FOS | GeneID:2353 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2353 Official Symbol FOS
Locus N/A Gene Type protein-coding
Synonyms AP-1; C-FOS
Full Name v-fos FBJ murine osteosarcoma viral oncogene homolog
Description v-fos FBJ murine osteosarcoma viral oncogene homolog
Chromosome 14q24.3
Also Known As FBJ murine osteosarcoma viral (v-fos) oncogene homolog (oncogene FOS); activator protein 1; cellular oncogene c-fos
Summary The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. In some cases, expression of the FOS gene has also been associated with apoptotic cell death. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3844

ID Symbol Protein Species
GeneID:2353 FOS NP_005243.1 Homo sapiens
GeneID:14281 Fos NP_034364.1 Mus musculus
GeneID:280795 FOS NP_877587.1 Bos taurus
GeneID:314322 Fos NP_071533.1 Rattus norvegicus
GeneID:394198 fos NP_991132.1 Danio rerio
GeneID:453047 FOS XP_510075.2 Pan troglodytes
GeneID:490792 FOS XP_547914.1 Canis lupus familiaris

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab14285 c-Fos antibody (ab14285); Chicken polyclonal to c-Fos
2 abcam ab18333 c-Fos antibody (ab18333); Rabbit polyclonal to c-Fos
3 abcam ab5794 c-Fos antibody (ab5794); Rabbit polyclonal to c-Fos
4 abcam ab6167 c-Fos antibody (ab6167); Sheep polyclonal to c-Fos
5 abcam ab7963 c-Fos antibody (ab7963); Rabbit polyclonal to c-Fos
6 abcam ab16902 c-Fos antibody [2G9C3] (ab16902); Mouse monoclonal [2G9C3] to c-Fos
7 abcam ab18119 c-Fos antibody (ab18119); Rabbit polyclonal to c-Fos
8 abcam ab63444 c-Fos (phospho S362) antibody (ab63444); Rabbit polyclonal to c-Fos (phospho S362)
9 abcam ab62147 c-Fos antibody (ab62147); Sheep polyclonal to c-Fos
10 abcam ab55836 c-Fos (phospho S374) antibody [34E4] (ab55836); Mouse monoclonal [34E4] to c-Fos (phospho S374)
11 abcam ab53036 c-Fos antibody (ab53036); Rabbit polyclonal to c-Fos
12 abcam ab49373 c-Fos antibody [CF2] (ab49373); Mouse monoclonal [CF2] to c-Fos
13 abcam ab48942 c-Fos antibody (ab48942); Rabbit polyclonal to c-Fos
14 abcam ab27436 c-Fos antibody, prediluted (ab27436); Rabbit polyclonal to c-Fos, prediluted
15 abcam ab17933 c-Fos (phospho T232) antibody (ab17933); Rabbit polyclonal to c-Fos (phospho T232)
16 abcam ab27793 c-Fos (phospho T325) antibody (ab27793); Rabbit polyclonal to c-Fos (phospho T325)
17 abgent AP3314a Phospho-FOS-T232 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
18 abnova H00002353-M03 FOS monoclonal antibody (M03), clone 4E11; Mouse monoclonal antibody raised against a partial recombinant FOS.
19 abnova H00002353-M04 FOS monoclonal antibody (M04), clone 1H8; Mouse monoclonal antibody raised against a partial recombinant FOS.
20 abnova H00002353-M05 FOS monoclonal antibody (M05), clone 4D5; Mouse monoclonal antibody raised against a partial recombinant FOS.
21 abnova H00002353-M06 FOS monoclonal antibody (M06), clone 2C9; Mouse monoclonal antibody raised against a partial recombinant FOS.
22 abnova H00002353-M08 FOS monoclonal antibody (M08), clone 2D12; Mouse monoclonal antibody raised against a partial recombinant FOS.
23 abnova H00002353-M02 FOS monoclonal antibody (M02), clone 2F3; Mouse monoclonal antibody raised against a partial recombinant FOS.
24 acris AP15476PU-N c-fos; antibody Ab
25 acris AP15475PU-S c-fos (N-term); antibody Ab
26 acris AP17210PU-N c-fos (C-term); antibody Ab
27 acris AP15476PU-S c-fos; antibody Ab
28 acris AM00061PU-N FOS / C-FOS pSer374 (incl. pos. control); antibody Ab
29 acris AP15475PU-N c-fos (N-term); antibody Ab
30 acris BP679 FOS / C-FOS (aa 2-17); antibody Ab
31 acris AP06125PU-N FOS / C-FOS; antibody Ab
32 acris AM00062PU-N FOS / C-FOS (N-term) (incl. pos. control); antibody Ab
33 acris SP2050P FOS / C-FOS; antibody Ab
34 acris AP12766PU-N FOS pThr232; antibody Ab
35 scbt FOS FOS Antibody / FOS Antibodies;
36 sigma F137 Anti-c-Fos antibody produced in rabbit ;
37 sigma F7799 Anti-c-Fos antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of FOS Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FOS Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005634 Component nucleus
GO:0005667 Component transcription factor complex
GO:0003690 Function double-stranded DNA binding
GO:0010843 Function promoter binding
GO:0046982 Function protein heterodimerization activity
GO:0070412 Function R-SMAD binding
GO:0003704 Function specific RNA polymerase II transcription factor activity
GO:0003700 Function transcription factor activity
GO:0031668 Process cellular response to extracellular stimulus
GO:0034614 Process cellular response to reactive oxygen species
GO:0006306 Process DNA methylation
GO:0006954 Process inflammatory response
GO:0007399 Process nervous system development
GO:0045941 Process positive regulation of transcription
GO:0045944 Process positive regulation of transcription from RNA polymerase II promoter
GO:0042493 Process response to drug
GO:0060395 Process SMAD protein signal transduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_005252  UCSC Browser NP_005243 Q6FG41   P01100  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000303562 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENST00000303562 MI0000103 hsa-miR-101 UACAGUACUGUGAUAACUGAA
ENST00000303562 MI0000739 hsa-miR-101 UACAGUACUGUGAUAACUGAA
ENST00000303562 MI0000454 hsa-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENST00000303562 MI0000261 hsa-miR-139-3p GGAGACGCGGCCCUGUUGGAGU
ENST00000303562 MI0000261 hsa-miR-139-5p UCUACAGUGCACGUGUCUCCAG
ENST00000303562 MI0000478 hsa-miR-149 UCUGGCUCCGUGUCUUCACUCCC
ENST00000303562 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENST00000303562 MI0000681 hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGGU
ENST00000303562 MI0000269 hsa-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENST00000303562 MI0000289 hsa-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENST00000303562 MI0000271 hsa-miR-181c AACAUUCAACCUGUCGGUGAGU
ENST00000303562 MI0000298 hsa-miR-221 AGCUACAUUGUCUGCUGGGUUUC
ENST00000303562 MI0000299 hsa-miR-222 AGCUACAUCUGGCUACUGGGU
ENST00000303562 MI0000087 hsa-miR-29a UAGCACCAUCUGAAAUCGGUUA
ENST00000303562 MI0000105 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000303562 MI0000107 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000303562 MI0000735 hsa-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENST00000303562 MI0000814 hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG
ENST00000303562 MI0000268 hsa-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENST00000303562 MI0003185 hsa-miR-501-3p AAUGCACCCGGGCAAGGAUUCU
ENST00000303562 MI0003186 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA
ENST00000303562 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000303562 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000303562 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000303562 MI0005565 hsa-miR-543 AAACAUUCGCGGUGCACUUCUU
ENST00000303562 MI0003556 hsa-miR-551a GCGACCCACUCUUGGUUUCCA
ENST00000303562 MI0003575 hsa-miR-551b GCGACCCAUACUUGGUUUCAG
ENST00000303562 MI0003576 hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU
ENST00000303562 MI0003587 hsa-miR-580 UUGAGAAUGAUGAAUCAUUAGG
ENST00000303562 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENST00000303562 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENST00000303562 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENST00000303562 MI0003674 hsa-miR-653 GUGUUGAAACAAUCUCUACUG
ENST00000303562 MI0000263 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000303562 MI0000264 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000303562 MI0000265 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000303562 MI0005118 hsa-miR-770-5p UCCAGUACCACGUGUCAGGGCCA
ENST00000303562 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000303562 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000303562 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000303562 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000303562 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENST00000303562 MI0005473 mmu-miR-880 UACUCCAUCCUCUCUGAGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
1-(3-chlorophenyl)biguanide
  • 1-(3-chlorophenyl)biguanide results in increased expression of FOS protein
12088752
1-(3-chlorophenyl)piperazine
  • 1-(3-chlorophenyl)piperazine results in increased expression of FOS protein
11298663
1-(5-(2-thenyloxy)-1H-indol-3-yl)propan-2-amine
  • 1-(5-(2-thenyloxy)-1H-indol-3-yl)propan-2-amine does not affect the expression of FOS protein
11298663
1-Butanol
  • 1-Butanol inhibits the reaction [3-(N-phenylamino)-1,2-propanediol 1,2-dioleoyl ester analog results in increased expression of FOS mRNA]
15501433
2,2',4,6,6'-pentachlorobiphenyl
  • 2,2',4,6,6'-pentachlorobiphenyl results in increased activity of FOS protein
16611624
2,4-dinitrotoluene
  • 2,4-dinitrotoluene results in increased expression of FOS mRNA
11409192
2,4-dinitrotoluene
  • 2,4-dinitrotoluene results in increased expression of FOS protein
16705839
2,6-dinitrotoluene
  • 2,6-dinitrotoluene results in increased expression of FOS protein
16705839
2-Acetylaminofluorene
  • Drugs, Chinese Herbal inhibits the reaction [[2-Acetylaminofluorene co-treated with Diethylnitrosamine] results in increased expression of FOS protein]
  • [2-Acetylaminofluorene co-treated with Diethylnitrosamine] results in increased expression of FOS protein
17696247
3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid
  • 3-(4'-hydroxy-3'-adamantylbiphenyl-4-yl)acrylic acid results in increased expression of FOS mRNA
16788091
3-(N-phenylamino)-1,2-propanediol 1,2-dioleoyl ester
  • 1-Butanol inhibits the reaction [3-(N-phenylamino)-1,2-propanediol 1,2-dioleoyl ester analog results in increased expression of FOS mRNA]
  • 3-(N-phenylamino)-1,2-propanediol 1,2-dioleoyl ester analog results in increased expression of FOS mRNA
  • 3-(N-phenylamino)-1,2-propanediol 1,2-dioleoyl ester analog results in increased expression of FOS protein
  • Propranolol inhibits the reaction [3-(N-phenylamino)-1,2-propanediol 1,2-dioleoyl ester analog results in increased expression of FOS mRNA]
15501433
3-Pyridinecarboxylic acid, 1,4-dihydro-2,6-dimethyl-5-nitro-4-(2-(trifluoromethyl)phenyl)-, Methyl ester
  • 3-Pyridinecarboxylic acid, 1,4-dihydro-2,6-dimethyl-5-nitro-4-(2-(trifluoromethyl)phenyl)-, Methyl ester results in increased expression of FOS mRNA
16188231
4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole
  • 4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole promotes the reaction [sodium arsenite results in increased expression of FOS mRNA]
12547826
4-hydroxy-2-nonenal
  • 4-hydroxy-2-nonenal results in decreased expression of FOS protein
  • resveratrol inhibits the reaction [4-hydroxy-2-nonenal results in decreased expression of FOS protein]
16322078
4-hydroxy-2-nonenal
  • 4-hydroxy-2-nonenal results in decreased expression of FOS mRNA
12419474
4-iodo-2,5-dimethoxyphenylisopropylamine
  • 4-iodo-2,5-dimethoxyphenylisopropylamine results in increased expression of FOS protein
12482207
4-tert-octylphenol
  • 4-tert-octylphenol results in increased expression of FOS mRNA
17011747
Acetaminophen
  • Acetaminophen affects the expression of FOS mRNA
17562736
