FLT4 | GeneID:2324 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2324 Official Symbol FLT4
Locus N/A Gene Type protein-coding
Synonyms FLT41; LMPH1A; PCL; VEGFR3
Full Name fms-related tyrosine kinase 4
Description fms-related tyrosine kinase 4
Chromosome 5q35.3
Also Known As soluble VEGFR3 variant 1; soluble VEGFR3 variant 2; soluble VEGFR3 variant 3; vascular endothelial growth factor receptor 3
Summary This gene encodes a tyrosine kinase receptor for vascular endothelial growth factors C and D. The protein is thought to be involved in lymphangiogenesis and maintenance of the lymphatic endothelium. Mutations in this gene cause hereditary lymphedema type IA. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 7321

ID Symbol Protein Species
GeneID:2324 FLT4 NP_891555.2 Homo sapiens
GeneID:14257 Flt4 NP_032055.1 Mus musculus
GeneID:30121 flt4 NP_571020.1 Danio rerio
GeneID:114110 Flt4 NP_446104.1 Rattus norvegicus
GeneID:395742 FLT4 XP_414600.2 Gallus gallus
GeneID:462339 FLT4 XP_518160.2 Pan troglodytes
GeneID:481464 FLT4 XP_538585.2 Canis lupus familiaris

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab15295 VEGF Receptor 3 antibody, prediluted (ab15295); Rabbit polyclonal to VEGF Receptor 3, prediluted
2 abcam ab51496 VEGF Receptor 3 antibody [MM0003-7G63] (ab51496); Mouse monoclonal [MM0003-7G63] to VEGF Receptor 3
3 abcam ab10284 VEGF Receptor 3 antibody (ab10284); Rabbit polyclonal to VEGF Receptor 3
4 abcam ab14828 VEGF Receptor 3 antibody (ab14828); Rabbit polyclonal to VEGF Receptor 3
5 abcam ab27278 VEGF Receptor 3 antibody (ab27278); Rabbit polyclonal to VEGF Receptor 3
6 abgent AM7645b VGFR3 Monoclonal Antibody; Purified Mouse Monoclonal Antibody (Mab)
7 abgent AP7645d VGFR3 Antibody; Purified Rabbit Polyclonal Antibody (Pab)
8 abgent AP7645b FLT4 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
9 abgent AP7645a FLT4 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
10 abgent AM7645a VGFR3 Monoclonal Antibody (Ascites); Unpurified Mouse Monoclonal Antibody (Mab)
11 abnova H00002324-M05 FLT4 monoclonal antibody (M05), clone 4D1; Mouse monoclonal antibody raised against a partial recombinant FLT4.
12 abnova H00002324-M06 FLT4 monoclonal antibody (M06), clone 2E3; Mouse monoclonal antibody raised against a partial recombinant FLT4.
13 abnova H00002324-M07 FLT4 monoclonal antibody (M07), clone 1C1; Mouse monoclonal antibody raised against a partial recombinant FLT4.
14 abnova H00002324-M08 FLT4 monoclonal antibody (M08), clone 6B7; Mouse monoclonal antibody raised against a partial recombinant FLT4.
15 abnova H00002324-M01 FLT4 monoclonal antibody (M01), clone 5B6; Mouse monoclonal antibody raised against a partial recombinant FLT4.
16 abnova H00002324-M02 FLT4 monoclonal antibody (M02), clone 5F11; Mouse monoclonal antibody raised against a partial recombinant FLT4.
17 abnova H00002324-M03 FLT4 monoclonal antibody (M03), clone 6F9; Mouse monoclonal antibody raised against a partial recombinant FLT4.
18 abnova H00002324-M04 FLT4 monoclonal antibody (M04), clone 5B5; Mouse monoclonal antibody raised against a partial recombinant FLT4.
19 acris AP14354PU-N VEGFR-3 / Flt-4 (C-term); antibody Ab
20 acris AM11069SU-N VEGFR-3 / Flt-4 Ascites; antibody Ab
21 acris AM11070PU-N VEGFR-3 / Flt-4; antibody Ab
22 acris AP07835PU-N VEGFR-3 / Flt-4; antibody Ab
23 acris AP15558PU-N VEGFR-3 / Flt-4 (C-term); antibody Ab
24 acris DM3512B VEGFR-3 / Flt-4; antibody Ab
25 acris DP3511 VEGFR-3 / Flt-4; antibody Ab
26 acris AP14355PU-N VEGFR-3 / Flt-4; antibody Ab
27 acris AP15558PU-S VEGFR-3 / Flt-4; antibody Ab
28 acris DP135 VEGFR-3 / Flt-4; antibody Ab
29 acris DP3511P VEGFR-3 / Flt-4; antibody Ab
30 acris DP3511S VEGFR-3 / Flt-4; antibody Ab
31 acris DP135-05 VEGFR-3 / Flt-4; antibody Ab
32 acris DM3512P VEGFR-3 / Flt-4; antibody Ab
33 scbt FLT4 FLT4 Antibody / FLT4 Antibodies;
34 sigma V1135 Anti-Vascular Endothelial Growth Factor Receptor-3 antibody produced in goat ;

Exon, Intron and UTRs

Exon, Intron and UTRs of FLT4 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FLT4 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0004872 Function receptor activity
GO:0016740 Function transferase activity
GO:0005021 Function vascular endothelial growth factor receptor activity
GO:0008284 Process positive regulation of cell proliferation
GO:0006468 Process protein amino acid phosphorylation
GO:0048010 Process vascular endothelial growth factor receptor signaling pathway

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_002020  UCSC Browser NP_002011
2 NM_182925  UCSC Browser NP_891555

