ABCA5 | GeneID:23461 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 23461 Official Symbol ABCA5
Locus N/A Gene Type protein-coding
Synonyms ABC13; DKFZp451F117; DKFZp779N2435; EST90625; FLJ16381
Full Name ATP-binding cassette, sub-family A (ABC1), member 5
Description ATP-binding cassette, sub-family A (ABC1), member 5
Chromosome 17q24.3
Also Known As ATP-binding cassette A5; ATP-binding cassette, sub-family A , member 5
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24, but neither the substrate nor the function of this gene is known. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 10263

ID Symbol Protein Species
GeneID:23461 ABCA5 NP_061142.2 Homo sapiens
GeneID:217265 Abca5 NP_671752.1 Mus musculus
GeneID:286970 Abca5 NP_775429.1 Rattus norvegicus
GeneID:417444 ABCA5 XP_415695.2 Gallus gallus
GeneID:454848 ABCA5 XP_001166542.1 Pan troglodytes
GeneID:480455 ABCA5 XP_537573.2 Canis lupus familiaris
GeneID:510497 ABCA5 XP_587636.3 Bos taurus
GeneID:1272631 AgaP_AGAP010416 XP_311531.2 Anopheles gambiae
GeneID:100151075 LOC100151075 XP_001918691.1 Danio rerio

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCA5 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCA5 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005768 Component endosome
GO:0005794 Component Golgi apparatus
GO:0000139 Component Golgi membrane
GO:0016021 Component integral to membrane
GO:0031902 Component late endosome membrane
GO:0005765 Component lysosomal membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_018672  UCSC Browser NP_061142
2 NM_172232  UCSC Browser NP_758424

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000320086 MI0000448 hsa-miR-130a* UUCACAUUGUGCUACUGUCUGC
ENST00000320086 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENST00000320086 MI0003675 hsa-miR-411 UAGUAGACCGUAUAGCGUACG
ENST00000320086 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENST00000320086 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENST00000320086 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENST00000320086 MI0005543 hsa-miR-708 AAGGAGCUUACAAUCUAGCUGGG
ENST00000320086 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENST00000320086 MI0000098 hsa-miR-96* AAUCAUGUGCAGUGCCAAUAUG
ENST00000320086 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENST00000320086 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENST00000320086 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENST00000320086 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000320086 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000320086 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENST00000320086 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENST00000320086 MI0004658 mmu-miR-690 AAAGGCUAGGCUCACAACCAAA
ENST00000320086 MI0004687 mmu-miR-703 AAAACCUUCAGAAGGAAAGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Hosgood HD 3rd, et al. (2008) "Pathway-based evaluation of 380 candidate genes and lung cancer susceptibility suggests the importance of the cell cycle pathway." Carcinogenesis. 29(10):1938-1943. PMID:18676680
  3. [ + ] Ohtsuki S, et al. (2007) "Correlation of induction of ATP binding cassette transporter A5 (ABCA5) and ABCB1 mRNAs with differentiation state of human colon tumor." Biol Pharm Bull. 30(6):1144-1146. PMID:17541169
  4. [ + ] Hu Y, et al. (2007) "The ABCA5 protein: a urine diagnostic marker for prostatic intraepithelial neoplasia." Clin Cancer Res. 13(3):929-938. PMID:17289887
  5. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  6. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  7. [ + ] Petry F, et al. (2003) "Cloning of human and rat ABCA5/Abca5 and detection of a human splice variant." Biochem Biophys Res Commun. 300(2):343-350. PMID:12504089
  8. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  9. [ + ] Nagase T, et al. (2001) "Prediction of the coding sequences of unidentified human genes. XXI. The complete sequences of 60 new cDNA clones from brain which code for large proteins." DNA Res. 8(4):179-187. PMID:11572484
  10. [ + ] Dean M, et al. (2001) "The human ATP-binding cassette (ABC) transporter superfamily." Genome Res. 11(7):1156-1166. PMID:11435397
  11. [ + ] Allikmets R, et al. (1996) "Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database." Hum Mol Genet. 5(10):1649-1655. PMID:8894702