Acrylonitrile
  • Acrylonitrile results in decreased expression of FOS protein
16173056
Adenosine Triphosphate
  • Adenosine Triphosphate results in increased expression of FOS mRNA
  • Glucose affects the reaction [Adenosine Triphosphate results in increased expression of FOS mRNA]
  • Iodoacetates inhibits the reaction [Adenosine Triphosphate results in increased expression of FOS mRNA]
  • Potassium Cyanide inhibits the reaction [Adenosine Triphosphate results in increased expression of FOS mRNA]
  • Sodium Azide inhibits the reaction [Adenosine Triphosphate results in increased expression of FOS mRNA]
10723097
alpha helical corticotropin-releasing hormone
  • alpha helical corticotropin-releasing hormone results in increased expression of FOS protein
15486230
Ammonium Chloride
  • [EGF protein co-treated with Ammonium Chloride] does not affect the expression of FOS mRNA
12632255
anandamide
  • anandamide results in increased expression of FOS protein
  • capsazepine inhibits the reaction [anandamide results in increased expression of FOS protein]
  • resiniferatoxin inhibits the reaction [anandamide results in increased expression of FOS protein]
15601931
aniline
  • aniline results in increased activity of FOS protein
16169568
Anisomycin
  • Anisomycin results in increased expression of FOS mRNA
12660819
arsenic trioxide
  • arsenic trioxide affects the expression of FOS mRNA
12749819
arsenic trioxide
  • arsenic trioxide results in increased expression of FOS mRNA
14682389, 11678611
arsenic trioxide
  • Atrazine promotes the reaction [arsenic trioxide results in increased expression of FOS mRNA]
11678611
arsenic trioxide
  • arsenic trioxide results in increased expression of FOS protein
14682389
Ascorbic Acid
  • Ascorbic Acid results in increased expression of FOS mRNA
15305145
Atrazine
  • Atrazine promotes the reaction [arsenic trioxide results in increased expression of FOS mRNA]
11678611
bathocuproine sulfonate
  • bathocuproine sulfonate inhibits the reaction [pyrrolidine dithiocarbamic acid promotes the reaction [[JUN protein binds to FOS protein] which results in increased expression of and results in increased activity of CP protein]]
17032174
Benzene
  • Benzene results in increased expression of FOS
  • TP53 protein promotes the reaction [Benzene results in increased expression of FOS]
15935813
Benzene
  • Benzene results in increased expression of FOS mRNA
15050406, 12928149
benzyloxycarbonylleucyl-leucyl-leucine aldehyde
  • benzyloxycarbonylleucyl-leucyl-leucine aldehyde promotes the reaction [Hydrogen Peroxide results in increased expression of FOS protein]
15136564
bisphenol A
  • bisphenol A inhibits the reaction [Potassium results in increased expression of FOS mRNA]
15527870
bisphenol A
  • bisphenol A does not affect the expression of FOS mRNA
16029874
Cadmium
  • fulvestrant inhibits the reaction [Cadmium results in increased expression of FOS mRNA]
17125913
Cadmium
  • Cadmium results in increased expression of FOS mRNA
16624402
Cadmium
  • Cadmium results in increased expression of FOS mRNA
17125913, 11738272
Cadmium Chloride
  • Cadmium Chloride results in increased expression of FOS mRNA
  • fulvestrant inhibits the reaction [Cadmium Chloride results in increased expression of FOS mRNA]
17125913
Cadmium Chloride
  • Cadmium Chloride results in increased expression of FOS mRNA
16624402
Calcitriol
  • Calcitriol results in increased expression of FOS mRNA
16002434
Capsaicin
  • Capsaicin results in increased expression of FOS protein
  • HTR1B protein inhibits the reaction [Capsaicin results in increased expression of FOS protein]
  • HTR1D protein inhibits the reaction [Capsaicin results in increased expression of FOS protein]
  • HTR1F protein inhibits the reaction [Capsaicin results in increased expression of FOS protein]
  • LY 344864 inhibits the reaction [Capsaicin results in increased expression of FOS protein]
  • Sumatriptan inhibits the reaction [Capsaicin results in increased expression of FOS protein]
12110114
Capsaicin
  • Capsaicin inhibits the reaction [Cyclophosphamide results in increased expression of FOS protein]
10749792
Capsaicin
  • Capsaicin inhibits the reaction [Cyclophosphamide results in increased expression of FOS mRNA]
18093676
capsazepine
  • capsazepine inhibits the reaction [anandamide results in increased expression of FOS protein]
15601931
Carbamazepine
  • Carbamazepine results in decreased expression of FOS protein
7789465
Carbaryl
  • Carbaryl results in increased expression of FOS mRNA
11226373
Carbon Tetrachloride
  • Carbon Tetrachloride affects the expression of FOS mRNA
12734012
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of FOS mRNA
8847708, 17468546
Carnosine
  • Carnosine results in increased expression of FOS protein
17628717
Carrageenan
  • Carrageenan results in increased expression of FOS protein
  • Flurbiprofen inhibits the reaction [Carrageenan results in increased expression of FOS protein]
  • Flurbiprofen promotes the reaction [Urethane inhibits the reaction [Carrageenan results in increased expression of FOS protein]]
  • Urethane inhibits the reaction [Carrageenan results in increased expression of FOS protein]
  • Urethane inhibits the reaction [Flurbiprofen inhibits the reaction [Carrageenan results in increased expression of FOS protein]]
11164833
Chloral Hydrate
  • Chloral Hydrate inhibits the reaction [Cocaine results in increased expression of FOS protein]
15219685
Chloralose
  • [Nitroprusside co-treated with Urethane co-treated with Chloralose] results in increased expression of FOS protein
12088752
Chlorpyrifos
  • Chlorpyrifos results in decreased expression of FOS mRNA
  • Chlorpyrifos results in increased expression of FOS mRNA
12464398
cinnamic aldehyde
  • cinnamic aldehyde analog results in decreased expression of FOS protein
17510524
Cobalt
  • Cobalt results in increased expression of FOS mRNA
14971665
Cocaine
  • Cocaine results in increased expression of FOS mRNA
  • Estrogens does not affect the reaction [Cocaine results in increased expression of FOS mRNA]
  • Progesterone does not affect the reaction [Cocaine results in increased expression of FOS mRNA]
16962079
Cocaine
  • Chloral Hydrate inhibits the reaction [Cocaine results in increased expression of FOS protein]
  • Cocaine results in increased expression of FOS protein
  • Urethane inhibits the reaction [Cocaine results in increased expression of FOS protein]
15219685
Copper
  • Copper promotes the reaction [pyrrolidine dithiocarbamic acid promotes the reaction [[JUN protein binds to FOS protein] which results in increased expression of and results in increased activity of CP protein]]
17032174
CP 31398
  • CP 31398 results in increased expression of FOS mRNA
15155752
Curcumin
  • Curcumin results in increased expression of FOS mRNA
15713895
Cycloheximide
  • Cycloheximide inhibits the reaction [Hydrogen Peroxide results in increased expression of FOS protein]
15136564
Cycloheximide
  • Cycloheximide promotes the reaction [[EGF protein co-treated with Estradiol] results in increased expression of FOS mRNA]
12632255
Cyclophosphamide
  • resiniferatoxin inhibits the reaction [Cyclophosphamide results in increased expression of FOS protein]
15217452
Cyclophosphamide
  • Capsaicin inhibits the reaction [Cyclophosphamide results in increased expression of FOS protein]
10749792
Cyclophosphamide
  • Cyclophosphamide results in increased expression of FOS protein
15217452, 10749792
Cyclophosphamide
  • Capsaicin inhibits the reaction [Cyclophosphamide results in increased expression of FOS mRNA]
  • Cyclophosphamide results in increased expression of FOS mRNA
18093676
cypermethrin
  • cypermethrin does not affect the reaction [Hydrogen Peroxide results in increased expression of FOS protein]
15136564
cypermethrin
  • cypermethrin results in increased expression of FOS protein
8856738
cypermethrin
  • cypermethrin inhibits the reaction [Veratridine results in increased expression of FOS mRNA]
11082455
Dactinomycin
  • Dactinomycin inhibits the reaction [[EGF protein co-treated with Estradiol] results in increased expression of FOS mRNA]
12632255
daidzein
  • daidzein inhibits the reaction [Estradiol results in increased expression of FOS mRNA]
11473722
daidzein
  • daidzein results in increased expression of FOS mRNA
17142977
daidzin
  • daidzin results in increased expression of FOS mRNA
17142977
DDT
  • DDT results in increased activity of FOS protein
14604893
DDT
  • DDT inhibits the reaction [Potassium results in increased expression of FOS mRNA]
  • [Permethrin co-treated with DDT co-treated with Diethylstilbestrol] inhibits the reaction [Potassium results in increased expression of FOS mRNA]
15527870
deoxynivalenol
  • deoxynivalenol results in increased expression of FOS mRNA
15371230
Dexamethasone
  • Dexamethasone promotes the reaction [[EGF protein co-treated with Estradiol] results in increased expression of FOS mRNA]
12632255
Diethylnitrosamine
  • Drugs, Chinese Herbal inhibits the reaction [[2-Acetylaminofluorene co-treated with Diethylnitrosamine] results in increased expression of FOS protein]
  • [2-Acetylaminofluorene co-treated with Diethylnitrosamine] results in increased expression of FOS protein
17696247
Diethylstilbestrol
  • Diethylstilbestrol results in decreased expression of FOS mRNA
15171707
Diethylstilbestrol
  • Diethylstilbestrol results in increased expression of FOS mRNA
16636312, 14502647, 15289156, 15591538
Diethylstilbestrol
  • Diethylstilbestrol results in decreased expression of FOS protein
  • Diethylstilbestrol results in increased expression of FOS protein
15082075
Diethylstilbestrol
  • Diethylstilbestrol results in decreased methylation of FOS exon
14502647
Diethylstilbestrol
  • Diethylstilbestrol inhibits the reaction [Potassium results in increased expression of FOS mRNA]
  • [Permethrin co-treated with DDT co-treated with Diethylstilbestrol] inhibits the reaction [Potassium results in increased expression of FOS mRNA]
15527870
Diethylstilbestrol
  • Diethylstilbestrol results in increased expression of FOS mRNA
17011747, 17005392
Diethylstilbestrol
  • Diethylstilbestrol affects the reaction [PRLH protein affects the expression of FOS protein]
15862908
dihydroxyethyldithiocarbamate
  • Dizocilpine Maleate inhibits the reaction [[Kainic Acid co-treated with dihydroxyethyldithiocarbamate] results in increased expression of FOS protein]
  • [Kainic Acid co-treated with dihydroxyethyldithiocarbamate] results in increased expression of FOS protein
  • dihydroxyethyldithiocarbamate does not affect the expression of FOS protein
16686654
dimethylarsine
  • dimethylarsine does not affect the activity of FOS protein
  • dimethylarsine does not affect the phosphorylation of FOS protein
12475910
Dizocilpine Maleate
  • Dizocilpine Maleate inhibits the reaction [[Kainic Acid co-treated with dihydroxyethyldithiocarbamate] results in increased expression of FOS protein]
16686654
Doxorubicin
  • Doxorubicin results in increased expression of FOS mRNA
16900372
Drugs, Chinese Herbal
  • [Phenytoin co-treated with Drugs, Chinese Herbal] inhibits the reaction [Kainic Acid results in increased expression of FOS mRNA]
