FREQ | GeneID:23413 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 23413 Official Symbol FREQ
Locus N/A Gene Type protein-coding
Synonyms DKFZp761L1223; FLUP; NCS-1; NCS1
Full Name frequenin homolog (Drosophila)
Description frequenin homolog (Drosophila)
Chromosome 9q34
Also Known As OTTHUMP00000022356; frequenin homolog; frequenin-like ubiquitous protein; neuronal calcium sensor 1
Summary This gene is a member of the neuronal calcium sensor gene family, which encode calcium-binding proteins expressed predominantly in neurons. The protein encoded by this gene regulates G protein-coupled receptor phosphorylation in a calcium-dependent manner and can substitute for calmodulin. The protein is associated with secretory granules and modulates synaptic transmission and synaptic plasticity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 5719

ID Symbol Protein Species
GeneID:14299 Freq NP_062655.1 Mus musculus
GeneID:23413 FREQ NP_055101.2 Homo sapiens
GeneID:32797 Frq1 NP_573271.1 Drosophila melanogaster
GeneID:32799 Frq2 NP_525093.1 Drosophila melanogaster
GeneID:65153 Freq NP_077342.1 Rattus norvegicus
GeneID:180448 ncs-1 NP_508186.1 Caenorhabditis elegans
GeneID:396336 FREQ NP_990708.1 Gallus gallus
GeneID:491294 FREQ XP_548415.2 Canis lupus familiaris
GeneID:526544 FREQ NP_001035637.1 Bos taurus
GeneID:553174 freqb NP_001018350.1 Danio rerio
GeneID:1278632 AgaP_ENSANGG00000017071 XP_318275.1 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab34743 Frequenin antibody (HRP) (ab34743); Chicken polyclonal to Frequenin (HRP)
2 abcam ab5807 Frequenin antibody (ab5807); Rabbit polyclonal to Frequenin
3 abcam ab18060 Frequenin antibody (ab18060); Chicken polyclonal to Frequenin
4 abgent AP1551c NCS1 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
5 abnova H00023413-M02 FREQ monoclonal antibody (M02), clone 3E7; Mouse monoclonal antibody raised against a full-length recombinant FREQ.
6 acris R1159P NCS1; antibody Ab
7 acris AP08212PU-N NCS1; antibody Ab
8 acris AP11588PU-N NCS1 (Center); antibody Ab
9 acris SP5360P NCS1; antibody Ab
10 acris AP09219PU-N NCS1; antibody Ab
11 acris BP085 NCS1 (C-term); antibody Ab
12 acris AP07405PU-N NCS1; antibody Ab
13 acris R1159B NCS1; antibody Ab
14 acris AP05349PU-N NCS1 (C-term.); antibody Ab
15 acris R1159HRP NCS1; antibody Ab
16 scbt FREQ FREQ Antibody / FREQ Antibodies;
17 sigma N4285 Anti-NCS-1 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of FREQ Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FREQ Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0030424 Component axon
GO:0030425 Component dendrite
GO:0005794 Component Golgi apparatus
GO:0032580 Component Golgi cisterna membrane
GO:0016020 Component membrane
GO:0005509 Function calcium ion binding
GO:0005515 Function protein binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001128826  UCSC Browser NP_001122298
2 NM_014286  UCSC Browser NP_055101

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000372398 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Methimazole
  • Methimazole results in increased expression of FREQ mRNA
17403546
perchlorate
  • perchlorate results in decreased expression of FREQ mRNA
17403546
Propylthiouracil
  • Propylthiouracil results in increased expression of FREQ mRNA
17403546

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Thyroid Neoplasms inferred via Propylthiouracil 15710170
Hyperthyroidism inferred via Methimazole 14678291

