FNTA | GeneID:2339 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2339 Official Symbol FNTA
Locus N/A Gene Type protein-coding
Synonyms FPTA; MGC99680; PGGT1A; PTAR2
Full Name farnesyltransferase, CAAX box, alpha
Description farnesyltransferase, CAAX box, alpha
Chromosome 8p11
Also Known As FTase-alpha; GGTase-I-alpha; farnesyltransferase alpha-subunit; protein prenyltransferase alpha subunit repeat containing 2; ras proteins prenyltransferase alpha; type I protein geranyl-geranyltransferase alpha subunit
Summary Prenyltransferases attach either a farnesyl group or a geranylgeranyl group in thioether linkage to the cysteine residue of protein's with a C-terminal CAAX box. CAAX geranylgeranyltransferase and CAAX farnesyltransferase are heterodimers that share the same alpha subunit but have different beta subunits. This gene encodes the alpha subunit of these transferases. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 1534

ID Symbol Protein Species
GeneID:2339 FNTA NP_002018.1 Homo sapiens
GeneID:14272 Fnta NP_032059.1 Mus musculus
GeneID:25318 Fnta NP_036979.1 Rattus norvegicus
GeneID:33682 CG2976 NP_608862.1 Drosophila melanogaster
GeneID:176840 R02D3.5 NP_499882.1 Caenorhabditis elegans
GeneID:281169 FNTA NP_803464.1 Bos taurus
GeneID:427299 FNTA XP_424881.2 Gallus gallus
GeneID:472929 FNTA XP_001145933.1 Pan troglodytes
GeneID:475566 FNTA XP_532786.2 Canis lupus familiaris
GeneID:555882 zgc:158397 NP_001074029.1 Danio rerio
GeneID:825107 FTA NP_567084.1 Arabidopsis thaliana
GeneID:853849 RAM2 NP_012906.1 Saccharomyces cerevisiae
GeneID:1280873 AgaP_AGAP011767 XP_320743.2 Anopheles gambiae
GeneID:2543143 cwp1 NP_593518.1 Schizosaccharomyces pombe
GeneID:2685120 MGG_06947 XP_370450.1 Magnaporthe grisea
GeneID:2704877 NCU03632.1 XP_322934.1 Neurospora crassa
GeneID:2894243 KLLA0E18051g XP_454761.1 Kluyveromyces lactis
GeneID:4347566 Os09g0514400 NP_001063659.1 Oryza sativa
GeneID:4619623 AGOS_ACR094C NP_983496.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab38448 FNTA antibody (ab38448); Rabbit polyclonal to FNTA
2 abgent AP2420b FNTA Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
3 abgent AP2420a FNTA Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
4 acris AP08262PU-N FNTA (aa 150-250); antibody Ab
5 acris AP12200PU-N FNTA (Center); antibody Ab
6 acris AP12201PU-N FNTA (C-term); antibody Ab
7 scbt FNTA FNTA Antibody / FNTA Antibodies;
8 sigma HPA018830 Anti-FNTA antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of FNTA Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FNTA Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005829 Component cytosol
GO:0030548 Function acetylcholine receptor regulator activity
GO:0004662 Function CAAX-protein geranylgeranyltransferase activity
GO:0005515 Function protein binding
GO:0004660 Function protein farnesyltransferase activity
GO:0016740 Function transferase activity
GO:0045213 Process neurotransmitter receptor metabolic process
GO:0018347 Process protein amino acid farnesylation
GO:0018348 Process protein amino acid geranylgeranylation
GO:0007179 Process transforming growth factor beta receptor signaling pathway

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001018676  UCSC Browser NP_001018196
2 NM_001018677  UCSC Browser NP_001018197 A6NJW0   P49354  
3 NM_002027  UCSC Browser NP_002018 P49354   Q53XJ9  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000302279 MI0000108 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000302279 MI0000109 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000302279 MI0000114 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENST00000302279 MI0000476 hsa-miR-138-1* GCUACUUCACAACACCAGGGCC
ENST00000302279 MI0000456 hsa-miR-140-3p UACCACAGGGUAGAACCACGG
ENST00000302279 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENST00000302279 MI0000480 hsa-miR-154 UAGGUUAUCCGUGUUGCCUUCG
ENST00000302279 MI0000069 hsa-miR-15a UAGCAGCACAUAAUGGUUUGUG
