5530400C23Rik | GeneID:232426 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 232426 Official Symbol 5530400C23Rik
Locus N/A Gene Type protein-coding
Synonyms GRP
Full Name RIKEN cDNA 5530400C23 gene
Description RIKEN cDNA 5530400C23 gene
Chromosome 6 G1
Also Known As hypothetical protein LOC232426; submandibular gland secretory Glx-rich protein
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 79760

ID Symbol Protein Species
GeneID:232426 5530400C23Rik XP_620373.1 Mus musculus
GeneID:545884 EG545884 XP_132905.2 Mus musculus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab48610 Neuromedin C antibody (ab48610); Rabbit polyclonal to Neuromedin C

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_620373  UCSC Browser XP_620373

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000048459 MI0000579 mmu-miR-31* UGCUAUGCCAACAUAUUGCCAUC
ENSMUST00000048459 MI0000707 mmu-miR-33 GUGCAUUGUAGUUGCAUUGCA
ENSMUST00000048459 MI0001146 mmu-miR-384-3p AUUCCUAGAAAUUGUUCACAAU
ENSMUST00000048459 MI0001161 mmu-miR-410 AAUAUAACACAGAUGGCCUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  2. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  3. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  4. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  5. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  6. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  7. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636