FNTB | GeneID:2342 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2342 Official Symbol FNTB
Locus N/A Gene Type protein-coding
Synonyms FPTB; MGC31935
Full Name farnesyltransferase, CAAX box, beta
Description farnesyltransferase, CAAX box, beta
Chromosome 14q23-q24
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 1535

ID Symbol Protein Species
GeneID:2342 FNTB NP_002019.1 Homo sapiens
GeneID:41989 CG17565 NP_650540.1 Drosophila melanogaster
GeneID:64511 Fntb NP_742031.1 Rattus norvegicus
GeneID:110606 Fntb NP_666039.1 Mus musculus
GeneID:179946 tag-114 NP_506580.1 Caenorhabditis elegans
GeneID:323500 fntb NP_001002128.1 Danio rerio
GeneID:327686 FNTB NP_786999.1 Bos taurus
GeneID:452971 FNTB XP_001170866.1 Pan troglodytes
GeneID:490735 FNTB XP_547857.2 Canis lupus familiaris
GeneID:811026 PF11_0483 XP_001348150.1 Plasmodium falciparum
GeneID:834026 ERA1 NP_198844.1 Arabidopsis thaliana
GeneID:851468 RAM1 NP_010193.1 Saccharomyces cerevisiae
GeneID:1281446 AgaP_AGAP001729 XP_321357.2 Anopheles gambiae
GeneID:2542380 cpp1 NP_594251.1 Schizosaccharomyces pombe
GeneID:2679721 MGG_01287 XP_363361.2 Magnaporthe grisea
GeneID:2707699 NCU05999.1 XP_325854.1 Neurospora crassa
GeneID:2895695 KLLA0F07161g XP_455405.1 Kluyveromyces lactis
GeneID:4327880 Os01g0737800 NP_001044183.1 Oryza sativa
GeneID:4620533 AGOS_ADR275W NP_984371.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab71755 FNTB antibody - N-terminal (ab71755); Rabbit polyclonal to FNTB - N-terminal
2 abgent AP2414a FNTB Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
3 abnova H00002342-M01 FNTB monoclonal antibody (M01), clone 3A9; Mouse monoclonal antibody raised against a full-length recombinant FNTB.
4 acris AP12189PU-N FNTB (N-term); antibody Ab
5 acris AP01497PU-N FNTB; antibody Ab
6 scbt FNTB FNTB Antibody / FNTB Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of FNTB Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FNTB Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0004311 Function farnesyltranstransferase activity
GO:0046872 Function metal ion binding
GO:0005515 Function protein binding
GO:0004660 Function protein farnesyltransferase activity
GO:0016740 Function transferase activity
GO:0008270 Function zinc ion binding
GO:0008285 Process negative regulation of cell proliferation
GO:0048146 Process positive regulation of fibroblast proliferation
GO:0018347 Process protein amino acid farnesylation
GO:0042060 Process wound healing

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_002028  UCSC Browser NP_002019 P49356   B2RDX6  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000246166 MI0000298 hsa-miR-221* ACCUGGCAUACAAUGUAGAUUU
ENST00000246166 MI0000080 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000246166 MI0000081 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000246166 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENST00000246166 MI0000826 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU
ENST00000246166 MI0000743 hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG
ENST00000246166 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENST00000246166 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENST00000246166 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
alachlor
  • alachlor results in increased expression of FNTB mRNA
12419858
Flavonoids
  • Flavonoids results in decreased expression of FNTB mRNA
18035473
perilla alcohol
  • [perilla alcohol co-treated with Vitamin A] results in decreased expression of FNTB mRNA
  • [perilla alcohol co-treated with Vitamin A] results in increased expression of FNTB protein
  • perilla alcohol results in decreased expression of FNTB mRNA
  • perilla alcohol results in increased expression of FNTB protein
15959631
Vitamin A
  • Vitamin A results in increased expression of FNTB mRNA
  • Vitamin A results in increased expression of FNTB protein
  • [perilla alcohol co-treated with Vitamin A] results in decreased expression of FNTB mRNA
  • [perilla alcohol co-treated with Vitamin A] results in increased expression of FNTB protein
15959631

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Anemia inferred via Vitamin A 16960172
Anemia, Iron-Deficiency inferred via Vitamin A 16960172
Asthma inferred via Vitamin A 16732791
Bronchopulmonary Dysplasia inferred via Vitamin A 17426644, 17377406
Child Nutrition Disorders inferred via Vitamin A 16153327
Cholestasis inferred via Vitamin A 16175620
Cleft Palate inferred via Vitamin A 16054864
Colonic Neoplasms inferred via Vitamin A 17219422, 16267017
Diabetes Mellitus, Type 1 inferred via Vitamin A 16506275
Dry Eye Syndromes inferred via Vitamin A 16146918
Ectromelia inferred via Vitamin A 16054864
Fetal Resorption inferred via Vitamin A 16054864
Heart Defects, Congenital inferred via Vitamin A 16080930
Hernia, Diaphragmatic inferred via Vitamin A 17436238, 16292552, 16490937, 16877224, 16863852
HIV Infections inferred via Vitamin A 16960176
HIV Seropositivity inferred via Vitamin A 17209195
Hypervitaminosis A inferred via Vitamin A 16054864
Limb Deformities, Congenital inferred via Vitamin A 16054864
Liver Cirrhosis inferred via Vitamin A 16256175
Liver Cirrhosis, Experimental inferred via Vitamin A 16248980
Liver Diseases inferred via Vitamin A 16175620
Liver Diseases, Alcoholic inferred via Vitamin A 16762690
Liver Neoplasms, Experimental inferred via Vitamin A 17113696
Lung Diseases inferred via Vitamin A 16863852
Multiple Myeloma inferred via Vitamin A 16374440
Neural Tube Defects inferred via Vitamin A 17400914
Respiratory Distress Syndrome, Newborn inferred via Vitamin A 16877224
Vitamin A Deficiency inferred via Vitamin A 16960172, 16175781, 16146918
Inflammation inferred via Flavonoids 17296493
Agricultural Workers' Diseases inferred via alachlor 11874814, 14769641
Dermatitis, Allergic Contact inferred via alachlor 8428444
Infertility, Male inferred via alachlor 16466525, 12948887, 17049205
Leukemia inferred via alachlor 14769641
Multiple Myeloma inferred via alachlor 14769641
Nose Neoplasms inferred via alachlor 16698726, 15580706, 16178123, 11127290, 14563481
Respiratory Sounds inferred via alachlor 11874814
Thyroid Neoplasms inferred via alachlor 8812207

