ACSL6 | GeneID:23305 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 23305 Official Symbol ACSL6
Locus N/A Gene Type protein-coding
Synonyms ACS2; FACL6; FLJ16173; KIAA0837; LACS2; LACS5
Full Name acyl-CoA synthetase long-chain family member 6
Description acyl-CoA synthetase long-chain family member 6
Chromosome 5q31
Also Known As fatty-acid-Coenzyme A ligase, long-chain 6; long fatty acyl-CoA synthetase 2; long-chain acyl-CoA synthetase 6
Summary Long-chain acyl-CoA synthetases (EC 6.2.1.3), such as ACSL6, catalyze the formation of acyl-CoA from fatty acids, ATP, and CoA (Malhotra et al., 1999 [PubMed 10548543]).[supplied by OMIM]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 100939

ID Symbol Protein Species
GeneID:23305 ACSL6 NP_001009185.1 Homo sapiens
GeneID:117243 Acsl6 NP_570095.1 Rattus norvegicus
GeneID:216739 Acsl6 NP_659072.3 Mus musculus
GeneID:416324 ACSL6 XP_414641.2 Gallus gallus
GeneID:474670 ACSL6 XP_849968.1 Canis lupus familiaris
GeneID:506059 ACSL6 NP_001033131.1 Bos taurus
GeneID:566863 wu:fa04h02 XP_001920939.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abgent AP2537b FACL6 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
2 abgent AP2537a FACL6 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
3 acris AP12264PU-N ACSL6 (N-term); antibody Ab
4 acris AP12265PU-N ACSL6 (Center); antibody Ab
5 acris AP01409PU-N ACSL6; antibody Ab
6 scbt ACSL6 ACSL6 Antibody / ACSL6 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACSL6 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACSL6 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005783 Component endoplasmic reticulum
GO:0005789 Component endoplasmic reticulum membrane
GO:0016021 Component integral to membrane
GO:0005792 Component microsome
GO:0005741 Component mitochondrial outer membrane
GO:0005739 Component mitochondrion
GO:0005778 Component peroxisomal membrane
GO:0005777 Component peroxisome
GO:0005886 Component plasma membrane
GO:0005524 Function ATP binding
GO:0016874 Function ligase activity
GO:0004467 Function long-chain-fatty-acid-CoA ligase activity
GO:0000287 Function magnesium ion binding
GO:0000166 Function nucleotide binding
GO:0006637 Process acyl-CoA metabolic process
GO:0006629 Process lipid metabolic process
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001009185  UCSC Browser NP_001009185
2 NM_015256  UCSC Browser NP_056071

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000296869 MI0000474 hsa-miR-134 UGUGACUGGUUGACCAGAGGGG
ENST00000296869 MI0000737 hsa-miR-200a* CAUCUUACCGGACAGUGCUGGA
ENST00000296869 MI0000078 hsa-miR-22* AGUUCUUCAGUGGCAAGCUUUA
ENST00000296869 MI0000087 hsa-miR-29a* ACUGAUUUCUUUUGGUGUUCAG
ENST00000296869 MI0000105 hsa-miR-29b-1* GCUGGUUUCAUAUGGUGGUUUAGA
ENST00000296869 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENST00000296869 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENST00000296869 MI0003644 hsa-miR-630 AGUAUUCUGUACCAGGGAAGGU
ENST00000296869 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENST00000379264 MI0003513 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Dietary Fats
  • Dietary Fats results in increased expression of ACSL6 mRNA
18042831
palm oil
  • palm oil results in increased expression of ACSL6 mRNA
18042831

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Kang H, et al. (2009) "Acyl-CoA synthetase long-chain family member 6 is associated with premature ovarian failure." Fertil Steril. 91(4 Suppl):1339-1343. PMID:18555221
  2. [ + ] Edwards TL, et al. (2008) "Interaction between interleukin 3 and dystrobrevin-binding protein 1 in schizophrenia." Schizophr Res. 106(2-3):208-217. PMID:18804346
  3. [ + ] Luo XJ, et al. (2008) "Association of haplotypes spanning PDZ-GEF2, LOC728637 and ACSL6 with schizophrenia in Han Chinese." J Med Genet. 45(12):818-826. PMID:18718982
  4. [ + ] Ma J, et al. (2007) "Identifying leukocyte gene expression patterns associated with plasma lipid levels in human subjects." Atherosclerosis. 191(1):63-72. PMID:16806233
  5. [ + ] Chowdari KV, et al. (2007) "DNA pooling: a comprehensive, multi-stage association analysis of ACSL6 and SIRT5 polymorphisms in schizophrenia." Genes Brain Behav. 6(3):229-239. PMID:16827919
  6. [ + ] Denoeud F, et al. (2007) "Prominent use of distal 5' transcription start sites and discovery of a large number of additional exons in ENCODE regions." Genome Res. 17(6):746-759. PMID:17567994
  7. [ + ] Murati A, et al. (2006) "t(5;12)(q23-31;p13) with ETV6-ACSL6 gene fusion in polycythemia vera." Leukemia. 20(6):1175-1178. PMID:16572202
  8. [ + ] Soupene E, et al. (2006) "Multiple erythroid isoforms of human long-chain acyl-CoA synthetases are produced by switch of the fatty acid gate domains." BMC Mol Biol. 7():21. PMID:16834775
  9. [ + ] Chen X, et al. (2006) "Haplotypes spanning SPEC2, PDZ-GEF2 and ACSL6 genes are associated with schizophrenia." Hum Mol Genet. 15(22):3329-3342. PMID:17030554
  10. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  11. [ + ] Mashek DG, et al. (2004) "Revised nomenclature for the mammalian long-chain acyl-CoA synthetase gene family." J Lipid Res. 45(10):1958-1961. PMID:15292367
  12. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  13. [ + ] Yagasaki F, et al. (1999) "Fusion of TEL/ETV6 to a novel ACS2 in myelodysplastic syndrome and acute myelogenous leukemia with t(5;12)(q31;p13)." Genes Chromosomes Cancer. 26(3):192-202. PMID:10502316
  14. [ + ] Malhotra KT, et al. (1999) "Identification and molecular characterization of acyl-CoA synthetase in human erythrocytes and erythroid precursors." Biochem J. 344 Pt 1():135-143. PMID:10548543
  15. [ + ] Nagase T, et al. (1998) "Prediction of the coding sequences of unidentified human genes. XII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro." DNA Res. 5(6):355-364. PMID:10048485