ENST00000302279 MI0000438 hsa-miR-15b UAGCAGCACAUCAUGGUUUACA
ENST00000302279 MI0000070 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000302279 MI0000115 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000302279 MI0000071 hsa-miR-17* ACUGCAGUGAAGGCACUUGUAG
ENST00000302279 MI0000269 hsa-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENST00000302279 MI0000289 hsa-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENST00000302279 MI0000269 hsa-miR-181a-2* ACCACUGACCGUUGACUGUACC
ENST00000302279 MI0000270 hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENST00000302279 MI0000683 hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENST00000302279 MI0000271 hsa-miR-181c AACAUUCAACCUGUCGGUGAGU
ENST00000302279 MI0003139 hsa-miR-181d AACAUUCAUUGUUGUCGGUGGGU
ENST00000302279 MI0000274 hsa-miR-187* GGCUACAACACAGGACCCGGGC
ENST00000302279 MI0000489 hsa-miR-195 UAGCAGCACAGAAAUAUUGGC
ENST00000302279 MI0005570 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU
ENST00000302279 MI0000286 hsa-miR-210 CUGUGCGUGUGACAGCGGCUGA
ENST00000302279 MI0000079 hsa-miR-23a AUCACAUUGCCAGGGAUUUCC
ENST00000302279 MI0000079 hsa-miR-23a* GGGGUUCCUGGGGAUGGGAUUU
ENST00000302279 MI0000439 hsa-miR-23b AUCACAUUGCCAGGGAUUACC
ENST00000302279 MI0000081 hsa-miR-24-2* UGCCUACUGAGCUGAAACACAG
ENST00000302279 MI0000744 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU
ENST00000302279 MI0000807 hsa-miR-323-3p CACAUUACACGGUCGACCUCU
ENST00000302279 MI0000806 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC
ENST00000302279 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENST00000302279 MI0000777 hsa-miR-369-5p AGAUCGACCGUGUUAUAUUCGC
ENST00000302279 MI0000789 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
ENST00000302279 MI0001735 hsa-miR-409-5p AGGUUACCCGAGCAACUUUGCAU
ENST00000302279 MI0003133 hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG
ENST00000302279 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENST00000302279 MI0003513 hsa-miR-455-5p UAUGUGCCUUUGGACUACAUCG
ENST00000302279 MI0003138 hsa-miR-497 CAGCAGCACACUGUGGUUUGU
ENST00000302279 MI0003183 hsa-miR-499-3p AACAUCACAGCAAGUCUGUGCU
ENST00000302279 MI0003183 hsa-miR-499-5p UUAAGACUUGCAGUGAUGUUU
ENST00000302279 MI0003186 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA
ENST00000302279 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENST00000302279 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENST00000302279 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENST00000302279 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENST00000302279 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENST00000302279 MI0003581 hsa-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU
ENST00000302279 MI0003602 hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENST00000302279 MI0003639 hsa-miR-625* GACUAUAGAACUUUCCCCCUCA
ENST00000302279 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENST00000302279 MI0003664 hsa-miR-649 AAACCUGUGUUGUUCAAGAGUC
ENST00000302279 MI0005541 hsa-miR-875-5p UAUACCUCAGUUUUAUCAGGUG
ENST00000302279 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENST00000302279 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENST00000302279 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENST00000302279 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU
ENST00000302279 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENST00000302279 MI0001526 mmu-miR-434-3p UUUGAACCAUCACUCGACUCCU
ENST00000302279 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENST00000302279 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000302279 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000302279 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000302279 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENST00000302279 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENST00000302279 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENST00000302279 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA
