ABCB9 | GeneID:23457 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 23457 Official Symbol ABCB9
Locus N/A Gene Type protein-coding
Synonyms EST122234; KIAA1520; TAPL
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 9
Description ATP-binding cassette, sub-family B (MDR/TAP), member 9
Chromosome 12q24
Also Known As
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. The function of this half-transporter has not yet been determined; however, this protein may play a role in lysosomes. Alternative splicing of this gene results in distinct isoforms which are likely to have different substrate specifications. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 10491

ID Symbol Protein Species
GeneID:23457 ABCB9 NP_982269.1 Homo sapiens
GeneID:56325 Abcb9 NP_063928.2 Mus musculus
GeneID:63886 Abcb9 NP_071574.1 Rattus norvegicus
GeneID:416834 ABCB9 XP_415125.2 Gallus gallus
GeneID:452335 ABCB9 XP_509453.2 Pan troglodytes
GeneID:477456 ABCB9 XP_849373.1 Canis lupus familiaris
GeneID:570148 DKEY-21K4.3 XP_698681.3 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab60036 ABCB9 antibody - Carboxyterminal end (ab60036); Rabbit polyclonal to ABCB9 - Carboxyterminal end
2 abcam ab39273 ABCB9 antibody (ab39273); Goat polyclonal to ABCB9
3 abgent AP6115a ABCB9 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
4 abnova H00023457-M01 ABCB9 monoclonal antibody (M01), clone 4F4; Mouse monoclonal antibody raised against a partial recombinant ABCB9.
5 acris AP16092PU-N ABCB9 (C-term); antibody Ab
6 acris AP13078PU-N ABCB9 (C-term); antibody Ab
7 acris AP08961PU-N ABCB9 (C-term); antibody Ab
8 scbt ABCB9 ABCB9 Antibody / ABCB9 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCB9 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCB9 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0043190 Component ATP-binding cassette (ABC) transporter complex
GO:0005783 Component endoplasmic reticulum
GO:0005789 Component endoplasmic reticulum membrane
GO:0016021 Component integral to membrane
GO:0005765 Component lysosomal membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0015198 Function oligopeptide transporter activity
GO:0005215 Function transporter activity
GO:0006857 Process oligopeptide transport
GO:0015031 Process protein transport
GO:0007283 Process spermatogenesis

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_019624  UCSC Browser NP_062570
2 NM_019625  UCSC Browser NP_062571
3 NM_203444  UCSC Browser NP_982269 Q6P2Q0   Q9NP78  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000280560 MI0000060 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000280560 MI0000061 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000280560 MI0000062 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000280560 MI0000063 hsa-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENST00000280560 MI0000064 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENST00000280560 MI0000065 hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENST00000280560 MI0000066 hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENST00000280560 MI0000067 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000280560 MI0000068 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000280560 MI0000433 hsa-let-7g UGAGGUAGUAGUUUGUACAGUU
ENST00000280560 MI0000434 hsa-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENST00000280560 MI0000469 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA
ENST00000280560 MI0000446 hsa-miR-125b UCCCUGAGACCCUAACUUGUGA
ENST00000280560 MI0000470 hsa-miR-125b UCCCUGAGACCCUAACUUGUGA
ENST00000280560 MI0000482 hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENST00000280560 MI0000274 hsa-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENST00000280560 MI0000238 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENST00000280560 MI0000279 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENST00000280560 MI0001150 hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENST00000280560 MI0000080 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000280560 MI0000081 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000280560 MI0000089 hsa-miR-31 AGGCAAGAUGCUGGCAUAGCU
ENST00000280560 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENST00000280560 MI0000813 hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENST00000280560 MI0000812 hsa-miR-331-3p GCCCCUGGGCCUAUCCUAGAA
ENST00000280560 MI0001445 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENST00000280560 MI0001721 hsa-miR-431* CAGGUCGUCUUGCAGGGCUUCU
ENST00000280560 MI0003125 hsa-miR-490-5p CCAUGGAUCUCCAGGUGGGU
ENST00000280560 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENST00000280560 MI0003150 hsa-miR-526b* GAAAGUGCUUCCUUUUAGAGGC
ENST00000280560 MI0003592 hsa-miR-585 UGGGCGUAUCUGUAUGCUA
ENST00000280560 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENST00000280560 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENST00000280560 MI0003655 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU
ENST00000280560 MI0005532 hsa-miR-874 CUGCCCUGGCCCGAGGGACCGA
ENST00000280560 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENST00000280560 MI0005714 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC
ENST00000280560 MI0005759 hsa-miR-937 AUCCGCGCUCUGACUCUCUGCC
ENST00000280560 MI0000100 hsa-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENST00000280560 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENST00000280560 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENST00000280560 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENST00000280560 MI0000643 mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG
ENST00000280560 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENST00000280560 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG
ENST00000280560 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENST00000280560 MI0005206 mmu-miR-742 GAAAGCCACCAUGCUGGGUAAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ABCB9 mRNA
17562736
Flavonoids
  • Flavonoids results in decreased expression of ABCB9 mRNA
18035473
Raloxifene
  • Raloxifene affects the expression of ABCB9 mRNA
14699072