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
DRD2 DRD2 / FREQ Affinity Capture-Western Kabbani N (2002)
DRD2 FREQ / DRD2 Affinity Capture-Western Kabbani N (2002)
DRD2 FREQ / DRD2 Reconstituted Complex Kabbani N (2002)
DRD2 DRD2 / FREQ Two-hybrid Kabbani N (2002)
DRD2 FREQ / DRD2 Two-hybrid Kabbani N (2002)
DRD3 FREQ / DRD3 Affinity Capture-Western Kabbani N (2002)
DTX2 FREQ / DTX2 Two-hybrid Rual JF (2005)
IL1RAPL1 IL1RAPL1 / FREQ Affinity Capture-Western Bahi N (2003)
IL1RAPL1 IL1RAPL1 / FREQ Reconstituted Complex Bahi N (2003)
IL1RAPL1 FREQ / IL1RAPL1 Two-hybrid Bahi N (2003)
KCND2 KCND2 / FREQ Affinity Capture-Western Nakamura TY (2001)
PIK4CB FREQ / PIK4CB Affinity Capture-Western Kapp-Barnea Y (2003)
PIK4CB FREQ / PIK4CB Affinity Capture-Western Zhao X (2001)
PIK4CB PIK4CB / FREQ Affinity Capture-Western Zhao X (2001)
PIK4CB PIK4CB / FREQ Reconstituted Complex Zhao X (2001)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Torres KC, et al. (2009) "Expression of neuronal calcium sensor-1 (NCS-1) is decreased in leukocytes of schizophrenia and bipolar disorder patients." Prog Neuropsychopharmacol Biol Psychiatry. 33(2):229-234. PMID:19091302
  2. [ + ] Szafranski K, et al. (2007) "Violating the splicing rules: TG dinucleotides function as alternative 3' splice sites in U2-dependent introns." Genome Biol. 8(8):R154. PMID:17672918
  3. [ + ] Kapp-Barnea Y, et al. (2006) "Neuronal calcium sensor-1 and phosphatidylinositol 4-kinase beta stimulate extracellular signal-regulated kinase 1/2 signaling by accelerating recycling through the endocytic recycling compartment." Mol Biol Cell. 17(9):4130-4141. PMID:16837555
  4. [ + ] Dahl JP, et al. (2006) "Interaction between variation in the D2 dopamine receptor (DRD2) and the neuronal calcium sensor-1 (FREQ) genes in predicting response to nicotine replacement therapy for tobacco dependence." Pharmacogenomics J. 6(3):194-199. PMID:16402081
  5. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  6. [ + ] Rual JF, et al. (2005) "Towards a proteome-scale map of the human protein-protein interaction network." Nature. 437(7062):1173-1178. PMID:16189514
  7. [ + ] O'Callaghan DW, et al. (2004) "Identification of residues that determine the absence of a Ca(2+)/myristoyl switch in neuronal calcium sensor-1." J Biol Chem. 279(14):14347-14354. PMID:14726528
  8. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  9. [ + ] Humphray SJ, et al. (2004) "DNA sequence and analysis of human chromosome 9." Nature. 429(6990):369-374. PMID:15164053
  10. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  11. [ + ] Ren X, et al. (2003) "Effective association of Kv channel-interacting proteins with Kv4 channel is mediated with their unique core peptide." J Biol Chem. 278(44):43564-43570. PMID:12928444
  12. [ + ] Koh PO, et al. (2003) "Up-regulation of neuronal calcium sensor-1 (NCS-1) in the prefrontal cortex of schizophrenic and bipolar patients." Proc Natl Acad Sci U S A. 100(1):313-317. PMID:12496348
  13. [ + ] Bahi N, et al. (2003) "IL1 receptor accessory protein like, a protein involved in X-linked mental retardation, interacts with Neuronal Calcium Sensor-1 and regulates exocytosis." Hum Mol Genet. 12(12):1415-1425. PMID:12783849
  14. [ + ] Strahl T, et al. (2003) "Conservation of regulatory function in calcium-binding proteins: human frequenin (neuronal calcium sensor-1) associates productively with yeast phosphatidylinositol 4-kinase isoform, Pik1." J Biol Chem. 278(49):49589-49599. PMID:14512421
  15. [ + ] Kapp-Barnea Y, et al. (2003) "Neuronal calcium sensor-1 and phosphatidylinositol 4-kinase beta regulate IgE receptor-triggered exocytosis in cultured mast cells." J Immunol. 171(10):5320-5327. PMID:14607934
  16. [ + ] Brochetta C, et al. (2003) "Identification and subcellular localization of neuronal calcium sensor-1 (NCS-1) in human neutrophils and HL-60 cells." Inflammation. 27(6):361-372. PMID:14760944
  17. [ + ] Chen C, et al. (2002) "Human neuronal calcium sensor-1 shows the highest expression level in cerebral cortex." Neurosci Lett. 319(2):67-70. PMID:11825672
  18. [ + ] Kabbani N, et al. (2002) "Interaction with neuronal calcium sensor NCS-1 mediates desensitization of the D2 dopamine receptor." J Neurosci. 22(19):8476-8486. PMID:12351722
  19. [ + ] Taverna E, et al. (2002) "Neuronal calcium sensor 1 and phosphatidylinositol 4-OH kinase beta interact in neuronal cells and are translocated to membranes during nucleotide-evoked exocytosis." J Cell Sci. 115(Pt 20):3909-3922. PMID:12244129
  20. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  21. [ + ] Scalettar BA, et al. (2002) "Neuronal calcium sensor-1 binds to regulated secretory organelles and functions in basal and stimulated exocytosis in PC12 cells." J Cell Sci. 115(Pt 11):2399-2412. PMID:12006624
  22. [ + ] O'Callaghan DW, et al. (2002) "Differential use of myristoyl groups on neuronal calcium sensor proteins as a determinant of spatio-temporal aspects of Ca2+ signal transduction." J Biol Chem. 277(16):14227-14237. PMID:11836243
  23. [ + ] Burgoyne RD, et al. (2001) "The neuronal calcium sensor family of Ca2+-binding proteins." Biochem J. 353(Pt 1):1-12. PMID:11115393
  24. [ + ] Zhao X, et al. (2001) "Interaction of neuronal calcium sensor-1 (NCS-1) with phosphatidylinositol 4-kinase beta stimulates lipid kinase activity and affects membrane trafficking in COS-7 cells." J Biol Chem. 276(43):40183-40189. PMID:11526106
  25. [ + ] Bourne Y, et al. (2001) "Immunocytochemical localization and crystal structure of human frequenin (neuronal calcium sensor 1)." J Biol Chem. 276(15):11949-11955. PMID:11092894
  26. [ + ] Nakamura TY, et al. (2001) "A role for frequenin, a Ca2+-binding protein, as a regulator of Kv4 K+-currents." Proc Natl Acad Sci U S A. 98(22):12808-12813. PMID:11606724
  27. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548
  28. [ + ] De Castro E, et al. (1995) "Regulation of rhodopsin phosphorylation by a family of neuronal calcium sensors." Biochem Biophys Res Commun. 216(1):133-140. PMID:7488079