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
PTP4A2 PTP4A2 / FNTB Affinity Capture-MS Ewing RM (2007)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ewing RM, et al. (2007) "Large-scale mapping of human protein-protein interactions by mass spectrometry." Mol Syst Biol. 3():89. PMID:17353931
  2. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  3. [ + ] Rush J, et al. (2005) "Immunoaffinity profiling of tyrosine phosphorylation in cancer cells." Nat Biotechnol. 23(1):94-101. PMID:15592455
  4. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  5. [ + ] Reid TS, et al. (2004) "Crystal structures of the anticancer clinical candidates R115777 (Tipifarnib) and BMS-214662 complexed with protein farnesyltransferase suggest a mechanism of FTI selectivity." Biochemistry. 43(22):6877-6884. PMID:15170324
  6. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  7. [ + ] deSolms SJ, et al. (2003) "Dual protein farnesyltransferase-geranylgeranyltransferase-I inhibitors as potential cancer chemotherapeutic agents." J Med Chem. 46(14):2973-2984. PMID:12825937
  8. [ + ] Long SB, et al. (2002) "Reaction path of protein farnesyltransferase at atomic resolution." Nature. 419(6907):645-650. PMID:12374986
  9. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  10. [ + ] Bell IM, et al. (2002) "3-Aminopyrrolidinone farnesyltransferase inhibitors: design of macrocyclic compounds with improved pharmacokinetics and excellent cell potency." J Med Chem. 45(12):2388-2409. PMID:12036349
  11. [ + ] Guenzi E, et al. (2001) "The helical domain of GBP-1 mediates the inhibition of endothelial cell proliferation by inflammatory cytokines." EMBO J. 20(20):5568-5577. PMID:11598000
  12. [ + ] Long SB, et al. (2001) "The crystal structure of human protein farnesyltransferase reveals the basis for inhibition by CaaX tetrapeptides and their mimetics." Proc Natl Acad Sci U S A. 98(23):12948-12953. PMID:11687658
  13. [ + ] Lobell RB, et al. (2001) "Evaluation of farnesyl:protein transferase and geranylgeranyl:protein transferase inhibitor combinations in preclinical models." Cancer Res. 61(24):8758-8768. PMID:11751396
  14. [ + ] Ashar HR, et al. (2000) "Farnesyl transferase inhibitors block the farnesylation of CENP-E and CENP-F and alter the association of CENP-E with the microtubules." J Biol Chem. 275(39):30451-30457. PMID:10852915
  15. [ + ] Zeng Q, et al. (2000) "Prenylation-dependent association of protein-tyrosine phosphatases PRL-1, -2, and -3 with the plasma membrane and the early endosome." J Biol Chem. 275(28):21444-21452. PMID:10747914
  16. [ + ] Prakash B, et al. (2000) "Structure of human guanylate-binding protein 1 representing a unique class of GTP-binding proteins." Nature. 403(6769):567-571. PMID:10676968
  17. [ + ] Long SB, et al. (1998) "Cocrystal structure of protein farnesyltransferase complexed with a farnesyl diphosphate substrate." Biochemistry. 37(27):9612-9618. PMID:9657673
  18. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  19. [ + ] Goalstone ML, et al. (1996) "Effect of insulin on farnesyltransferase activity in 3T3-L1 adipocytes." J Biol Chem. 271(44):27585-27589. PMID:8910345
  20. [ + ] Nantais DE, et al. (1996) "Prenylation of an interferon-gamma-induced GTP-binding protein: the human guanylate binding protein, huGBP1." J Leukoc Biol. 60(3):423-431. PMID:8830800
  21. [ + ] Wang T, et al. (1996) "The p21(RAS) farnesyltransferase alpha subunit in TGF-beta and activin signaling." Science. 271(5252):1120-1122. PMID:8599089
  22. [ + ] Sinensky M, et al. (1994) "The processing pathway of prelamin A." J Cell Sci. 107 ( Pt 1)():61-67. PMID:8175923
  23. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298
  24. [ + ] Omer CA, et al. (1993) "Characterization of recombinant human farnesyl-protein transferase: cloning, expression, farnesyl diphosphate binding, and functional homology with yeast prenyl-protein transferases." Biochemistry. 32(19):5167-5176. PMID:8494894
  25. [ + ] Andres DA, et al. (1993) "cDNA cloning of the two subunits of human CAAX farnesyltransferase and chromosomal mapping of FNTA and FNTB loci and related sequences." Genomics. 18(1):105-112. PMID:8276393
  26. [ + ] Manne V, et al. (1990) "Identification and preliminary characterization of protein-cysteine farnesyltransferase." Proc Natl Acad Sci U S A. 87(19):7541-7545. PMID:2217184