ABCB10 | GeneID:23456 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 23456 Official Symbol ABCB10
Locus N/A Gene Type protein-coding
Synonyms EST20237; M-ABC2; MTABC2
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 10
Description ATP-binding cassette, sub-family B (MDR/TAP), member 10
Chromosome 1q42.13
Also Known As ABC transporter 10 protein; ATP-binding cassette sub-family B member 10, mitochondrial; ATP-binding cassette transporter 10; ATP-binding cassette, sub-family B, member 10; OTTHUMP00000037475; mitochondrial ATP-binding cassette 2
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The function of this mitochondrial protein is unknown. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 6474

ID Symbol Protein Species
GeneID:23456 ABCB10 NP_036221.1 Homo sapiens
GeneID:30994 CG3156 NP_569844.2 Drosophila melanogaster
GeneID:56199 Abcb10 NP_062425.1 Mus musculus
GeneID:178522 haf-1 NP_503098.2 Caenorhabditis elegans
GeneID:180056 haf-3 NP_506927.1 Caenorhabditis elegans
GeneID:361439 Abcb10 NP_001012166.1 Rattus norvegicus
GeneID:421537 ABCB10 XP_419578.2 Gallus gallus
GeneID:789800 ABCB10 XP_001256449.1 Bos taurus
GeneID:814343 MAL3P1.7 XP_001351101.1 Plasmodium falciparum
GeneID:833896 ATTAP2 NP_198720.2 Arabidopsis thaliana
GeneID:855858 MDL2 NP_015053.2 Saccharomyces cerevisiae
GeneID:1273250 AgaP_AGAP002717 XP_563428.1 Anopheles gambiae
GeneID:2541285 mdl1 NP_595751.1 Schizosaccharomyces pombe
GeneID:2685051 MGG_06878 XP_370381.2 Magnaporthe grisea
GeneID:2705539 NCU04117.1 XP_323457.1 Neurospora crassa
GeneID:2893314 KLLA0D00748g XP_453105.1 Kluyveromyces lactis
GeneID:4334151 Os03g0755100 NP_001051311.1 Oryza sativa
GeneID:4619550 AGOS_ACR022W NP_983425.1 Eremothecium gossypii
GeneID:100003744 LOC100003744 XP_001343218.2 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abgent AP6109a ABCB10 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
2 acris AP13072PU-N ABCB10 (N-term); antibody Ab
3 scbt ABCB10 ABCB10 Antibody / ABCB10 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCB10 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCB10 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0043190 Component ATP-binding cassette (ABC) transporter complex
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005743 Component mitochondrial inner membrane
GO:0005739 Component mitochondrion
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_012089  UCSC Browser NP_036221

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000344517 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENST00000344517 MI0000273 hsa-miR-183 UAUGGCACUGGUAGAAUUCACU
ENST00000344517 MI0000487 hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU
ENST00000344517 MI0003137 hsa-miR-193b AACUGGCCCUCAAAGUCCCGCU
ENST00000344517 MI0000737 hsa-miR-200a UAACACUGUCUGGUAACGAUGU
ENST00000344517 MI0000777 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENST00000344517 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENST00000344517 MI0003171 hsa-miR-518d-3p CAAAGCGCUUCCCUUUGGAGC
ENST00000344517 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENST00000344517 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ABCB10 mRNA
17562736
Calcitriol
  • Calcitriol results in decreased expression of ABCB10 mRNA
12875902
cyanoginosin LR
  • cyanoginosin LR results in decreased expression of ABCB10 mRNA
17654400
Tretinoin
  • Tretinoin results in decreased expression of ABCB10 mRNA
12875902

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16443354, 16166294
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 16823087, 12679006, 16935935, 17107899, 17217047, 17339181, 16140955, 16331271, 17294898, 17361223, 17368321, 17301526, 17506722, 16766008, 16788101, 15748426
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Hepatitis, Toxic inferred via cyanoginosin LR 17654400
Breast Neoplasms inferred via Calcitriol 11237771
Carcinoma, Squamous Cell inferred via Calcitriol 11237771
Encephalomyelitis, Autoimmune, Experimental inferred via Calcitriol 15138306
Prostatic Hyperplasia inferred via Calcitriol 15572423
Prostatic Neoplasms inferred via Calcitriol 12479363, 16644109, 16289102
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 17562736, 17522070, 14986274, 15968718, 16227642, 16177239
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Tang L, et al. (2009) "Exclusion of ABCB8 and ABCB10 as cancer candidate genes in acute myeloid leukemia." Leukemia. 23(5):1000-1002. PMID:19151771
  2. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  3. [ + ] Fortna A, et al. (2004) "Lineage-specific gene duplication and loss in human and great ape evolution." PLoS Biol. 2(7):E207. PMID:15252450
  4. [ + ] Graf SA, et al. (2004) "Targeting, import, and dimerization of a mammalian mitochondrial ATP binding cassette (ABC) transporter, ABCB10 (ABC-me)." J Biol Chem. 279(41):42954-42963. PMID:15215243
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Saito S, et al. (2002) "Three hundred twenty-six genetic variations in genes encoding nine members of ATP-binding cassette, subfamily B (ABCB/MDR/TAP), in the Japanese population." J Hum Genet. 47(1):38-50. PMID:11829140
  7. [ + ] Zhang F, et al. (2000) "M-ABC2, a new human mitochondrial ATP-binding cassette membrane protein." FEBS Lett. 478(1-2):89-94. PMID:10922475
  8. [ + ] Zhang F, et al. (2000) "Characterization of ABCB9, an ATP binding cassette protein associated with lysosomes." J Biol Chem. 275(30):23287-23294. PMID:10748049
  9. [ + ] Allikmets R, et al. (1995) "Characterization and mapping of three new mammalian ATP-binding transporter genes from an EST database." Mamm Genome. 6(2):114-117. PMID:7766993