ABCA6 | GeneID:23460 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 23460 Official Symbol ABCA6
Locus N/A Gene Type protein-coding
Synonyms EST155051; FLJ43498
Full Name ATP-binding cassette, sub-family A (ABC1), member 6
Description ATP-binding cassette, sub-family A (ABC1), member 6
Chromosome 17q24.3
Also Known As ABC transporter ABCA6; ATP-binding cassette A6; ATP-binding cassette, sub-family A, member 6
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 71264

ID Symbol Protein Species
GeneID:23460 ABCA6 NP_525023.2 Homo sapiens
GeneID:76184 Abca6 NP_671751.1 Mus musculus
GeneID:480456 ABCA6 XP_850922.1 Canis lupus familiaris
GeneID:537351 ABCA6 XP_617513.3 Bos taurus
GeneID:742817 ABCA6 XP_001146278.1 Pan troglodytes

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab61093 ABCA6 antibody (ab61093); Mouse monoclonal to ABCA6
2 abnova H00023460-M01 ABCA6 monoclonal antibody (M01), clone 2F1; Mouse monoclonal antibody raised against a partial recombinant ABCA6.
3 acris AP17860PU-N ABCA6 C-term; antibody Ab

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCA6 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCA6 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_080284  UCSC Browser NP_525023

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000284425 MI0000064 hsa-let-7c* UAGAGUUACACCCUGGGAGUUA
ENST00000284425 MI0000103 hsa-miR-101 UACAGUACUGUGAUAACUGAA
ENST00000284425 MI0000739 hsa-miR-101 UACAGUACUGUGAUAACUGAA
ENST00000284425 MI0000471 hsa-miR-126* CAUUAUUACUUUUGGUACGCG
ENST00000284425 MI0000455 hsa-miR-138-2* GCUAUUUCACGACACCAGGGUU
ENST00000284425 MI0000261 hsa-miR-139-5p UCUACAGUGCACGUGUCUCCAG
ENST00000284425 MI0000115 hsa-miR-16-2* CCAAUAUUACUGUGCUGCUUUA
ENST00000284425 MI0000483 hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCU
ENST00000284425 MI0005545 hsa-miR-190b UGAUAUGUUUGAUAUUGGGUU
ENST00000284425 MI0000242 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000284425 MI0000281 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000284425 MI0000282 hsa-miR-199b-5p CCCAGUGUUUAGACUAUCUGUUC
ENST00000284425 MI0000300 hsa-miR-223* CGUGUAUUUGACAAGCUGAGUU
ENST00000284425 MI0000086 hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA
ENST00000284425 MI0000738 hsa-miR-302a* ACUUAAACGUGGAUGUACUUGCU
ENST00000284425 MI0000772 hsa-miR-302b* ACUUUAACAUGGAAGUGCUUUC
ENST00000284425 MI0000441 hsa-miR-30b UGUAAACAUCCUACACUCAGCU
ENST00000284425 MI0000254 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000284425 MI0000736 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000284425 MI0000814 hsa-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENST00000284425 MI0003646 hsa-miR-33b* CAGUGCCUCGGCAGUGCAGCCC
ENST00000284425 MI0000825 hsa-miR-345 GCUGACUCCUAGUCCAGGGCUC
ENST00000284425 MI0000777 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENST00000284425 MI0000777 hsa-miR-369-5p AGAUCGACCGUGUUAUAUUCGC
ENST00000284425 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENST00000284425 MI0003685 hsa-miR-421 AUCAACAGACAUUAAUUGGGCGC
ENST00000284425 MI0001446 hsa-miR-424* CAAAACGUGAGGCGCUGCUAU
ENST00000284425 MI0001652 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000284425 MI0003187 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000284425 MI0005531 hsa-miR-450b-5p UUUUGCAAUAUGUUCCUGAAUA
ENST00000284425 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000284425 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000284425 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENST00000284425 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENST00000284425 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENST00000284425 MI0003205 hsa-miR-532-5p CAUGCCUUGAGUGUAGGACCGU
ENST00000284425 MI0003516 hsa-miR-545 UCAGCAAACAUUUAUUGUGUGC
ENST00000284425 MI0003516 hsa-miR-545* UCAGUAAAUGUUUAUUAGAUGA
ENST00000284425 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000284425 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000284425 MI0003562 hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU
ENST00000284425 MI0003602 hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENST00000284425 MI0003634 hsa-miR-620 AUGGAGAUAGAUAUAGAAAU
ENST00000284425 MI0003643 hsa-miR-629 UGGGUUUACGUUGGGAGAACU
ENST00000284425 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENST00000284425 MI0005714 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC
ENST00000284425 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENST00000284425 MI0000097 hsa-miR-95 UUCAACGGGUAUUUAUUGAGCA
ENST00000284425 MI0000244 mmu-miR-201 UACUCAGUAAGGCAUUGUUCUU
ENST00000284425 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENST00000284425 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENST00000284425 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ABCA6 mRNA
17562736
Dietary Fats
  • Dietary Fats results in decreased expression of ABCA6 mRNA
18042831
nickel sulfate
  • nickel sulfate results in decreased expression of ABCA6 mRNA
16780908
palm oil
  • palm oil results in decreased expression of ABCA6 mRNA
18042831

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Dermatitis, Allergic Contact inferred via nickel sulfate 16780908
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 14986274, 16227642, 15968718, 16177239, 17562736, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Hosgood HD 3rd, et al. (2008) "Pathway-based evaluation of 380 candidate genes and lung cancer susceptibility suggests the importance of the cell cycle pathway." Carcinogenesis. 29(10):1938-1943. PMID:18676680
  3. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  4. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Kaminski WE, et al. (2001) "ABCA6, a novel a subclass ABC transporter." Biochem Biophys Res Commun. 285(5):1295-1301. PMID:11478798
  7. [ + ] Dean M, et al. (2001) "The human ATP-binding cassette (ABC) transporter superfamily." Genome Res. 11(7):1156-1166. PMID:11435397
  8. [ + ] Klucken J, et al. (2000) "ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport." Proc Natl Acad Sci U S A. 97(2):817-822. PMID:10639163
  9. [ + ] Allikmets R, et al. (1996) "Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database." Hum Mol Genet. 5(10):1649-1655. PMID:8894702