8758711
Drugs, Chinese Herbal
  • Drugs, Chinese Herbal inhibits the reaction [[2-Acetylaminofluorene co-treated with Diethylnitrosamine] results in increased expression of FOS protein]
17696247
Drugs, Chinese Herbal
  • Drugs, Chinese Herbal inhibits the reaction [Estrogens results in increased expression of FOS]
14758024
Drugs, Chinese Herbal
  • Drugs, Chinese Herbal inhibits the reaction [Estradiol results in increased expression of FOS mRNA]
11506814, 11285193
Drugs, Chinese Herbal
  • Drugs, Chinese Herbal inhibits the reaction [Estradiol results in increased expression of FOS protein]
11285193
Dust
  • Dust results in increased expression of FOS mRNA
15735009
Estradiol
  • daidzein inhibits the reaction [Estradiol results in increased expression of FOS mRNA]
11473722
Estradiol
  • Drugs, Chinese Herbal inhibits the reaction [Estradiol results in increased expression of FOS protein]
  • Estradiol results in increased expression of FOS protein
11285193
Estradiol
  • Drugs, Chinese Herbal inhibits the reaction [Estradiol results in increased expression of FOS mRNA]
11506814, 11285193
Estradiol
  • Cycloheximide promotes the reaction [[EGF protein co-treated with Estradiol] results in increased expression of FOS mRNA]
  • Dactinomycin inhibits the reaction [[EGF protein co-treated with Estradiol] results in increased expression of FOS mRNA]
  • Dexamethasone promotes the reaction [[EGF protein co-treated with Estradiol] results in increased expression of FOS mRNA]
  • Estradiol does not affect the expression of FOS mRNA
  • INS1 protein promotes the reaction [[EGF protein co-treated with Estradiol] results in increased expression of FOS mRNA]
  • [EGF protein co-treated with Estradiol] results in increased expression of FOS mRNA
12632255
Estradiol
  • Estradiol affects the expression of FOS mRNA
15598610
Estradiol
  • Estradiol results in increased expression of FOS protein
  • Progesterone inhibits the reaction [Estradiol results in increased expression of FOS protein]
15796768
Estradiol
  • Estradiol results in increased expression of FOS mRNA
17142977, 16029874, 15072547
Estradiol
  • Estradiol results in increased expression of FOS mRNA
15289156, 11473722, 11285193, 11506814
Estradiol
  • Toremifene inhibits the reaction [Estradiol results in increased expression of FOS mRNA]
  • Toremifene inhibits the reaction [Estradiol results in increased expression of FOS protein]
12079510
Estrogens
  • Estrogens does not affect the reaction [Cocaine results in increased expression of FOS mRNA]
16962079
Estrogens
  • Drugs, Chinese Herbal inhibits the reaction [Estrogens results in increased expression of FOS]
14758024
Ethinyl Estradiol
  • Ethinyl Estradiol results in increased expression of FOS mRNA
17555576, 16174780, 14976129
Ethinyl Estradiol
  • Ethinyl Estradiol results in increased expression of FOS mRNA
16174780
Flurbiprofen
  • Flurbiprofen inhibits the reaction [Carrageenan results in increased expression of FOS protein]
  • Flurbiprofen promotes the reaction [Urethane inhibits the reaction [Carrageenan results in increased expression of FOS protein]]
  • Urethane inhibits the reaction [Flurbiprofen inhibits the reaction [Carrageenan results in increased expression of FOS protein]]
11164833
fulvestrant
  • fulvestrant results in decreased expression of FOS mRNA
15072547
fulvestrant
  • fulvestrant inhibits the reaction [Cadmium Chloride results in increased expression of FOS mRNA]
  • fulvestrant inhibits the reaction [Cadmium results in increased expression of FOS mRNA]
17125913
Furosemide
  • Furosemide results in increased expression of FOS protein
  • Losartan inhibits the reaction [Furosemide results in increased expression of FOS protein]
15528393
Furosemide
  • Furosemide results in increased expression of FOS protein
10760498
Genistein
  • Genistein results in increased expression of FOS mRNA
15289156
Glucose
  • Glucose affects the reaction [Adenosine Triphosphate results in increased expression of FOS mRNA]
10723097
Glutathione
  • Glutathione inhibits the reaction [tert-Butylhydroperoxide results in increased expression of FOS mRNA]
15105052
Glutethimide
  • [EGF protein co-treated with Glutethimide] does not affect the expression of FOS mRNA
12632255
Hydrogen Peroxide
  • Cycloheximide inhibits the reaction [Hydrogen Peroxide results in increased expression of FOS protein]
  • Hydrogen Peroxide results in increased expression of FOS protein
  • Hydrogen Peroxide results in increased phosphorylation of FOS protein
  • Okadaic Acid promotes the reaction [Hydrogen Peroxide results in increased expression of FOS protein]
  • benzyloxycarbonylleucyl-leucyl-leucine aldehyde promotes the reaction [Hydrogen Peroxide results in increased expression of FOS protein]
  • cypermethrin does not affect the reaction [Hydrogen Peroxide results in increased expression of FOS protein]
15136564
Hydrogen Peroxide
  • Hydrogen Peroxide results in decreased expression of FOS mRNA
12419474
Hydrogen Peroxide
  • Hydrogen Peroxide promotes the reaction [JUN protein binds to FOS protein]
11728812
hydroquinone
  • hydroquinone results in decreased expression of FOS mRNA
15452088
hydroxytamoxifen
  • hydroxytamoxifen results in increased expression of FOS mRNA
15072547
Indomethacin
  • Indomethacin results in increased expression of FOS mRNA
18299717
Indomethacin
  • Indomethacin affects the reaction [Lipopolysaccharides results in increased expression of FOS protein]
12646303
Iodoacetates
  • Iodoacetates inhibits the reaction [Adenosine Triphosphate results in increased expression of FOS mRNA]
10723097
irinotecan
  • irinotecan metabolite results in increased expression of FOS mRNA
  • irinotecan results in increased expression of FOS mRNA
15956246
isorhapontigenin
  • isorhapontigenin affects the expression of FOS protein
15607907
Kainic Acid
  • Dizocilpine Maleate inhibits the reaction [[Kainic Acid co-treated with dihydroxyethyldithiocarbamate] results in increased expression of FOS protein]
  • Kainic Acid results in increased expression of FOS protein
  • [Kainic Acid co-treated with dihydroxyethyldithiocarbamate] results in increased expression of FOS protein
16686654
Kainic Acid
  • Kainic Acid results in increased expression of FOS mRNA
  • [Phenytoin co-treated with Drugs, Chinese Herbal] inhibits the reaction [Kainic Acid results in increased expression of FOS mRNA]
8758711
KN 62
  • KN 62 inhibits the reaction [LIF protein results in increased expression of FOS protein]
11073891
lead nitrate
  • lead nitrate results in increased expression of FOS mRNA
14971657
Lipopolysaccharides
  • Indomethacin affects the reaction [Lipopolysaccharides results in increased expression of FOS protein]
  • Lipopolysaccharides results in increased expression of FOS protein
12646303
Lipopolysaccharides
  • Lipopolysaccharides results in decreased expression of FOS mRNA
  • Lipopolysaccharides results in increased expression of FOS mRNA
12057914
Losartan
  • Losartan inhibits the reaction [AGT protein results in increased expression of FOS protein]
  • Losartan inhibits the reaction [Furosemide results in increased expression of FOS protein]
  • Losartan inhibits the reaction [Polyethylene Glycols results in increased expression of FOS protein]
15528393
Luteolin
  • Luteolin results in decreased activity of FOS protein
16343431
LY 344864
  • LY 344864 inhibits the reaction [Capsaicin results in increased expression of FOS protein]
12110114
lycopene
  • lycopene results in increased expression of FOS mRNA
16886892
Manganese
  • Manganese results in decreased expression of FOS protein
17043766
methylarsine oxide
  • methylarsine oxide does not affect the activity of FOS protein
  • methylarsine oxide does not affect the phosphorylation of FOS protein
12475910
methylformamide
  • methylformamide analog results in increased expression of FOS mRNA
  • methylformamide results in increased expression of FOS mRNA
17040096
Methylnitrosourea
  • [tetramethylpyrazine affects the expression of FOS mRNA] which results in chemical resistance to Methylnitrosourea
16268501
Methylnitrosourea
  • Methylnitrosourea results in increased expression of FOS protein
  • Niacinamide inhibits the reaction [Methylnitrosourea results in increased expression of FOS protein]
16168987
Methylnitrosourea
  • Methylnitrosourea results in increased expression of FOS mRNA
17412507
Monensin
  • [EGF protein co-treated with Monensin] does not affect the expression of FOS mRNA
12632255
mono-(2-ethylhexyl)phthalate
  • mono-(2-ethylhexyl)phthalate results in increased expression of FOS mRNA
16809437
Morphine
  • Morphine results in increased expression of FOS mRNA
15183518
myricetin
  • myricetin inhibits the reaction [EGF protein results in increased expression of FOS mRNA]
  • myricetin inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of FOS mRNA]
17693661
Nandrolone
  • [testosterone 17 beta-cypionate co-treated with Nandrolone co-treated with testosterone undecanoate] results in increased expression of FOS protein
17113655
naphthalene
  • naphthalene results in increased expression of FOS protein
14595851
Niacinamide
  • Niacinamide inhibits the reaction [Methylnitrosourea results in increased expression of FOS protein]
16168987
Nickel
  • Nickel results in increased expression of FOS mRNA
14971665
nickel sulfate
  • nickel sulfate results in increased expression of FOS mRNA
16780908
Nifedipine
  • Nifedipine inhibits the reaction [FGF2 protein results in increased expression of FOS mRNA]
16188231
Nitroglycerin
  • Nitroglycerin results in increased expression of FOS protein
16897600
Nitroglycerin
  • Nitroglycerin does not affect the expression of FOS protein
11298663
Nitroprusside
  • Nitroprusside affects the expression of FOS protein
  • [Nitroprusside co-treated with Urethane] affects the expression of FOS protein
11588591
Nitroprusside
  • Nitroprusside results in increased expression of FOS protein
  • [Nitroprusside co-treated with Urethane co-treated with Chloralose] results in increased expression of FOS protein
12088752
Norepinephrine
  • [EGF protein co-treated with Norepinephrine] does not affect the expression of FOS mRNA
12632255
Okadaic Acid
  • Okadaic Acid promotes the reaction [Hydrogen Peroxide results in increased expression of FOS protein]
15136564
Oxytocin
  • Oxytocin results in increased expression of FOS protein
11442774
p38alpha inhibitor CMPD1
  • p38alpha inhibitor CMPD1 promotes the reaction [sodium arsenite results in increased expression of FOS mRNA]
12547826
Paraquat
  • Paraquat promotes the reaction [JUN protein binds to FOS protein]
11728812
PD 169316
  • PD 169316 promotes the reaction [sodium arsenite results in increased expression of FOS mRNA]
12547826
PD 169316
  • PD 169316 does not affect the expression of FOS mRNA
14685156
perfluorooctane sulfonic acid
  • perfluorooctane sulfonic acid results in increased expression of FOS mRNA
17390077
Permethrin
  • Permethrin inhibits the reaction [Potassium results in increased expression of FOS mRNA]
  • [Permethrin co-treated with DDT co-treated with Diethylstilbestrol] inhibits the reaction [Potassium results in increased expression of FOS mRNA]
15527870
Permethrin
