iron 16604332
Atherosclerosis inferred via Iron 16640825, 16632123
Bacterial Infections inferred via Iron 16640825
Cardiomyopathies inferred via Iron 16640825
Cardiomyopathy, Dilated inferred via Iron 16604332
Colonic Neoplasms inferred via Iron 16640825
Diabetes Mellitus inferred via Iron 16640825, 16604332
Diabetes Mellitus, Type 1 inferred via Iron 16506275
Diabetes Mellitus, Type 2 inferred via Iron 16506275
Fatty Liver inferred via Iron 16640825
Friedreich Ataxia inferred via Iron 16640825, 16604332
Hemochromatosis inferred via Iron 17236123, 16574947, 16604332, 16640825, 17053826, 17255318
Hemosiderosis inferred via Iron 16604332
Hepatitis, Viral, Human inferred via Iron 16640825
Hepatolenticular Degeneration inferred via Iron 17182432
Hepatomegaly inferred via Iron 16890145
HIV Infections inferred via Iron 16597321
Hypogonadism inferred via Iron 16640825
Hypothyroidism inferred via Iron 16640825
Iron Metabolism Disorders inferred via Iron 17163184
Lewy Body Disease inferred via Iron 16563566
Liver Cirrhosis inferred via Iron 16640825
Liver Diseases, Alcoholic inferred via Iron 17207112, 16737972
Liver Neoplasms inferred via Iron 16640825
Lung Neoplasms inferred via Iron 16640825
Macular Degeneration inferred via Iron 16640825
Multiple Sclerosis, Chronic Progressive inferred via Iron 17086897
Mycoses inferred via Iron 16640825
Myocardial Ischemia inferred via Iron 16604332
Myocardial Reperfusion Injury inferred via Iron 16604332
Nephrotic Syndrome inferred via Iron 17178036
Neurodegenerative Diseases inferred via Iron 17296847, 16604332
Osteoarthritis inferred via Iron 16640825
Osteoporosis inferred via Iron 16640825, 16648989
Parkinson Disease inferred via Iron 16640825, 16563566
Pituitary Diseases inferred via Iron 16604332
Poisoning inferred via Iron 16604332
Porphyria Cutanea Tarda inferred via Iron 16640825
Pre-Eclampsia inferred via Iron 16640825
Protozoan Infections inferred via Iron 16640825
Restless Legs Syndrome inferred via Iron 16930377
Sudden Infant Death inferred via Iron 16640825
Tuberculosis inferred via Iron 16597321

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
PMPCB PMPCB / FXN Reconstituted Complex Koutnikova H (1998)
PMPCB PMPCB / FXN Two-hybrid Koutnikova H (1998)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Gangat N, et al. (2009) "Absence of frataxin mutations in refractory anemia with ring sideroblasts (RARS)." Leuk Res. 33(4):586-587. PMID:18687468
  2. [ + ] Lamba LD, et al. (2009) "Friedreich's ataxia: a new mutation in two compound heterozygous siblings with unusual clinical onset." Eur Neurol. 61(4):240-243. PMID:19182486
  3. [ + ] Wardle M, et al. (2009) "The genetic aetiology of late-onset chronic progressive cerebellar ataxia. A population-based study." J Neurol. 256(3):343-348. PMID:19259763
  4. [ + ] Shiffman D, et al. (2008) "Analysis of 17,576 potentially functional SNPs in three case-control studies of myocardial infarction." PLoS ONE. 3(8):e2895. PMID:18682748
  5. [ + ] Long S, et al. (2008) "Mitochondrial localization of human frataxin is necessary but processing is not for rescuing frataxin deficiency in Trypanosoma brucei." Proc Natl Acad Sci U S A. 105(36):13468-13473. PMID:18768799
  6. [ + ] Schmucker S, et al. (2008) "The in vivo mitochondrial two-step maturation of human frataxin." Hum Mol Genet. 17(22):3521-3531. PMID:18725397
  7. [ + ] Castaldo I, et al. (2008) "DNA methylation in intron 1 of the frataxin gene is related to GAA repeat length and age of onset in Friedreich ataxia patients." J Med Genet. 45(12):808-812. PMID:18697824
  8. [ + ] Baralle M, et al. (2008) "Influence of Friedreich ataxia GAA noncoding repeat expansions on pre-mRNA processing." Am J Hum Genet. 83(1):77-88. PMID:18597733
