ACAP2 | GeneID:23527 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 23527 Official Symbol ACAP2
Locus N/A Gene Type protein-coding
Synonyms CENTB2; CNT-B2; KIAA0041
Full Name ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Description ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Chromosome 3q29
Also Known As Arf GAP with coiled coil, ANK repeat and PH domains 2; centaurin, beta 2
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 8182

ID Symbol Protein Species
GeneID:23527 ACAP2 NP_036419.2 Homo sapiens
GeneID:42735 cenB1A NP_524458.1 Drosophila melanogaster
GeneID:78618 Acap2 NP_084414.1 Mus musculus
GeneID:174848 cnt-1 NP_001022412.1 Caenorhabditis elegans
GeneID:424895 ACAP2 NP_001006548.1 Gallus gallus
GeneID:460948 ACAP2 XP_516962.2 Pan troglodytes
GeneID:488039 ACAP2 XP_545162.2 Canis lupus familiaris
GeneID:506187 ACAP2 XP_582601.3 Bos taurus
GeneID:564814 LOC564814 XP_693236.3 Danio rerio
GeneID:619382 Centb2 NP_001029178.1 Rattus norvegicus
GeneID:831171 SFC NP_196834.3 Arabidopsis thaliana
GeneID:1271660 AgaP_AGAP000563 XP_310516.2 Anopheles gambiae
GeneID:4346168 Os08g0537600 NP_001062366.1 Oryza sativa
GeneID:4347541 Os09g0510700 NP_001063635.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab57140 Centaurin beta 2 antibody (ab57140); Mouse monoclonal to Centaurin beta 2
2 abcam ab26070 Centaurin beta 2 antibody (ab26070); Goat polyclonal to Centaurin beta 2
3 acris AP08558PU-N ACAP2 / CENTB2 (C-term); antibody Ab
4 acris AP16172PU-N ACAP2 / CENTB2 (C-term); antibody Ab
5 acris SP7407P ACAP2 / CENTB2; antibody Ab
6 scbt CENTB2 CENTB2 Antibody / CENTB2 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACAP2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACAP2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0008060 Function ARF GTPase activator activity
GO:0046872 Function metal ion binding
GO:0008270 Function zinc ion binding
GO:0032312 Process regulation of ARF GTPase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_012287  UCSC Browser NP_036419 A8K2V4   Q15057  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000326793 MI0003558 hsa-miR-553 AAAACGGUGAGAUUUUGUUUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ACAP2 mRNA
17562736

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17562736, 14986274, 17522070, 16081117, 16177239, 15968718, 16227642
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Cuthbert EJ, et al. (2008) "Substrate specificities and activities of AZAP family Arf GAPs in vivo." Am J Physiol Cell Physiol. 294(1):C263-C270. PMID:18003747
  2. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  3. [ + ] Rush J, et al. (2005) "Immunoaffinity profiling of tyrosine phosphorylation in cancer cells." Nat Biotechnol. 23(1):94-101. PMID:15592455
  4. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Jackson TR, et al. (2000) "ACAPs are arf6 GTPase-activating proteins that function in the cell periphery." J Cell Biol. 151(3):627-638. PMID:11062263
  7. [ + ] Dowler S, et al. (2000) "Identification of pleckstrin-homology-domain-containing proteins with novel phosphoinositide-binding specificities." Biochem J. 351(Pt 1):19-31. PMID:11001876
  8. [ + ] Jackson TR, et al. (2000) "Cytohesins and centaurins: mediators of PI 3-kinase-regulated Arf signaling." Trends Biochem Sci. 25(10):489-495. PMID:11050434
  9. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  10. [ + ] Nomura N, et al. (1994) "Prediction of the coding sequences of unidentified human genes. II. The coding sequences of 40 new genes (KIAA0041-KIAA0080) deduced by analysis of cDNA clones from human cell line KG-1." DNA Res. 1(5):223-229. PMID:7584044
  11. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298