  • Permethrin results in increased expression of FOS protein
8856738
Permethrin
  • Permethrin inhibits the reaction [Veratridine results in increased expression of FOS mRNA]
  • Permethrin results in decreased expression of FOS protein
11082455
Permethrin
  • Permethrin results in decreased expression of FOS mRNA
12111003
Phenytoin
  • [Phenytoin co-treated with Drugs, Chinese Herbal] inhibits the reaction [Kainic Acid results in increased expression of FOS mRNA]
8758711
Phenytoin
  • Phenytoin results in decreased expression of FOS protein
7789465
piperine
  • piperine results in decreased localization of FOS protein
15531295
Polyethylene Glycols
  • Losartan inhibits the reaction [Polyethylene Glycols results in increased expression of FOS protein]
  • Polyethylene Glycols results in increased expression of FOS protein
15528393
Potassium
  • DDT inhibits the reaction [Potassium results in increased expression of FOS mRNA]
  • Diethylstilbestrol inhibits the reaction [Potassium results in increased expression of FOS mRNA]
  • Permethrin inhibits the reaction [Potassium results in increased expression of FOS mRNA]
  • Pyrethrins inhibits the reaction [Potassium results in increased expression of FOS mRNA]
  • [Permethrin co-treated with DDT co-treated with Diethylstilbestrol] inhibits the reaction [Potassium results in increased expression of FOS mRNA]
  • bisphenol A inhibits the reaction [Potassium results in increased expression of FOS mRNA]
15527870
Potassium Cyanide
  • Potassium Cyanide inhibits the reaction [Adenosine Triphosphate results in increased expression of FOS mRNA]
  • Potassium Cyanide results in increased expression of FOS mRNA
10723097
Progesterone
  • Progesterone promotes the reaction [EGF protein affects the localization of FOS protein]
  • Progesterone promotes the reaction [EGF protein results in increased expression of FOS mRNA]
  • Progesterone promotes the reaction [EGF protein results in increased expression of FOS protein]
16175315
Progesterone
  • Progesterone inhibits the reaction [Estradiol results in increased expression of FOS protein]
15796768
Progesterone
  • Progesterone does not affect the reaction [Cocaine results in increased expression of FOS mRNA]
16962079
Progesterone
  • Progesterone results in decreased expression of FOS mRNA
16376865
Propranolol
  • Propranolol inhibits the reaction [3-(N-phenylamino)-1,2-propanediol 1,2-dioleoyl ester analog results in increased expression of FOS mRNA]
15501433
puerarin
  • puerarin results in increased expression of FOS mRNA
17142977
Pyrethrins
  • Pyrethrins inhibits the reaction [Potassium results in increased expression of FOS mRNA]
15527870
pyrrolidine dithiocarbamic acid
  • Copper promotes the reaction [pyrrolidine dithiocarbamic acid promotes the reaction [[JUN protein binds to FOS protein] which results in increased expression of and results in increased activity of CP protein]]
  • bathocuproine sulfonate inhibits the reaction [pyrrolidine dithiocarbamic acid promotes the reaction [[JUN protein binds to FOS protein] which results in increased expression of and results in increased activity of CP protein]]
  • pyrrolidine dithiocarbamic acid results in increased expression of FOS protein
17032174
Pyruvic Acid
  • [EGF protein co-treated with Pyruvic Acid] does not affect the expression of FOS mRNA
12632255
Quinolinic Acid
  • Quinolinic Acid results in increased expression of FOS mRNA
15698628
resiniferatoxin
  • resiniferatoxin inhibits the reaction [Cyclophosphamide results in increased expression of FOS protein]
15217452
resiniferatoxin
  • resiniferatoxin inhibits the reaction [anandamide results in increased expression of FOS protein]
15601931
resveratrol
  • resveratrol inhibits the reaction [4-hydroxy-2-nonenal results in decreased expression of FOS protein]
16322078
resveratrol
  • EGF protein inhibits the reaction [resveratrol results in increased expression of FOS mRNA]
15542774
resveratrol
  • resveratrol results in increased expression of FOS mRNA
17174366, 15542774
resveratrol
  • resveratrol inhibits the reaction [JUN protein binds to FOS protein]
16761963
resveratrol
  • Thyroxine inhibits the reaction [resveratrol results in increased expression of FOS mRNA]
17174366
resveratrol
  • resveratrol results in increased expression of and results in increased activity of FOS protein
16928824
SB 203580
  • SB 203580 promotes the reaction [sodium arsenite results in increased expression of FOS mRNA]
12547826
sodium arsenate
  • sodium arsenate results in increased expression of FOS mRNA
11353140
sodium arsenite
  • sodium arsenite results in increased expression of FOS mRNA
12210719
sodium arsenite
  • sodium arsenite results in decreased expression of FOS mRNA
12377979
sodium arsenite
  • sodium arsenite does not affect the activity of FOS protein
  • sodium arsenite does not affect the phosphorylation of FOS protein
12475910
sodium arsenite
  • 4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)imidazole promotes the reaction [sodium arsenite results in increased expression of FOS mRNA]
  • PD 169316 promotes the reaction [sodium arsenite results in increased expression of FOS mRNA]
  • SB 203580 promotes the reaction [sodium arsenite results in increased expression of FOS mRNA]
  • U 0126 inhibits the reaction [sodium arsenite results in increased expression of FOS mRNA]
  • p38alpha inhibitor CMPD1 promotes the reaction [sodium arsenite results in increased expression of FOS mRNA]
12547826
sodium arsenite
  • sodium arsenite results in increased expression of FOS mRNA
11353140
sodium arsenite
  • sodium arsenite results in increased expression of FOS mRNA
17409708, 12547826
sodium arsenite
  • sodium arsenite affects the activity of FOS protein
14523996
Sodium Azide
  • Sodium Azide inhibits the reaction [Adenosine Triphosphate results in increased expression of FOS mRNA]
10723097
Styrene
  • Styrene results in increased expression of FOS protein
15212811
SU 5402
  • SU 5402 inhibits the reaction [FGF2 protein results in increased expression of FOS mRNA]
16188231
Sumatriptan
  • Sumatriptan inhibits the reaction [Capsaicin results in increased expression of FOS protein]
12110114
Tamoxifen
  • Tamoxifen results in increased expression of FOS mRNA
17555576
tanshinone
  • tanshinone results in increased expression of FOS protein
16009009
tert-Butylhydroperoxide
  • CAT protein inhibits the reaction [tert-Butylhydroperoxide results in increased expression of FOS mRNA]
  • Glutathione inhibits the reaction [tert-Butylhydroperoxide results in increased expression of FOS mRNA]
  • Thiourea inhibits the reaction [tert-Butylhydroperoxide results in increased expression of FOS mRNA]
  • tert-Butylhydroperoxide results in increased expression of FOS mRNA
15105052
tert-Butylhydroperoxide
  • tert-Butylhydroperoxide results in decreased expression of FOS mRNA
12419474
testosterone 17 beta-cypionate
  • [testosterone 17 beta-cypionate co-treated with Nandrolone co-treated with testosterone undecanoate] results in increased expression of FOS protein
17113655
testosterone undecanoate
  • [testosterone 17 beta-cypionate co-treated with Nandrolone co-treated with testosterone undecanoate] results in increased expression of FOS protein
17113655
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin affects the expression of FOS protein
16985168
Tetrachloroethylene
  • Tetrachloroethylene results in decreased expression of FOS protein
16010555
Tetradecanoylphorbol Acetate
  • Tetradecanoylphorbol Acetate results in increased activity of [JUN protein binds to FOS protein]
16116958
Tetradecanoylphorbol Acetate
  • Tetradecanoylphorbol Acetate results in increased expression of FOS mRNA
  • myricetin inhibits the reaction [Tetradecanoylphorbol Acetate results in increased expression of FOS mRNA]
17693661
tetramethylpyrazine
  • [tetramethylpyrazine affects the expression of FOS mRNA] which results in chemical resistance to Methylnitrosourea
16268501
Thimerosal
  • Thimerosal results in increased expression of FOS mRNA
16870260
Thiourea
  • Thiourea inhibits the reaction [tert-Butylhydroperoxide results in increased expression of FOS mRNA]
15105052
Thyroxine
  • Thyroxine inhibits the reaction [resveratrol results in increased expression of FOS mRNA]
17174366
Toremifene
  • Toremifene inhibits the reaction [Estradiol results in increased expression of FOS mRNA]
  • Toremifene inhibits the reaction [Estradiol results in increased expression of FOS protein]
12079510
Tretinoin
  • Tretinoin results in increased expression of FOS mRNA
17045167
Triiodothyronine
  • Triiodothyronine results in increased expression of FOS mRNA
17403546
Trinitrotoluene
  • Trinitrotoluene results in increased expression of FOS mRNA
11409192
Tungsten Compounds
  • Tungsten Compounds results in increased expression of FOS mRNA
14971665
U 0126
  • U 0126 inhibits the reaction [sodium arsenite results in increased expression of FOS mRNA]
12547826
Uranium
  • Uranium results in increased expression of FOS mRNA
14971665
Urethane
  • IFNG protein inhibits the reaction [Urethane results in decreased expression of FOS mRNA]
  • Urethane results in decreased expression of FOS mRNA
12810352
Urethane
  • [Nitroprusside co-treated with Urethane] affects the expression of FOS protein
11588591
Urethane
  • Urethane inhibits the reaction [Cocaine results in increased expression of FOS protein]
15219685
Urethane
  • Urethane results in increased expression of FOS protein
11442774
Urethane
  • Flurbiprofen promotes the reaction [Urethane inhibits the reaction [Carrageenan results in increased expression of FOS protein]]
  • Urethane inhibits the reaction [Carrageenan results in increased expression of FOS protein]
  • Urethane inhibits the reaction [Flurbiprofen inhibits the reaction [Carrageenan results in increased expression of FOS protein]]
11164833
Urethane
  • [Nitroprusside co-treated with Urethane co-treated with Chloralose] results in increased expression of FOS protein
12088752
Urethane
  • Urethane results in increased expression of FOS mRNA
16289808
Veratridine
  • Permethrin inhibits the reaction [Veratridine results in increased expression of FOS mRNA]
  • Veratridine results in increased expression of FOS mRNA
  • cypermethrin inhibits the reaction [Veratridine results in increased expression of FOS mRNA]
11082455
Zinc
  • Zinc results in increased expression of FOS protein
16472982
Zinc
  • Zinc results in increased phosphorylation of FOS protein
16373669

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Breast Neoplasms marker 16298037
Lung Neoplasms marker 16289808
Acrodermatitis inferred via Zinc 17190629, 16889938, 17202136
Alzheimer Disease inferred via Zinc 17119284, 16325427, 16410023, 16580781
Anemia, Sickle Cell inferred via Zinc 16916123
Asthma inferred via Zinc 17085522
Brain Injuries inferred via Zinc 17109824
Carcinoma, Squamous Cell inferred via Zinc 16543248
Cardiovascular Diseases inferred via Zinc 16936243
Diabetes Mellitus inferred via Zinc 16479319
Esophageal Neoplasms inferred via Zinc 16543248
Gastritis inferred via Zinc 17241300
Growth Disorders inferred via Zinc 17217573
Heart Failure inferred via Zinc 17162251
Heart Injuries inferred via Zinc 17074742