ENST00000302279 MI0004682 mmu-miR-698 CAUUCUCGUUUCCUUCCCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Carmustine
  • Carmustine results in decreased expression of FNTA mRNA
  • Carmustine results in increased expression of FNTA mRNA
15980968
perilla alcohol
  • [Vitamin A co-treated with perilla alcohol] results in decreased expression of FNTA protein
15959631
Vitamin A
  • [Vitamin A co-treated with perilla alcohol] results in decreased expression of FNTA protein
15959631
Vitamin K
  • Vitamin K affects the expression of FNTA mRNA
16844298

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Anemia inferred via Vitamin A 16960172
Anemia, Iron-Deficiency inferred via Vitamin A 16960172
Asthma inferred via Vitamin A 16732791
Bronchopulmonary Dysplasia inferred via Vitamin A 17426644, 17377406
Child Nutrition Disorders inferred via Vitamin A 16153327
Cholestasis inferred via Vitamin A 16175620
Cleft Palate inferred via Vitamin A 16054864
Colonic Neoplasms inferred via Vitamin A 17219422, 16267017
Diabetes Mellitus, Type 1 inferred via Vitamin A 16506275
Dry Eye Syndromes inferred via Vitamin A 16146918
Ectromelia inferred via Vitamin A 16054864
Fetal Resorption inferred via Vitamin A 16054864
Heart Defects, Congenital inferred via Vitamin A 16080930
Hernia, Diaphragmatic inferred via Vitamin A 17436238, 16877224, 16490937, 16292552, 16863852
HIV Infections inferred via Vitamin A 16960176
HIV Seropositivity inferred via Vitamin A 17209195
Hypervitaminosis A inferred via Vitamin A 16054864
Limb Deformities, Congenital inferred via Vitamin A 16054864
Liver Cirrhosis inferred via Vitamin A 16256175
Liver Cirrhosis, Experimental inferred via Vitamin A 16248980
Liver Diseases inferred via Vitamin A 16175620
Liver Diseases, Alcoholic inferred via Vitamin A 16762690
Liver Neoplasms, Experimental inferred via Vitamin A 17113696
Lung Diseases inferred via Vitamin A 16863852
Multiple Myeloma inferred via Vitamin A 16374440
Neural Tube Defects inferred via Vitamin A 17400914
Respiratory Distress Syndrome, Newborn inferred via Vitamin A 16877224
Vitamin A Deficiency inferred via Vitamin A 16960172, 16175781, 16146918
Brain Neoplasms inferred via Carmustine 16187019
Glioblastoma inferred via Carmustine 16187019
Melanoma inferred via Carmustine 12393984

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ACVR1 ACVR1 / FNTA Two-hybrid Wang T (1996)
PTP4A2 PTP4A2 / FNTA Affinity Capture-MS Ewing RM (2007)
TGFB1 TGFB1 / FNTA Two-hybrid Wang T (1996)
TGFBR1 TGFBR1 / FNTA Biochemical Activity Kawabata M (1995)
TGFBR1 TGFBR1 / FNTA Reconstituted Complex Kawabata M (1995)
TGFBR1 FNTA / TGFBR1 Two-hybrid Kawabata M (1995)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Zhou J, et al. (2009) "The protein farnesyltransferase regulates HDAC6 activity in a microtubule-dependent manner." J Biol Chem. 284(15):9648-9655. PMID:19228685
  2. [ + ] Ewing RM, et al. (2007) "Large-scale mapping of human protein-protein interactions by mass spectrometry." Mol Syst Biol. 3():89. PMID:17353931
  3. [ + ] Veluthakal R, et al. (2007) "Dominant-negative alpha-subunit of farnesyl- and geranyltransferase inhibits glucose-stimulated, but not KCl-stimulated, insulin secretion in INS 832/13 cells." Diabetes. 56(1):204-210. PMID:17192483
  4. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  5. [ + ] Reid TS, et al. (2004) "Crystallographic analysis of CaaX prenyltransferases complexed with substrates defines rules of protein substrate selectivity." J Mol Biol. 343(2):417-433. PMID:15451670
  6. [ + ] Reid TS, et al. (2004) "Crystal structures of the anticancer clinical candidates R115777 (Tipifarnib) and BMS-214662 complexed with protein farnesyltransferase suggest a mechanism of FTI selectivity." Biochemistry. 43(22):6877-6884. PMID:15170324
  7. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  8. [ + ] deSolms SJ, et al. (2003) "Dual protein farnesyltransferase-geranylgeranyltransferase-I inhibitors as potential cancer chemotherapeutic agents." J Med Chem. 46(14):2973-2984. PMID:12825937