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Albuminuria inferred via Raloxifene 17308373, 17451421
Alzheimer Disease inferred via Raloxifene 15800139
Brain Injuries inferred via Raloxifene 16580743
Breast Neoplasms inferred via Raloxifene 17242785, 15572757, 17261762, 17952589, 17893378, 16912660, 15775269, 17440819, 16837676, 17595753, 15758505, 17049068
Carcinoma, Transitional Cell inferred via Raloxifene 17572228
Cardiovascular Diseases inferred via Raloxifene 15775269
Cognition Disorders inferred via Raloxifene 15800139
Depressive Disorder, Major inferred via Raloxifene 17474826
Diabetic Nephropathies inferred via Raloxifene 17308373, 15920148, 17451421
Edema inferred via Raloxifene 15860553
Encephalomyelitis, Autoimmune, Experimental inferred via Raloxifene 15845917
Fatty Liver inferred via Raloxifene 17473493
Heart Diseases inferred via Raloxifene 11110106
Hypertension inferred via Raloxifene 15787275, 17577099
Leiomyoma inferred via Raloxifene 16973256
Mixed Tumor, Mullerian inferred via Raloxifene 15863610
Multiple Myeloma inferred via Raloxifene 16497877
Myxoma inferred via Raloxifene 16343187
Osteoporosis inferred via Raloxifene 15775268, 17882678
Osteoporosis, Postmenopausal inferred via Raloxifene 15758505, 17893378, 15579764, 17823083
Prostatic Neoplasms inferred via Raloxifene 16220300, 15731164, 16536755
Purpura inferred via Raloxifene 15770314
Stroke inferred via Raloxifene 16837676
Urinary Bladder Neoplasms inferred via Raloxifene 17572228
Venous Thromboembolism inferred via Raloxifene 16837676
Vulvar Neoplasms inferred via Raloxifene 16343187
Inflammation inferred via Flavonoids 17296493
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 17522070, 14986274, 16227642, 15968718, 16177239, 17562736
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Kamakura A, et al. (2008) "Functional dissection of transmembrane domains of human TAP-like (ABCB9)." Biochem Biophys Res Commun. 377(3):847-851. PMID:18952056
  3. [ + ] Zhao C, et al. (2008) "Peptide specificity and lipid activation of the lysosomal transport complex ABCB9 (TAPL)." J Biol Chem. 283(25):17083-17091. PMID:18434309
  4. [ + ] Ohara T, et al. (2008) "Biochemical characterization of transporter associated with antigen processing (TAP)-like (ABCB9) expressed in insect cells." Biol Pharm Bull. 31(1):1-5. PMID:18175933
  5. [ + ] Demirel O, et al. (2007) "Identification of a lysosomal peptide transport system induced during dendritic cell development." J Biol Chem. 282(52):37836-37843. PMID:17977821
  6. [ + ] Ohashi-Kobayashi A, et al. (2006) "Examination of drug resistance activity of human TAP-like (ABCB9) expressed in yeast." Biochem Biophys Res Commun. 343(2):597-601. PMID:16554024
  7. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  8. [ + ] Wolters JC, et al. (2005) "Selective and ATP-dependent translocation of peptides by the homodimeric ATP binding cassette transporter TAP-like (ABCB9)." J Biol Chem. 280(25):23631-23636. PMID:15863492
  9. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  10. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  11. [ + ] Beausoleil SA, et al. (2004) "Large-scale characterization of HeLa cell nuclear phosphoproteins." Proc Natl Acad Sci U S A. 101(33):12130-12135. PMID:15302935
  12. [ + ] Homma K, et al. (2004) "Alternative splice variants encoding unstable protein domains exist in the human brain." J Mol Biol. 343(5):1207-1220. PMID:15491607
  13. [ + ] Kobayashi A, et al. (2003) "Gene organization of human transporter associated with antigen processing-like (TAPL, ABCB9): analysis of alternative splicing variants and promoter activity." Biochem Biophys Res Commun. 309(4):815-822. PMID:13679046
  14. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  15. [ + ] Saito S, et al. (2002) "Three hundred twenty-six genetic variations in genes encoding nine members of ATP-binding cassette, subfamily B (ABCB/MDR/TAP), in the Japanese population." J Hum Genet. 47(1):38-50. PMID:11829140
  16. [ + ] Zhang F, et al. (2000) "Characterization of ABCB9, an ATP binding cassette protein associated with lysosomes." J Biol Chem. 275(30):23287-23294. PMID:10748049
  17. [ + ] Kobayashi A, et al. (2000) "A half-type ABC transporter TAPL is highly conserved between rodent and man, and the human gene is not responsive to interferon-gamma in contrast to TAP1 and TAP2." J Biochem. 128(4):711-718. PMID:11011155
  18. [ + ] Nagase T, et al. (2000) "Prediction of the coding sequences of unidentified human genes. XVII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro." DNA Res. 7(2):143-150. PMID:10819331
  19. [ + ] Allikmets R, et al. (1996) "Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database." Hum Mol Genet. 5(10):1649-1655. PMID:8894702
  20. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548