Helicobacter Infections inferred via Zinc 17241300
Hepatolenticular Degeneration inferred via Zinc 17276780
Ischemia inferred via Zinc 16584753
Kidney Diseases inferred via Zinc 16960431
Kidney Failure, Chronic inferred via Zinc 16518626
Mammary Neoplasms, Experimental inferred via Zinc 12773700
Pre-Eclampsia inferred via Zinc 17114810
Prostatic Neoplasms inferred via Zinc 12429649, 16517595, 16606632, 16700911
Retinal Degeneration inferred via Zinc 16584753
Tongue Neoplasms inferred via Zinc 16543248
Adenocarcinoma inferred via Urethane 18316556
Adenocarcinoma, Bronchiolo-Alveolar inferred via Urethane 15814487
Adenoma inferred via Urethane 17093202, 10822126, 17195641, 11497255, 16926031
Cleft Palate inferred via Urethane 12810352
Heart Diseases inferred via Urethane 16046796
Liver Neoplasms inferred via Urethane 17093202, 16391232, 17559639
Lung Neoplasms inferred via Urethane 16204055, 16391232, 10779650, 15166089, 15136453, 11544531, 11323394, 16289808, 11074608, 11893704, 16337739, 11497255, 12466968, 12117781, 11307925, 16788158, 16926031, 12957351, 11246140, 17195641, 10822126, 12765245, 14587096, 17255336, 11552296, 10997738, 11992545, 11062179, 16007126, 11807781, 15902970, 17093202
Neoplasms inferred via Urethane 15625555
Neoplasms, Experimental inferred via Urethane 15582191
Ovarian Neoplasms inferred via Urethane 16391232
Pituitary Neoplasms inferred via Urethane 16391232
Skin Neoplasms inferred via Urethane 11807781
Vascular Neoplasms inferred via Urethane 10620525
Acrocephalosyndactylia inferred via U 0126 17694057
Leukemia, Monocytic, Acute inferred via U 0126 16972261
Ovarian Neoplasms inferred via U 0126 16211241
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16443354, 16166294
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 12679006, 16823087, 15748426, 16788101, 16766008, 17506722, 16140955, 16331271, 17294898, 17361223, 17368321, 17301526, 17339181, 17217047, 17107899, 16935935
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Female Urogenital Diseases inferred via Toremifene 16709447
Spermatocele inferred via Toremifene 16709447
Lung Neoplasms inferred via Tetradecanoylphorbol Acetate 11807781
Mammary Neoplasms, Experimental inferred via Tetradecanoylphorbol Acetate 8985016
Pancreatic Neoplasms inferred via Tetradecanoylphorbol Acetate 15976015
Skin Neoplasms inferred via Tetradecanoylphorbol Acetate 8985016, 11807781
Breast Neoplasms inferred via Tetrachloroethylene 15986119
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Breast Neoplasms inferred via Tamoxifen 16202921, 15565566, 16818667, 16873071, 17261762, 17440819, 15668708, 17893378, 17049068, 11161223, 17242785
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 16827153, 14580682
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Migraine Disorders inferred via Sumatriptan 15689192
Breast Neoplasms inferred via Styrene 15986119
Hearing Loss inferred via Styrene 17420221
Adrenal Gland Neoplasms inferred via sodium arsenite 15276417
Adrenocortical Adenoma inferred via sodium arsenite 16712894
Carcinoma, Hepatocellular inferred via sodium arsenite 15276417, 16507464
Carcinoma, Squamous Cell inferred via sodium arsenite 18572023
Genital Neoplasms, Female inferred via sodium arsenite 16452187
Hodgkin Disease inferred via sodium arsenite 12676792
Liver Neoplasms inferred via sodium arsenite 15276417, 16712894
Lung Neoplasms inferred via sodium arsenite 15276417, 16712894, 17077188
Melanoma inferred via sodium arsenite 16487513
Neoplasms inferred via sodium arsenite 11559025
Neural Tube Defects inferred via sodium arsenite 12854658
Ovarian Neoplasms inferred via sodium arsenite 15276417
Prostatic Neoplasms inferred via sodium arsenite 16039940
Skin Neoplasms inferred via sodium arsenite 18572023
Spinal Dysraphism inferred via sodium arsenite 12854658
Urinary Bladder Neoplasms inferred via sodium arsenite 11723127, 16712894, 16452187
Uterine Cervical Neoplasms inferred via sodium arsenite 11813266
Vascular Diseases inferred via sodium arsenite 17056641
Neural Tube Defects inferred via sodium arsenate 11749123
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 17534123, 16393696
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 17164350, 17049120, 16267019, 16490592, 17935668
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 16525036, 17125593, 16317513, 16456233, 17015251
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 15767336, 16731767, 17636462, 17718901, 17804756
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 16317513, 15827377, 16314181, 17520802
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Encephalitis, Herpes Simplex inferred via Quinolinic Acid 17174341
Prostatic Neoplasms inferred via pyrrolidine dithiocarbamic acid 16139439
Brain Ischemia inferred via puerarin 16041641
Liver Cirrhosis inferred via puerarin 16426832
Hepatomegaly inferred via Propranolol 16371745
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15380490, 15845082
Breast Neoplasms inferred via Progesterone 17614352, 16175315, 15562024
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Abnormalities, Drug-Induced inferred via Phenytoin 3425630, 10563481
Atherosclerosis inferred via Phenytoin 15136057
Cleft Palate inferred via Phenytoin 2227380, 3877104, 10789828, 1687470, 6856622, 6862529
Congenital Abnormalities inferred via Phenytoin 10627286
Drug Eruptions inferred via Phenytoin 15024534
Epidermolysis Bullosa inferred via Phenytoin 6251365, 1399206
Epilepsies, Partial inferred via Phenytoin 17116037
Epilepsy inferred via Phenytoin 11434505
Fetal Death inferred via Phenytoin 10627286
Gingival Hyperplasia inferred via Phenytoin 9029455
Gingival Overgrowth inferred via Phenytoin 16390469, 14659971
Hyperhomocysteinemia inferred via Phenytoin 10459572
Liver Diseases inferred via Phenytoin 14986274
Myoclonic Epilepsies, Progressive inferred via Phenytoin 17484760
Myotonia Congenita inferred via Phenytoin 1896199
Osteomalacia inferred via Phenytoin 17016548
Pseudolymphoma inferred via Phenytoin 1419762, 8603615, 12752131
Dermatitis, Contact inferred via Permethrin 14617103
Insect Bites and Stings inferred via Permethrin 15189238, 12749493, 12971516
Leukemia inferred via Permethrin 12937054
Glioblastoma inferred via perfluorooctane sulfonic acid 17162496
Agricultural Workers' Diseases inferred via Paraquat 11874814
Gliosis inferred via Paraquat 11124998
Nerve Degeneration inferred via Paraquat 16893418
Parkinson Disease inferred via Paraquat 12911755, 15824117, 16140633, 11124998, 15451049, 16510128, 11445065, 11181820
Pneumonia inferred via Paraquat 12504350
Pulmonary Fibrosis inferred via Paraquat 16324872, 17997886
Respiratory Distress Syndrome, Adult inferred via Paraquat 11700416
Respiratory Sounds inferred via Paraquat 11874814
Retinal Degeneration inferred via Paraquat 16458197
Glioblastoma inferred via Okadaic Acid 17312396
Methemoglobinemia inferred via Nitroglycerin 3537620
Myocardial Infarction inferred via Nitroglycerin 14729435
Dermatitis, Allergic Contact inferred via nickel sulfate 16780908
Breast Neoplasms inferred via Nickel 15986119
Dermatitis, Allergic Contact inferred via Nickel 17244072, 17100760
HIV Infections inferred via Nickel 17263646
Pemphigoid, Bullous inferred via Niacinamide 11026799
Adenocarcinoma inferred via Methylnitrosourea 15688392, 15113128
Breast Neoplasms inferred via Methylnitrosourea 16253758
Cataract inferred via Methylnitrosourea 12484553
Fibrosarcoma inferred via Methylnitrosourea 11555667
Glioma inferred via Methylnitrosourea 9825942
Limb Deformities, Congenital inferred via Methylnitrosourea 15526292
Lower Extremity Deformities, Congenital inferred via Methylnitrosourea 16080182
Lung Neoplasms inferred via Methylnitrosourea 18062963
Lymphoma inferred via Methylnitrosourea 11418001, 16257854
Lymphoma, B-Cell inferred via Methylnitrosourea 14633661
Mammary Neoplasms, Experimental inferred via Methylnitrosourea 16619500, 17020996, 17131329, 11807958, 14999141, 16827153, 11751437, 10767621, 10838139, 16944150, 16051031, 15113128, 15688392, 12931682, 15313902
Neoplasms inferred via Methylnitrosourea 15533788
Neoplasms, Experimental inferred via Methylnitrosourea 12696579
Neurilemmoma inferred via Methylnitrosourea 11555667
Pancreatic Neoplasms inferred via Methylnitrosourea 16965848
Prostatic Neoplasms inferred via Methylnitrosourea 15682402, 12376480
Retinal Degeneration inferred via Methylnitrosourea 18155124, 18172121
Retinoblastoma inferred via Methylnitrosourea 11555667
Stomach Neoplasms inferred via Methylnitrosourea 18593901, 15930296, 16257854
Thymus Neoplasms inferred via Methylnitrosourea 11418001
Anemia, Sideroblastic inferred via Manganese 16910769
Glioblastoma inferred via Manganese 17043766
Manganese Poisoning inferred via Manganese 16551646, 16568477
Movement Disorders inferred via Manganese 16551646
Nerve Degeneration inferred via Manganese 16551646
Parkinson Disease inferred via Manganese 11181820
Parkinsonian Disorders inferred via Manganese 16140633
Neoplasms inferred via lycopene 17051425
Prostatic Neoplasms inferred via lycopene 17337101, 15084515
Atherosclerosis inferred via Losartan 10821809
Heart Failure inferred via Losartan 10979640
Liver Cirrhosis, Experimental inferred via Losartan 17900296, 15573910, 12445418
Myocardial Infarction inferred via Losartan 12692751
Hemolytic-Uremic Syndrome inferred via Lipopolysaccharides 16366002
Inflammation inferred via Lipopolysaccharides 17255318, 17963957
Iron Metabolism Disorders inferred via Lipopolysaccharides 17255318
Respiratory Hypersensitivity inferred via Lipopolysaccharides 10835634
Seizures inferred via Kainic Acid 16336964, 10686065
Cardiomegaly inferred via isorhapontigenin 15607907
Colonic Neoplasms inferred via irinotecan 17725105
Colorectal Neoplasms inferred via irinotecan 16303861, 18259882, 17454858, 15273666
Neoplasm Metastasis inferred via irinotecan 18259882
Stomach Neoplasms inferred via irinotecan 15723263
Adenoma inferred via Indomethacin 11497255
Alzheimer Disease inferred via Indomethacin 15579461
Breast Neoplasms inferred via Indomethacin 17401462
Carcinoma, Hepatocellular inferred via Indomethacin 16391822
Colonic Neoplasms inferred via Indomethacin 11260862, 15963497, 15786552
Colorectal Neoplasms inferred via Indomethacin 18059344, 12606626, 17054584
Duodenal Ulcer inferred via Indomethacin 17045617, 16699067, 17202747
Edema inferred via Indomethacin 8985016
Enteritis inferred via Indomethacin 16328016
Esophageal Neoplasms inferred via Indomethacin 11005569
Glioblastoma inferred via Indomethacin 12870263
Hyperlipidemias inferred via Indomethacin 17546600
Ileal Diseases inferred via Indomethacin 10574470
Intestinal Diseases inferred via Indomethacin 15610444, 15831440, 17329856, 10210152
Jejunal Diseases inferred via Indomethacin 10574470
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via Indomethacin 10785260
Leukemia, Myeloid, Acute inferred via Indomethacin 18360721
Lung Neoplasms inferred via Indomethacin 11497255
Pain inferred via Indomethacin 17440234
Stomach Diseases inferred via Indomethacin 17207306
Stomach Ulcer inferred via Indomethacin 16934674, 18299717, 12467913, 12077510, 17654042, 15104355, 10878458
Ulcer inferred via Indomethacin 10574470