  9. [ + ] Acquaviva F, et al. (2008) "Recombinant human erythropoietin increases frataxin protein expression without increasing mRNA expression." Cerebellum. 7(3):360-365. PMID:18581197
  10. [ + ] Correia AR, et al. (2008) "Dynamics, stability and iron-binding activity of frataxin clinical mutants." FEBS J. 275(14):3680-3690. PMID:18537827
  11. [ + ] Stolle CA, et al. (2008) "Novel, complex interruptions of the GAA repeat in small, expanded alleles of two affected siblings with late-onset Friedreich ataxia." Mov Disord. 23(9):1303-1306. PMID:18464277
  12. [ + ] Huang J, et al. (2008) "Mapping iron binding sites on human frataxin: implications for cluster assembly on the ISU Fe-S cluster scaffold protein." J Biol Inorg Chem. 13(5):825-836. PMID:18425540
  13. [ + ] Li K, et al. (2008) "Iron-dependent regulation of frataxin expression: implications for treatment of Friedreich ataxia." Hum Mol Genet. 17(15):2265-2273. PMID:18424449
  14. [ + ] Zanella I, et al. (2008) "The effects of frataxin silencing in HeLa cells are rescued by the expression of human mitochondrial ferritin." Biochim Biophys Acta. 1782(2):90-98. PMID:18160053
  15. [ + ] Pollard LM, et al. (2008) "Repair of DNA double-strand breaks within the (GAA*TTC)n sequence results in frequent deletion of the triplet-repeat sequence." Nucleic Acids Res. 36(2):489-500. PMID:18045804
  16. [ + ] Al-Mahdawi S, et al. (2008) "The Friedreich ataxia GAA repeat expansion mutation induces comparable epigenetic changes in human and transgenic mouse brain and heart tissues." Hum Mol Genet. 17(5):735-746. PMID:18045775
  17. [ + ] La Pean A, et al. (2008) "Predictors of progression in patients with Friedreich ataxia." Mov Disord. 23(14):2026-2032. PMID:18759347
  18. [ + ] Lu C, et al. (2007) "Frataxin knockdown causes loss of cytoplasmic iron-sulfur cluster functions, redox alterations and induction of heme transcripts." Arch Biochem Biophys. 457(1):111-122. PMID:17098208
  19. [ + ] Condo I, et al. (2007) "In vivo maturation of human frataxin." Hum Mol Genet. 16(13):1534-1540. PMID:17468497
  20. [ + ] Gellera C, et al. (2007) "Frataxin gene point mutations in Italian Friedreich ataxia patients." Neurogenetics. 8(4):289-299. PMID:17703324
  21. [ + ] Greene E, et al. (2007) "Repeat-induced epigenetic changes in intron 1 of the frataxin gene and its consequences in Friedreich ataxia." Nucleic Acids Res. 35(10):3383-3390. PMID:17478498
  22. [ + ] Ershova MV, et al. (2007) "[The use of noben for correction of mitochondrial disorders in Friedrich's disease]" Zh Nevrol Psikhiatr Im S S Korsakova. 107(9):32-37. PMID:18379460
  23. [ + ] Shan Y, et al. (2007) "Mitochondrial frataxin interacts with ISD11 of the NFS1/ISCU complex and multiple mitochondrial chaperones." Hum Mol Genet. 16(8):929-941. PMID:17331979
  24. [ + ] Yoon T, et al. (2007) "N-terminal iron-mediated self-cleavage of human frataxin: regulation of iron binding and complex formation with target proteins." J Biol Inorg Chem. 12(4):535-542. PMID:17285345
  25. [ + ] De Biase I, et al. (2007) "Progressive GAA expansions in dorsal root ganglia of Friedreich's ataxia patients." Ann Neurol. 61(1):55-60. PMID:17262846
  26. [ + ] Lim J, et al. (2006) "A protein-protein interaction network for human inherited ataxias and disorders of Purkinje cell degeneration." Cell. 125(4):801-814. PMID:16713569
  27. [ + ] Condo I, et al. (2006) "A pool of extramitochondrial frataxin that promotes cell survival." J Biol Chem. 281(24):16750-16756. PMID:16608849
  28. [ + ] Schulz TJ, et al. (2006) "Induction of oxidative metabolism by mitochondrial frataxin inhibits cancer growth: Otto Warburg revisited." J Biol Chem. 281(2):977-981. PMID:16263703