  9. [ + ] Long SB, et al. (2002) "Reaction path of protein farnesyltransferase at atomic resolution." Nature. 419(6907):645-650. PMID:12374986
  10. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  11. [ + ] Bell IM, et al. (2002) "3-Aminopyrrolidinone farnesyltransferase inhibitors: design of macrocyclic compounds with improved pharmacokinetics and excellent cell potency." J Med Chem. 45(12):2388-2409. PMID:12036349
  12. [ + ] Kim KW, et al. (2001) "Inactivation of farnesyltransferase and geranylgeranyltransferase I by caspase-3: cleavage of the common alpha subunit during apoptosis." Oncogene. 20(3):358-366. PMID:11313965
  13. [ + ] Long SB, et al. (2001) "The crystal structure of human protein farnesyltransferase reveals the basis for inhibition by CaaX tetrapeptides and their mimetics." Proc Natl Acad Sci U S A. 98(23):12948-12953. PMID:11687658
  14. [ + ] Guenzi E, et al. (2001) "The helical domain of GBP-1 mediates the inhibition of endothelial cell proliferation by inflammatory cytokines." EMBO J. 20(20):5568-5577. PMID:11598000
  15. [ + ] Ashar HR, et al. (2000) "Farnesyl transferase inhibitors block the farnesylation of CENP-E and CENP-F and alter the association of CENP-E with the microtubules." J Biol Chem. 275(39):30451-30457. PMID:10852915
  16. [ + ] Prakash B, et al. (2000) "Structure of human guanylate-binding protein 1 representing a unique class of GTP-binding proteins." Nature. 403(6769):567-571. PMID:10676968
  17. [ + ] Zeng Q, et al. (2000) "Prenylation-dependent association of protein-tyrosine phosphatases PRL-1, -2, and -3 with the plasma membrane and the early endosome." J Biol Chem. 275(28):21444-21452. PMID:10747914
  18. [ + ] Wang T, et al. (1996) "The p21(RAS) farnesyltransferase alpha subunit in TGF-beta and activin signaling." Science. 271(5252):1120-1122. PMID:8599089
  19. [ + ] Goalstone ML, et al. (1996) "Effect of insulin on farnesyltransferase activity in 3T3-L1 adipocytes." J Biol Chem. 271(44):27585-27589. PMID:8910345
  20. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548
  21. [ + ] Nantais DE, et al. (1996) "Prenylation of an interferon-gamma-induced GTP-binding protein: the human guanylate binding protein, huGBP1." J Leukoc Biol. 60(3):423-431. PMID:8830800
  22. [ + ] Armstrong SA, et al. (1995) "CAAX geranylgeranyl transferase transfers farnesyl as efficiently as geranylgeranyl to RhoB." J Biol Chem. 270(14):7864-7868. PMID:7713879
  23. [ + ] Kawabata M, et al. (1995) "Interaction of the transforming growth factor-beta type I receptor with farnesyl-protein transferase-alpha." J Biol Chem. 270(50):29628-29631. PMID:8530343
  24. [ + ] Sinensky M, et al. (1994) "The processing pathway of prelamin A." J Cell Sci. 107 ( Pt 1)():61-67. PMID:8175923
  25. [ + ] Zhang FL, et al. (1994) "cDNA cloning and expression of rat and human protein geranylgeranyltransferase type-I." J Biol Chem. 269(5):3175-3180. PMID:8106351
  26. [ + ] Omer CA, et al. (1993) "Characterization of recombinant human farnesyl-protein transferase: cloning, expression, farnesyl diphosphate binding, and functional homology with yeast prenyl-protein transferases." Biochemistry. 32(19):5167-5176. PMID:8494894
  27. [ + ] Andres DA, et al. (1993) "Mutational analysis of alpha-subunit of protein farnesyltransferase. Evidence for a catalytic role." J Biol Chem. 268(2):1383-1390. PMID:8419339
  28. [ + ] Andres DA, et al. (1993) "cDNA cloning of the two subunits of human CAAX farnesyltransferase and chromosomal mapping of FNTA and FNTB loci and related sequences." Genomics. 18(1):105-112. PMID:8276393
  29. [ + ] Adamson P, et al. (1992) "Post-translational modifications of p21rho proteins." J Biol Chem. 267(28):20033-20038. PMID:1400319
  30. [ + ] Manne V, et al. (1990) "Identification and preliminary characterization of protein-cysteine farnesyltransferase." Proc Natl Acad Sci U S A. 87(19):7541-7545. PMID:2217184