Cardiovascular Diseases inferred via Hydrogen Peroxide 16936243
Kidney Failure, Chronic inferred via Hydrogen Peroxide 16518626
Carcinoma, Squamous Cell inferred via Glutathione 17015178
Breast Neoplasms inferred via Genistein 17200150, 16541309, 16873071
Carcinoma, Hepatocellular inferred via Genistein 16924424
Cardiovascular Diseases inferred via Genistein 16332659
Colonic Neoplasms inferred via Genistein 17182828
Diabetes Mellitus, Type 2 inferred via Genistein 16647724
Endometrial Hyperplasia inferred via Genistein 16402032
Glioblastoma inferred via Genistein 16598420
Liver Cirrhosis, Experimental inferred via Genistein 17823541
Mammary Neoplasms, Experimental inferred via Genistein 14578162, 12929590
Myocardial Infarction inferred via Genistein 17141266
Myocardial Reperfusion Injury inferred via Genistein 17141266
Osteoporosis, Postmenopausal inferred via Genistein 16169203
Prostatic Neoplasms inferred via Genistein 16925846, 15256057, 15378649
Dyspnea inferred via Furosemide 16935035
Edema inferred via Furosemide 11834646
Heart Failure inferred via Furosemide 16011733, 12660669, 16845234
Hypercalcemia inferred via Furosemide 17652376
Hypercalciuria inferred via Furosemide 17652376
Hyperparathyroidism, Secondary inferred via Furosemide 15086907
Hypertension, Pregnancy-Induced inferred via Furosemide 16612254
Hypoproteinemia inferred via Furosemide 16096441
Nephrocalcinosis inferred via Furosemide 15086907
Nocturnal Enuresis inferred via Furosemide 17945291
Polyuria inferred via Furosemide 17945291
Reperfusion Injury inferred via Furosemide 16526316
Respiratory Distress Syndrome, Adult inferred via Furosemide 12394941, 16096441, 15912074
Stomach Neoplasms inferred via Furosemide 17052386
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 11677210, 15861022, 16919318, 17681005, 17333356, 16105132
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Critical Illness inferred via Estrogens 16670151
Wounds and Injuries inferred via Estrogens 11172683
Breast Neoplasms inferred via Estradiol 17289903, 18497071, 17018787, 17261762, 12948864, 14630087
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 16891317, 11807958, 11408345
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Hepatitis, Toxic inferred via Drugs, Chinese Herbal 15027814
Leukemia, Lymphocytic, Chronic, B-Cell inferred via Drugs, Chinese Herbal 15802533
Liver Cirrhosis inferred via Drugs, Chinese Herbal 17163593
Liver Cirrhosis, Experimental inferred via Drugs, Chinese Herbal 15754396, 17036385, 18567088, 17348192, 15339415, 17666798, 15744066, 17881167, 15864749, 15763062, 18371158, 18237412, 15383259, 15641146, 16610055, 15818738, 12632512, 15849816
Liver Diseases inferred via Drugs, Chinese Herbal 17207593
Mammary Neoplasms, Experimental inferred via Drugs, Chinese Herbal 14758024
Osteoporosis, Postmenopausal inferred via Drugs, Chinese Herbal 16548355
Pulmonary Fibrosis inferred via Drugs, Chinese Herbal 16987627
Rhinitis, Allergic, Perennial inferred via Drugs, Chinese Herbal 15015336
Wounds and Injuries inferred via Drugs, Chinese Herbal 16313111
Adenocarcinoma inferred via Doxorubicin 17418594
Bone Marrow Neoplasms inferred via Doxorubicin 14601052
Brain Neoplasms inferred via Doxorubicin 17150277
Breast Neoplasms inferred via Doxorubicin 15692762, 16826403, 18382427, 17369602, 16264153, 15136595, 11325840, 16322301, 16096432, 15993339, 15634643, 15567936, 15994142, 15668708, 18234424, 16935488, 18628466, 17983394, 17426702, 15939500
Carcinoid Tumor inferred via Doxorubicin 16051944
Carcinoma, Hepatocellular inferred via Doxorubicin 18059187, 16234567, 17876044, 16023760
Carcinoma, Renal Cell inferred via Doxorubicin 16201981
Cardiomyopathies inferred via Doxorubicin 16952015, 17007740, 17382496, 16731534, 18627295, 15505089, 16278810, 15476868, 16269455, 16109756, 16242529, 16364871, 16651473, 17351982, 17131338, 16455267, 17329180, 17974986, 17308081, 15811867
Cardiomyopathy, Dilated inferred via Doxorubicin 17334414, 16243910
Colorectal Neoplasms inferred via Doxorubicin 18259882
Drug Toxicity inferred via Doxorubicin 18602426
Endometrial Neoplasms inferred via Doxorubicin 17359293
Endomyocardial Fibrosis inferred via Doxorubicin 18037988
Glioblastoma inferred via Doxorubicin 17150277
Head and Neck Neoplasms inferred via Doxorubicin 15692506
Heart Diseases inferred via Doxorubicin 16707910, 16330681, 16244371, 16244372, 16144979, 16879835
Hemangiosarcoma inferred via Doxorubicin 15692506
Hepatitis, Toxic inferred via Doxorubicin 17416283
Hodgkin Disease inferred via Doxorubicin 17606976, 15147373, 18501091
Kidney Diseases inferred via Doxorubicin 16775033, 15369732
Kidney Failure inferred via Doxorubicin 17922066
Kidney Failure, Chronic inferred via Doxorubicin 16707910
Leukemia, Erythroblastic, Acute inferred via Doxorubicin 16085563
Liver Cirrhosis, Experimental inferred via Doxorubicin 16595196, 16439617
Liver Neoplasms, Experimental inferred via Doxorubicin 17085340, 16842330
Lung Neoplasms inferred via Doxorubicin 17418594
Lymphoma inferred via Doxorubicin 16098063
Lymphoma, Non-Hodgkin inferred via Doxorubicin 17654614
Lymphoma, T-Cell inferred via Doxorubicin 15621674
Mammary Neoplasms, Experimental inferred via Doxorubicin 15458769
Melanoma inferred via Doxorubicin 16827129
Mucositis inferred via Doxorubicin 17415656
Neoplasm Metastasis inferred via Doxorubicin 18259882
Nephrotic Syndrome inferred via Doxorubicin 15640375, 16889571
Neuroblastoma inferred via Doxorubicin 15555623
Osteosarcoma inferred via Doxorubicin 15930896
Phyllodes Tumor inferred via Doxorubicin 17983394
Prostatic Neoplasms inferred via Doxorubicin 15897917, 16888761, 15749863, 18437689, 16868541, 16729912
Sarcoma inferred via Doxorubicin 18313854, 16767912, 15675481, 15625365, 17203757, 17710206
Sarcoma, Ewing's inferred via Doxorubicin 14601052, 16326096
Sarcoma, Kaposi inferred via Doxorubicin 17846226
Skin Neoplasms inferred via Doxorubicin 15692506
Soft Tissue Neoplasms inferred via Doxorubicin 16767912, 17203757, 15625365
Thyroid Neoplasms inferred via Doxorubicin 17909728, 16010429
Urinary Bladder Neoplasms inferred via Doxorubicin 17653716
Ventricular Dysfunction, Left inferred via Doxorubicin 17334414, 16364871
Seizures inferred via Dizocilpine Maleate 11218047, 17157343, 12660363
Amyloidosis inferred via Diethylstilbestrol 15469931
Breast Neoplasms inferred via Diethylstilbestrol 15324884, 17129689
Carcinoma, Hepatocellular inferred via Diethylstilbestrol 16924424, 15948411
Cryptorchidism inferred via Diethylstilbestrol 12952375, 16002989
Endometrial Hyperplasia inferred via Diethylstilbestrol 16402032
Endometrial Neoplasms inferred via Diethylstilbestrol 15700306, 16804899
Female Urogenital Diseases inferred via Diethylstilbestrol 16513791, 16611131, 15751030, 16534752, 16002989
Genital Neoplasms, Female inferred via Diethylstilbestrol 16452187
Hyperplasia inferred via Diethylstilbestrol 12960047, 14722030
Hypospadias inferred via Diethylstilbestrol 16002989
Infertility inferred via Diethylstilbestrol 15036965
Kidney Neoplasms inferred via Diethylstilbestrol 15003126, 16762066, 14681315
Liver Neoplasms inferred via Diethylstilbestrol 16712894, 15890375
Lupus Nephritis inferred via Diethylstilbestrol 15166399
Lymphoma inferred via Diethylstilbestrol 15700306
Male Urogenital Diseases inferred via Diethylstilbestrol 16002989
Neoplasms inferred via Diethylstilbestrol 15313581
Pituitary Diseases inferred via Diethylstilbestrol 14722030
Pituitary Neoplasms inferred via Diethylstilbestrol 15687265, 16977796
Prostatic Neoplasms inferred via Diethylstilbestrol 15846301, 17136230, 15046698
Spermatocele inferred via Diethylstilbestrol 16709447, 16002989
Urinary Bladder Neoplasms inferred via Diethylstilbestrol 16712894, 16452187
Uterine Cervical Neoplasms inferred via Diethylstilbestrol 16175088
Uterine Diseases inferred via Diethylstilbestrol 14652134
Uterine Neoplasms inferred via Diethylstilbestrol 15809267, 16690809
Vaginal Neoplasms inferred via Diethylstilbestrol 16513791, 16002989
Adenoma inferred via Diethylnitrosamine 10737359
Carcinoma, Hepatocellular inferred via Diethylnitrosamine 16878318, 10672840, 10737359, 11831363, 17428255
Liver Neoplasms inferred via Diethylnitrosamine 2422723, 15885732, 16942905, 12112319, 10737359, 18648771
Liver Neoplasms, Experimental inferred via Diethylnitrosamine 16267830, 16842330, 3124819
Colonic Neoplasms inferred via Dexamethasone 15824018
Liver Cirrhosis, Experimental inferred via Dexamethasone 16718785
Lung Neoplasms inferred via Dexamethasone 15824018, 11195469
Multiple Myeloma inferred via Dexamethasone 15867202, 16118317, 15744524
Respiratory Distress Syndrome, Adult inferred via Dexamethasone 11700416
Adenoma, Liver Cell inferred via DDT 12597452
Agricultural Workers' Diseases inferred via DDT 12584743, 16487989
Breast Neoplasms inferred via DDT 16792888, 12709520
Carcinoma, Hepatocellular inferred via DDT 12597452
Dyspnea inferred via DDT 16487989
Hepatitis inferred via DDT 16487989
Hepatomegaly inferred via DDT 2387028
Infertility, Male inferred via DDT 17192596, 17157474
Liver Diseases inferred via DDT 15729006
Liver Neoplasms inferred via DDT 15975961, 11948501
Neoplasms inferred via DDT 8820588
Prostatic Neoplasms inferred via DDT 12584743
Urologic Diseases inferred via DDT 16487989
Cardiovascular Diseases inferred via daidzein 16332659
Diabetes Mellitus, Type 2 inferred via daidzein 16647724
Hypertension inferred via daidzein 17169123
Bone Marrow Neoplasms inferred via Dactinomycin 14601052
Sarcoma, Ewing's inferred via Dactinomycin 14601052
Agricultural Workers' Diseases inferred via cypermethrin 16487989
Dyspnea inferred via cypermethrin 16487989
Hepatitis inferred via cypermethrin 16487989
Insect Bites and Stings inferred via cypermethrin 15189238
Liver Diseases inferred via cypermethrin 15991261
Urologic Diseases inferred via cypermethrin 16487989
Arteriosclerosis inferred via Cyclophosphamide 15014928
Breast Neoplasms inferred via Cyclophosphamide 17388661, 11325840, 16978400, 15136595, 15093573, 12006526, 18323546, 18234424
Carcinoma, Lewis Lung inferred via Cyclophosphamide 16152834
Carcinoma, Renal Cell inferred via Cyclophosphamide 16201981
Cystitis inferred via Cyclophosphamide 11948286, 17010015, 10700343, 16413132, 17979934, 18483878, 16651033, 16989017, 12388444, 10498854, 15643279, 12913760, 18710439, 15276878, 18433785, 18295254, 16614059
Diabetes Mellitus, Experimental inferred via Cyclophosphamide 11751995, 10990075, 15331540
Diabetes Mellitus, Type 1 inferred via Cyclophosphamide 18772604
Eosinophilia inferred via Cyclophosphamide 11006010
Gliosarcoma inferred via Cyclophosphamide 11389073
GLOBOZOOSPERMIA inferred via Cyclophosphamide 16517039
Graft vs Host Disease inferred via Cyclophosphamide 11014644, 15172196, 16376943
Hemophilia A inferred via Cyclophosphamide 11918545
Hepatic Veno-Occlusive Disease inferred via Cyclophosphamide 14986274
Hodgkin Disease inferred via Cyclophosphamide 17606976, 16135485
Infertility, Male inferred via Cyclophosphamide 16517039
Leukemia inferred via Cyclophosphamide 10602166
Leukemia, Lymphocytic, Chronic, B-Cell inferred via Cyclophosphamide 18587576, 17658394, 17802794, 18172266, 17296974, 17008537
Leukopenia inferred via Cyclophosphamide 10052129, 11830472