  29. [ + ] Burnett R, et al. (2006) "DNA sequence-specific polyamides alleviate transcription inhibition associated with long GAA.TTC repeats in Friedreich's ataxia." Proc Natl Acad Sci U S A. 103(31):11497-11502. PMID:16857735
  30. [ + ] Correia AR, et al. (2006) "Conformational stability of human frataxin and effect of Friedreich's ataxia-related mutations on protein folding." Biochem J. 398(3):605-611. PMID:16787388
  31. [ + ] Napoli E, et al. (2006) "Frataxin, iron-sulfur clusters, heme, ROS, and aging." Antioxid Redox Signal. 8(3-4):506-516. PMID:16677095
  32. [ + ] Acquaviva F, et al. (2005) "Extra-mitochondrial localisation of frataxin and its association with IscU1 during enterocyte-like differentiation of the human colon adenocarcinoma cell line Caco-2." J Cell Sci. 118(Pt 17):3917-3924. PMID:16091420
  33. [ + ] Gonzalez-Cabo P, et al. (2005) "Frataxin interacts functionally with mitochondrial electron transport chain proteins." Hum Mol Genet. 14(15):2091-2098. PMID:15961414
  34. [ + ] O'Neill HA, et al. (2005) "Assembly of human frataxin is a mechanism for detoxifying redox-active iron." Biochemistry. 44(2):537-545. PMID:15641778
  35. [ + ] Holmkvist J, et al. (2005) "Haplotype construction of the FRDA gene and evaluation of its role in type II diabetes." Eur J Hum Genet. 13(7):849-855. PMID:15827563
  36. [ + ] Anderson PR, et al. (2005) "RNAi-mediated suppression of the mitochondrial iron chaperone, frataxin, in Drosophila." Hum Mol Genet. 14(22):3397-3405. PMID:16203742
  37. [ + ] O'Neill HA, et al. (2005) "Supramolecular assemblies of human frataxin are formed via subunit-subunit interactions mediated by a non-conserved amino-terminal region." J Mol Biol. 345(3):433-439. PMID:15581888
  38. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  39. [ + ] Clark RM, et al. (2004) "Expansion of GAA triplet repeats in the human genome: unique origin of the FRDA mutation at the center of an Alu." Genomics. 83(3):373-383. PMID:14962663
  40. [ + ] Yoon T, et al. (2004) "Frataxin-mediated iron delivery to ferrochelatase in the final step of heme biosynthesis." J Biol Chem. 279(25):25943-25946. PMID:15123683
  41. [ + ] Chattopadhyay B, et al. (2004) "Molecular analysis of GAA repeats and four linked bi-allelic markers in and around the frataxin gene in patients and normal populations from India." Ann Hum Genet. 68(Pt 3):189-195. PMID:15180699
  42. [ + ] Al-Mahdawi S, et al. (2004) "GAA repeat instability in Friedreich ataxia YAC transgenic mice." Genomics. 84(2):301-310. PMID:15233994
  43. [ + ] Bulteau AL, et al. (2004) "Frataxin acts as an iron chaperone protein to modulate mitochondrial aconitase activity." Science. 305(5681):242-245. PMID:15247478
  44. [ + ] Miranda CJ, et al. (2004) "Frataxin overexpressing mice." FEBS Lett. 572(1-3):281-288. PMID:15304363
  45. [ + ] Stehling O, et al. (2004) "Iron-sulfur protein maturation in human cells: evidence for a function of frataxin." Hum Mol Genet. 13(23):3007-3015. PMID:15509595
  46. [ + ] Pollard LM, et al. (2004) "Replication-mediated instability of the GAA triplet repeat mutation in Friedreich ataxia." Nucleic Acids Res. 32(19):5962-5971. PMID:15534367
  47. [ + ] Yoon T, et al. (2003) "Iron-sulfur cluster biosynthesis. Characterization of frataxin as an iron donor for assembly of [2Fe-2S] clusters in ISU-type proteins." J Am Chem Soc. 125(20):6078-6084. PMID:12785837
  48. [ + ] Nichol H, et al. (2003) "Structure of frataxin iron cores: an X-ray absorption spectroscopic study." Biochemistry. 42(20):5971-5976. PMID:12755598
  49. [ + ] Duby G, et al. (2002) "A non-essential function for yeast frataxin in iron-sulfur cluster assembly." Hum Mol Genet. 11(21):2635-2643. PMID:12354789
  50. [ + ] Chauhan C, et al. (2002) "Origin and instability of GAA repeats: insights from Alu elements." J Biomol Struct Dyn. 20(2):253-263. PMID:12354077