Lymphoma inferred via Cyclophosphamide 12854902
Lymphoma, B-Cell inferred via Cyclophosphamide 16675587
Lymphoma, Non-Hodgkin inferred via Cyclophosphamide 11911406
Melanoma, Experimental inferred via Cyclophosphamide 16388313
Neuroblastoma inferred via Cyclophosphamide 16115947, 15176712
Oligospermia inferred via Cyclophosphamide 16517039
Pancreatic Neoplasms inferred via Cyclophosphamide 11332152
Prostatic Neoplasms inferred via Cyclophosphamide 17136230
Pulmonary Fibrosis inferred via Cyclophosphamide 16636934
Scleroderma, Systemic inferred via Cyclophosphamide 16636934
Urinary Bladder Neoplasms inferred via Cyclophosphamide 14692829
Breast Neoplasms inferred via Curcumin 16243823
Inflammation inferred via Curcumin 16956363, 17151092
Leukemia-Lymphoma, Adult T-Cell inferred via Curcumin 16106398
Leukemia, T-Cell inferred via Curcumin 16106398
Liver Cirrhosis, Experimental inferred via Curcumin 18006644
Liver Diseases inferred via Curcumin 16956363
Lung Neoplasms inferred via Curcumin 16243823
Lymphoma, T-Cell inferred via Curcumin 16173963
Memory Disorders inferred via Curcumin 17263510
Muscular Atrophy, Spinal inferred via Curcumin 17962980
Respiratory Distress Syndrome, Adult inferred via Curcumin 10666014
Alzheimer Disease inferred via Copper 17119284, 16325427, 16410023, 16866297, 16886094, 16962711
Amyotrophic Lateral Sclerosis inferred via Copper 10694572
Anemia, Iron-Deficiency inferred via Copper 16614410
Brain Neoplasms inferred via Copper 17079463
Breast Neoplasms inferred via Copper 15986119, 17079463
Cardiomegaly inferred via Copper 17327471
Hepatitis, Chronic inferred via Copper 17338147
Hepatolenticular Degeneration inferred via Copper 17109627, 16607473, 17276780, 17182432
Kidney Failure, Chronic inferred via Copper 16518626
Learning Disorders inferred via Copper 17134702
Menkes Kinky Hair Syndrome inferred via Copper 17109627, 17268249
Neovascularization, Pathologic inferred via Copper 17308104
Prostatic Neoplasms inferred via Copper 17079463, 17308104
Schizophrenia inferred via Copper 16842975
Breast Neoplasms inferred via Cobalt 15986119
Hypertension inferred via Cobalt 17039479
Colonic Neoplasms inferred via cinnamic aldehyde 16343908, 17510524
Dermatitis, Allergic Contact inferred via cinnamic aldehyde 11042091
Agricultural Workers' Diseases inferred via Chlorpyrifos 11874814, 16611668, 17119214
Liver Diseases inferred via Chlorpyrifos 15991261
Respiratory Sounds inferred via Chlorpyrifos 11874814, 16611668, 17119214
Respiratory Tract Diseases inferred via Chlorpyrifos 17119214, 16611668
Edema inferred via Carrageenan 17259670, 8985016, 12083418, 15860553
Inflammation inferred via Carrageenan 8985016
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 15673190, 16050911, 16011737, 15700767, 16124888, 16227642, 10355542, 16097048
Fatty Liver inferred via Carbon Tetrachloride 16045604, 16239168, 12795759, 61145, 12631006, 17595544, 15959796
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15027814, 15968718, 16227642, 15998439, 16177239, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 16239168, 17334410
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 15925388, 17525996, 16116963, 16248980, 17805973, 17976157, 18395095, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17766677, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 18376398, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 18418968, 12666154, 16638106, 18156304, 17557913
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15830285, 17285989, 16964402, 15720792
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Epilepsies, Partial inferred via Carbamazepine 17116037
Hyperhomocysteinemia inferred via Carbamazepine 10459572
Osteomalacia inferred via Carbamazepine 17016548
Pseudolymphoma inferred via Carbamazepine 9591791, 12752131
Inflammation inferred via Capsaicin 16956363
Liver Diseases inferred via Capsaicin 16956363
Breast Neoplasms inferred via Calcitriol 11237771
Carcinoma, Squamous Cell inferred via Calcitriol 11237771
Encephalomyelitis, Autoimmune, Experimental inferred via Calcitriol 15138306
Prostatic Hyperplasia inferred via Calcitriol 15572423
Prostatic Neoplasms inferred via Calcitriol 12479363, 16289102, 16644109
Kidney Diseases inferred via Cadmium Chloride 16962696
Cell Transformation, Neoplastic inferred via Cadmium 17332340
Kidney Diseases inferred via Cadmium 16962696, 16322080
Prostatic Neoplasms inferred via Cadmium 17075824
Breast Neoplasms inferred via bisphenol A 17123778
Carcinoma in Situ inferred via bisphenol A 17123778
Insulin Resistance inferred via bisphenol A 16393666
Prostatic Neoplasms inferred via bisphenol A 16740699
Substance-Related Disorders inferred via bisphenol A 16684133, 16045194
Uterine Diseases inferred via bisphenol A 14652134
Anemia, Aplastic inferred via Benzene 14761424, 17661222, 11369114
Bone Marrow Diseases inferred via Benzene 16183116
Breast Neoplasms inferred via Benzene 11921183, 17162533
Dermatitis inferred via Benzene 15902427
Hematologic Diseases inferred via Benzene 16183116
Hypertension inferred via Benzene 17940673
Leukemia inferred via Benzene 15935818, 18335105, 17119257, 14694614
Leukemia, Myeloid inferred via Benzene 17506065
Lung Diseases, Interstitial inferred via Benzene 14698565
Lymphoma inferred via Benzene 17119257, 17584886
Multiple Myeloma inferred via Benzene 17119195
Occupational Diseases inferred via Benzene 17479406, 15727169, 15935809, 15612468, 15913788, 15576619, 16737584, 17178637, 17119257
Thymus Neoplasms inferred via Benzene 10850423
Agricultural Workers' Diseases inferred via Atrazine 11874814
Infertility, Male inferred via Atrazine 12948887
Mesothelioma inferred via Atrazine 1916698
Parkinson Disease inferred via Atrazine 17218051
Respiratory Sounds inferred via Atrazine 11874814
Breast Neoplasms inferred via Ascorbic Acid 16443354
Common Cold inferred via Ascorbic Acid 17323712
Diabetes Mellitus, Type 2 inferred via Ascorbic Acid 16506275
Heart Defects, Congenital inferred via Ascorbic Acid 16080930
Hernia, Diaphragmatic inferred via Ascorbic Acid 16863852, 16490937
Lung Diseases inferred via Ascorbic Acid 16863852
Lung Neoplasms inferred via Ascorbic Acid 16401635
Obesity inferred via Ascorbic Acid 17217161
Pulmonary Eosinophilia inferred via Ascorbic Acid 14606601
Retinitis Pigmentosa inferred via Ascorbic Acid 16849425
Stroke inferred via Ascorbic Acid 16517955
Adenocarcinoma inferred via arsenic trioxide 11798837
Blood Coagulation Disorders inferred via arsenic trioxide 16206674
Burkitt Lymphoma inferred via arsenic trioxide 11589617
Carcinoma, Hepatocellular inferred via arsenic trioxide 16217749, 14691202, 15553829, 11135700, 15073043
Carcinoma, Small Cell inferred via arsenic trioxide 12490120
Coronary Restenosis inferred via arsenic trioxide 12609071
Death, Sudden, Cardiac inferred via arsenic trioxide 15213294
Esophageal Neoplasms inferred via arsenic trioxide 12903497
Fatty Liver inferred via arsenic trioxide 15073043
Gallbladder Neoplasms inferred via arsenic trioxide 16904648
Leukemia inferred via arsenic trioxide 15070760
Leukemia-Lymphoma, Adult T-Cell inferred via arsenic trioxide 12560223, 17077332
Leukemia, Monocytic, Acute inferred via arsenic trioxide 16972261
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via arsenic trioxide 14633726
Leukemia, Myeloid, Acute inferred via arsenic trioxide 16467208, 17050201, 16968895
Leukemia, Promyelocytic, Acute inferred via arsenic trioxide 16891316, 16330433, 16823087, 15622746, 17217047, 17107899, 15748426, 15336539, 15213294, 12679006, 11468182, 11161223, 12712474, 16966277, 16331271
Leukemia, T-Cell inferred via arsenic trioxide 16882451
Liver Neoplasms inferred via arsenic trioxide 14682389
Long QT Syndrome inferred via arsenic trioxide 15213294
Lung Neoplasms inferred via arsenic trioxide 11798837
Multiple Myeloma inferred via arsenic trioxide 15949261, 14977855, 11468182
Myelodysplastic Syndromes inferred via arsenic trioxide 16105982, 16882451
Neoplasm Invasiveness inferred via arsenic trioxide 16624393
Ovarian Neoplasms inferred via arsenic trioxide 16624393, 12452020
Pancreatic Neoplasms inferred via arsenic trioxide 15580305
Sarcoma, Ewing's inferred via arsenic trioxide 16646077
Stomach Neoplasms inferred via arsenic trioxide 17007042
Torsades de Pointes inferred via arsenic trioxide 15213294
Urinary Bladder Neoplasms inferred via arsenic trioxide 12973940, 11780464, 12845720
Splenic Diseases inferred via aniline 15694462
Lung Neoplasms inferred via Acrylonitrile 17372256
Hepatitis, Toxic inferred via Acetaminophen 2444490, 14986274, 16227642, 15968718, 16177239, 17562736, 16081117, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Amyotrophic Lateral Sclerosis inferred via 4-hydroxy-2-nonenal 10965797
Photosensitivity Disorders inferred via 4-hydroxy-2-nonenal 11550810
Adenoma inferred via 2-Acetylaminofluorene 10737359
Carcinoma, Hepatocellular inferred via 2-Acetylaminofluorene 10737359
Liver Neoplasms inferred via 2-Acetylaminofluorene 10737359, 18001218, 14678523, 11376686, 10672840, 16273603
Lung Neoplasms inferred via 2-Acetylaminofluorene 11376686
Urinary Bladder Neoplasms inferred via 2-Acetylaminofluorene 15867355, 15289314
Carcinoma, Hepatocellular inferred via 2,6-dinitrotoluene 16705839
Kidney Neoplasms inferred via 2,6-dinitrotoluene 16705839
Carcinoma, Hepatocellular inferred via 2,4-dinitrotoluene 16705839
Kidney Neoplasms inferred via 2,4-dinitrotoluene 16705839

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ATF2 ATF2 / FOS Invitro Hoeffler JP (1991)
BATF BATF / FOS Invitro Dorsey MJ (1995)
BATF BATF / FOS Two-hybrid Dorsey MJ (1995)
BCL3 FOS / BCL3 Reconstituted Complex Na SY (1999)
BCL3 BCL3 / FOS Two-hybrid Na SY (1999)
COBRA1 COBRA1 / FOS Affinity Capture-Western Zhong H (2004)
COBRA1 COBRA1 / FOS Reconstituted Complex Zhong H (2004)
CREBBP CREBBP / FOS Reconstituted Complex Fan S (2002)
CSNK2A1 FOS / CSNK2A1 Far Western Yamaguchi Y (1998)
CSNK2A1 FOS / CSNK2A1 Reconstituted Complex Yamaguchi Y (1998)
CSNK2A2 FOS / CSNK2A2 Far Western Yamaguchi Y (1998)
CSNK2A2 FOS / CSNK2A2 Reconstituted Complex Yamaguchi Y (1998)
DDIT3 DDIT3 / FOS Affinity Capture-Western Ubeda M (1999)
DDIT3 DDIT3 / FOS Reconstituted Complex Ubeda M (1999)
ETS2 ETS2 / FOS Reconstituted Complex Basuyaux JP (1997)
GTF2E2 FOS / GTF2E2 Reconstituted Complex Martin ML (1996)
GTF2F1 FOS / GTF2F1 Reconstituted Complex Martin ML (1996)
GTF2F2 FOS / GTF2F2 Reconstituted Complex Martin ML (1996)
JUN JUN / FOS Co-crystal Structure Glover JN (1995)
JUN FOS / JUN Reconstituted Complex Ito T (2001)
JUN JUN / FOS Reconstituted Complex Nomura N (1993)
JUN JUN / FOS Reconstituted Complex Pognonec P (1997)
JUN FOS / JUN Reconstituted Complex Venugopal R (1998)
JUN FOS / JUN Two-hybrid Finkel T (1993)
JUN JUN / FOS Two-hybrid Finkel T (1993)
JUN FOS / JUN Two-hybrid Pognonec P (1997)
JUN JUN / FOS Two-hybrid Yang X (1999)
MITF MITF / FOS Affinity Capture-Western Sato M (1999)
NACA NACA / FOS Reconstituted Complex Moreau A (1998)
NCOA1 FOS / NCOA1 Reconstituted Complex Lee SK (1998)
NCOA1 NCOA1 / FOS Reconstituted Complex Lee SK (2000)
NCOA1 FOS / NCOA1 Two-hybrid Lee SK (1998)
NCOA6 NCOA6 / FOS Reconstituted Complex Lee SK (2000)
NCOR2 FOS / NCOR2 Reconstituted Complex Lee SK (2000)
NCOR2 FOS / NCOR2 Two-hybrid Lee SK (2000)
NCOR2 NCOR2 / FOS Two-hybrid Lee SK (2000)
PML PML / FOS Reconstituted Complex Vallian S (1998)
RELA RELA / FOS Phenotypic Enhancement Yang X (1999)
RELA RELA / FOS Two-hybrid Yang X (1999)
RPS6KA4 RPS6KA4 / FOS Biochemical Activity Pierrat B (1998)
RUNX1 RUNX1 / FOS Affinity Capture-Western Hess J (2001)
RUNX1 FOS / RUNX1 Invivo D'Alonzo RC (2002)
RUNX1 RUNX1 / FOS Reconstituted Complex Hess J (2001)
RUNX2 RUNX2 / FOS Affinity Capture-Western Hess J (2001)
RUNX2 FOS / RUNX2 Invivo D'Alonzo RC (2002)
RUNX2 RUNX2 / FOS Reconstituted Complex Hess J (2001)
SMAD3 SMAD3 / FOS Reconstituted Complex Zhang Y (1998)
SMAD3 SMAD3 / FOS Two-hybrid Zhang Y (1998)
SPI1 SPI1 / FOS Reconstituted Complex Carrere S (1998)
TAF1 TAF1 / FOS Reconstituted Complex Metz R (1994)
TBP TBP / FOS Affinity Capture-Western Metz R (1994)
TBP TBP / FOS Reconstituted Complex Metz R (1994)
TCF1 TCF1 / FOS Affinity Capture-Western Leu JI (2001)
TSC22D3 TSC22D3 / FOS Reconstituted Complex Mittelstadt PR (2001)
VDR VDR / FOS Reconstituted Complex Towers TL (1999)
XBP1 XBP1 / FOS Reconstituted Complex Ono SJ (1991)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Raimundo N, et al. (2009) "Downregulation of SRF-FOS-JUNB pathway in fumarate hydratase deficiency and in uterine leiomyomas." Oncogene. 28(9):1261-1273. PMID:19151755
  2. [ + ] Chambellan A, et al. (2009) "Pivotal role of c-Fos in nitric oxide synthase 2 expression in airway epithelial cells." Nitric Oxide. 20(3):143-149. PMID:19135542
  3. [ + ] Siezen CL, et al. (2009) "Genetic susceptibility to respiratory syncytial virus bronchiolitis in preterm children is associated with airway remodeling genes and innate immune genes." Pediatr Infect Dis J. 28(4):333-335. PMID:19258923
  4. [ + ] Ono K, et al. (2009) "Behavioral characteristics and c-Fos expression in the medullary dorsal horn in a rat model for orofacial cancer pain." Eur J Pain. 13(4):373-379. PMID:18599327
  5. [ + ] Dube C, et al. (2009) "The nuclear receptors SF1 and LRH1 are expressed in endometrial cancer cells and regulate steroidogenic gene transcription by cooperating with AP-1 factors." Cancer Lett. 275(1):127-138. PMID:19022561
  6. [ + ] Uray IP, et al. (2009) "Rexinoid-induced expression of IGFBP-6 requires RARbeta-dependent permissive cooperation of retinoid receptors and AP-1." J Biol Chem. 284(1):345-353. PMID:18957410
  7. [ + ] Kumar D, et al. (2009) "Transcriptional synergy mediated by SAF-1 and AP-1: critical role of N-terminal polyalanine and two zinc finger domains of SAF-1." J Biol Chem. 284(3):1853-1862. PMID:19028685
  8. [ + ] Chavanas S, et al. (2008) "Long-range enhancer associated with chromatin looping allows AP-1 regulation of the peptidylarginine deiminase 3 gene in differentiated keratinocyte." PLoS One. 3(10):e3408. PMID:18923650
  9. [ + ] Manea A, et al. (2008) "AP-1-dependent transcriptional regulation of NADPH oxidase in human aortic smooth muscle cells: role of p22phox subunit." Arterioscler Thromb Vasc Biol. 28(5):878-885. PMID:18309110
  10. [ + ] Gonzalez JM, et al. (2008) "Fast regulation of AP-1 activity through interaction of lamin A/C, ERK1/2, and c-Fos at the nuclear envelope." J Cell Biol. 183(4):653-666. PMID:19015316
  11. [ + ] Ye FC, et al. (2008) "Kaposi's sarcoma-associated herpesvirus latent gene vFLIP inhibits viral lytic replication through NF-kappaB-mediated suppression of the AP-1 pathway: a novel mechanism of virus control of latency." J Virol. 82(9):4235-4249. PMID:18305042
  12. [ + ] Seldeen KL, et al. (2008) "Coupling of folding and DNA-binding in the bZIP domains of Jun-Fos heterodimeric transcription factor." Arch Biochem Biophys. 473(1):48-60. PMID:18316037
  13. [ + ] Wu S, et al. (2008) "IL-8 production and AP-1 transactivation induced by UVA in human keratinocytes: roles of D-alpha-tocopherol." Mol Immunol. 45(8):2288-2296. PMID:18206243
  14. [ + ] Hosgood HD 3rd, et al. (2008) "Pathway-based evaluation of 380 candidate genes and lung cancer susceptibility suggests the importance of the cell cycle pathway." Carcinogenesis. 29(10):1938-1943. PMID:18676680
  15. [ + ] Seldeen KL, et al. (2008) "Thermodynamic analysis of the heterodimerization of leucine zippers of Jun and Fos transcription factors." Biochem Biophys Res Commun. 375(4):634-638. PMID:18725194
  16. [ + ] Mahner S, et al. (2008) "C-Fos expression is a molecular predictor of progression and survival in epithelial ovarian carcinoma." Br J Cancer. 99(8):1269-1275. PMID:18854825
  17. [ + ] Ho HH, et al. (2008) "Lipopolysaccharide-induced expression of matrix metalloproteinases in human monocytes is suppressed by IFN-gamma via superinduction of ATF-3 and suppression of AP-1." J Immunol. 181(7):5089-5097. PMID:18802113
  18. [ + ] Bittencourt D, et al. (2008) "Cotranscriptional splicing potentiates the mRNA production from a subset of estradiol-stimulated genes." Mol Cell Biol. 28(18):5811-5824. PMID:18644870
  19. [ + ] Wang Y, et al. (2008) "Activator protein-1 and smad proteins synergistically regulate human follicle-stimulating hormone beta-promoter activity." Endocrinology. 149(11):5577-5591. PMID:18653705
  20. [ + ] Cadoret JC, et al. (2008) "Genome-wide studies highlight indirect links between human replication origins and gene regulation." Proc Natl Acad Sci U S A. 105(41):15837-15842. PMID:18838675
  21. [ + ] Chan CP, et al. (2008) "Thrombin activates Ras-CREB/ATF-1 signaling and stimulates c-fos, c-jun, and c-myc expression in human gingival fibroblasts." J Periodontol. 79(7):1248-1254. PMID:18597608
  22. [ + ] Jiang J, et al. (2008) "Ganoderic acids suppress growth and invasive behavior of breast cancer cells by modulating AP-1 and NF-kappaB signaling." Int J Mol Med. 21(5):577-584. PMID:18425349
  23. [ + ] Wang X, et al. (2008) "Regulation of Tcrb recombination ordering by c-Fos-dependent RAG deposition." Nat Immunol. 9(7):794-801. PMID:18500346
  24. [ + ] Shimizu Y, et al. (2008) "Growth inhibition of non-small cell lung cancer cells by AP-1 blockade using a cJun dominant-negative mutant." Br J Cancer. 98(5):915-922. PMID:18283312
  25. [ + ] Pan H, et al. (2008) "Increased expression of c-fos protein associated with increased matrix metalloproteinase-9 protein expression in the endometrium of endometriotic patients." Fertil Steril. 90(4):1000-1007. PMID:17888430
  26. [ + ] Jia G, et al. (2008) "Involvement of connexin 43 in angiotensin II-induced migration and proliferation of saphenous vein smooth muscle cells via the MAPK-AP-1 signaling pathway." J Mol Cell Cardiol. 44(5):882-890. PMID:18405916
  27. [ + ] Mendoza-Gamboa E, et al. (2008) "Bovine dialyzable leukocyte extract modulates AP-1 DNA-binding activity and nuclear transcription factor expression in MCF-7 breast cancer cells." Cytotherapy. 10(2):212-219. PMID:18368600
  28. [ + ] Abdel-Malak NA, et al. (2008) "Angiopoietin-1 promotes endothelial cell proliferation and migration through AP-1-dependent autocrine production of interleukin-8." Blood. 111(8):4145-4154. PMID:18252863
  29. [ + ] Vaysberg M, et al. (2008) "Tumor-derived variants of Epstein-Barr virus latent membrane protein 1 induce sustained Erk activation and c-Fos." J Biol Chem. 283(52):36573-36585. PMID:18986987
  30. [ + ] Gutierrez-Venegas G, et al. (2008) "Characterization of the transduction pathway involved in c-fos and c-jun expression induced by Aggregatibacter actinomycetemcomitans lipopolysaccharides in human gingival fibroblasts." Int Immunopharmacol. 8(11):1513-1523. PMID:18621151
  31. [ + ] Guller M, et al. (2008) "c-Fos overexpression increases the proliferation of human hepatocytes by stabilizing nuclear Cyclin D1." World J Gastroenterol. 14(41):6339-6346. PMID:19009649
  32. [ + ] Teng J, et al. (2008) "The G protein-coupled receptor GPR30 inhibits human urothelial cell proliferation." Endocrinology. 149(8):4024-4034. PMID:18467434
  33. [ + ] Eferl R, et al. (2008) "Development of pulmonary fibrosis through a pathway involving the transcription factor Fra-2/AP-1." Proc Natl Acad Sci U S A. 105(30):10525-10530. PMID:18641127
  34. [ + ] Yu CT, et al. (2008) "Identification of c-Fos as a mitotic phosphoprotein: regulation of c-Fos by Aurora-A." J Biomed Sci. 15(1):79-87. PMID:17926144
  35. [ + ] Malnou CE, et al. (2007) "Heterodimerization with Jun family members regulates c-Fos nucleocytoplasmic traffic." J Biol Chem. 282(42):31046-31059. PMID:17681951
  36. [ + ] Janssen R, et al. (2007) "Genetic susceptibility to respiratory syncytial virus bronchiolitis is predominantly associated with innate immune genes." J Infect Dis. 196(6):826-834. PMID:17703412
  37. [ + ] Ginsberg M, et al. (2007) "Amino acid residues required for physical and cooperative transcriptional interaction of STAT3 and AP-1 proteins c-Jun and c-Fos." Mol Cell Biol. 27(18):6300-6308. PMID:17636030
  38. [ + ] Lee JY, et al. (2007) "Effects of transcription factor activator protein-1 on interleukin-8 expression and enteritis in response to Clostridium difficile toxin A." J Mol Med. 85(12):1393-1404. PMID:17639289
  39. [ + ] Koul D, et al. (2007) "PTEN down regulates AP-1 and targets c-fos in human glioma cells via PI3-kinase/Akt pathway." Mol Cell Biochem. 300(1-2):77-87. PMID:17235455
  40. [ + ] Jin SP, et al. (2007) "Prognostic significance of loss of c-fos protein in gastric carcinoma." Pathol Oncol Res. 13(4):284-289. PMID:18158562
  41. [ + ] Neub A, et al. (2007) "Biphasic regulation of AP-1 subunits during human epidermal wound healing." J Invest Dermatol. 127(10):2453-2462. PMID:17495958
  42. [ + ] Soria-Gomez E, et al. (2007) "Pharmacological enhancement of the endocannabinoid system in the nucleus accumbens shell stimulates food intake and increases c-Fos expression in the hypothalamus." Br J Pharmacol. 151(7):1109-1116. PMID:17549045
  43. [ + ] Yao K, et al. (2007) "Reactive oxygen species mediates the apoptosis induced by transforming growth factor beta(2) in human lens epithelial cells." Biochem Biophys Res Commun. 354(1):278-283. PMID:17217916
  44. [ + ] Vasilescu J, et al. (2007) "The proteomic reactor facilitates the analysis of affinity-purified proteins by mass spectrometry: application for identifying ubiquitinated proteins in human cells." J Proteome Res. 6(1):298-305. PMID:17203973
  45. [ + ] Wilkerson DC, et al. (2007) "HSF2 binds to the Hsp90, Hsp27, and c-Fos promoters constitutively and modulates their expression." Cell Stress Chaperones. 12(3):283-290. PMID:17915561
  46. [ + ] Plaza-Menacho I, et al. (2007) "Ras/ERK1/2-mediated STAT3 Ser727 phosphorylation by familial medullary thyroid carcinoma-associated RET mutants induces full activation of STAT3 and is required for c-fos promoter activation, cell mitogenicity, and transformation." J Biol Chem. 282(9):6415-6424. PMID:17209045
  47. [ + ] Guo YP, et al. (2007) "Corticothalamic synchronization leads to c-fos expression in the auditory thalamus." Proc Natl Acad Sci U S A. 104(28):11802-11807. PMID:17606925
  48. [ + ] Portal MM, et al. (2007) "N-Terminal c-Fos tyrosine phosphorylation regulates c-Fos/ER association and c-Fos-dependent phospholipid synthesis activation." Oncogene. 26(24):3551-3558. PMID:17160021