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000261937 MI0000266 hsa-miR-10a UACCCUGUAGAUCCGAAUUUGUG
ENST00000261937 MI0000267 hsa-miR-10b UACCCUGUAGAACCGAAUUUGUG
ENST00000261937 MI0000267 hsa-miR-10b* ACAGAUUCGAUUCUAGGGGAAU
ENST00000261937 MI0000261 hsa-miR-139-3p GGAGACGCGGCCCUGUUGGAGU
ENST00000261937 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENST00000261937 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENST00000261937 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENST00000261937 MI0000484 hsa-miR-188-5p CAUCCCUUGCAUGGUGGAGGG
ENST00000261937 MI0000737 hsa-miR-200a UAACACUGUCUGGUAACGAUGU
ENST00000261937 MI0000342 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGA
ENST00000261937 MI0000650 hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENST00000261937 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENST00000261937 MI0000804 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENST00000261937 MI0000825 hsa-miR-345 GCUGACUCCUAGUCCAGGGCUC
ENST00000261937 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENST00000261937 MI0001641 hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
ENST00000261937 MI0001721 hsa-miR-431* CAGGUCGUCUUGCAGGGCUUCU
ENST00000261937 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENST00000261937 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000261937 MI0003125 hsa-miR-490-5p CCAUGGAUCUCCAGGUGGGU
ENST00000261937 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000261937 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000261937 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENST00000261937 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENST00000261937 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENST00000261937 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENST00000261937 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENST00000261937 MI0003205 hsa-miR-532-5p CAUGCCUUGAGUGUAGGACCGU
ENST00000261937 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000261937 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000261937 MI0003577 hsa-miR-570 CGAAAACAGCAAUUACCUUUGC
ENST00000261937 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENST00000261937 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENST00000261937 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000261937 MI0003622 hsa-miR-609 AGGGUGUUUCUCUCAUCUCU
ENST00000261937 MI0003623 hsa-miR-610 UGAGCUAAAUGUGUGCUGGGA
ENST00000261937 MI0003628 hsa-miR-615-3p UCCGAGCCUGGGUCUCCCUCUU
ENST00000261937 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENST00000261937 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENST00000261937 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENST00000261937 MI0003669 hsa-miR-661 UGCCUGGGUCUCUGGCCUGCGCGU
ENST00000261937 MI0005543 hsa-miR-708* CAACUAGACUGUGAGCUUCUAG
ENST00000261937 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENST00000261937 MI0003834 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU
ENST00000261937 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENST00000261937 MI0005527 hsa-miR-886-5p CGGGUCGGAGUUAGCUCAAGCGG
ENST00000261937 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENST00000261937 MI0000391 mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU
ENST00000261937 MI0005494 mmu-miR-343 UCUCCCUUCAUGUGCCCAGA
ENST00000261937 MI0004601 mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC
ENST00000261937 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC
ENST00000261937 MI0005474 mmu-miR-881 AACUGUGUCUUUUCUGAAUAGA
ENST00000261937 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.3029C>T1
c.1500C>G1
c.1132C>T1
Primary Site / Histology (Top 10)Mutations (sites * observations)
skin / malignant melanoma1
kidney / carcinoma1
ovary / carcinoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of FLT4 mRNA
16644059

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
HEMANGIOMA, CAPILLARY INFANTILE marker
LYMPHEDEMA, HEREDITARY, IA marker
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 15700767, 16124888, 16227642, 10355542, 16050911, 15673190, 16097048, 16011737
Fatty Liver inferred via Carbon Tetrachloride 16045604, 12795759, 61145, 12631006, 17595544, 15959796, 16239168
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 16177239, 15998439, 11566570, 16227642, 15027814, 15968718
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 17334410, 16239168
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 18156304, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 16638106, 18395095, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 17976157, 15925388, 17525996, 17805973, 17557913, 16248980, 16116963
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15720792, 16964402, 15830285, 17285989
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
GRB2 FLT4 / GRB2 Reconstituted Complex Pajusola K (1994)
ITGB1 FLT4 / ITGB1 Affinity Capture-Western Wang JF (2001)
SHC1 FLT4 / SHC1 Affinity Capture-Western Fournier E (1996)
SHC1 SHC1 / FLT4 Affinity Capture-Western Fournier E (1999)
SHC1 FLT4 / SHC1 Affinity Capture-Western Pajusola K (1994)
SHC1 FLT4 / SHC1 Reconstituted Complex Fournier E (1996)
SHC1 FLT4 / SHC1 Reconstituted Complex Pajusola K (1994)
VEGFC FLT4 / VEGFC Affinity Capture-Western Lee J (1996)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Jia JB, et al. (2009) "Protein expression profiling of vascular endothelial growth factor and its receptors identifies subclasses of hepatocellular carcinoma and predicts survival." J Cancer Res Clin Oncol. 135(6):847-854. PMID:19066962
  2. [ + ] Poyer F, et al. (2009) "Secretion of MMP-2 and MMP-9 induced by VEGF autocrine loop correlates with clinical features in childhood acute lymphoblastic leukemia." Leuk Res. 33(3):407-417. PMID:18829111
  3. [ + ] Verstraeten VL, et al. (2009) "Functional analysis of FLT4 mutations associated with Nonne-Milroy lymphedema." J Invest Dermatol. 129(2):509-512. PMID:18719607
  4. [ + ] Goodyear SM, et al. (2009) "Role of the VEGFR3/VEGFD receptor axis in TGFbeta1 activation of primary prostate cell lines." Prostate. 69(9):982-990. PMID:19301310
  5. [ + ] Bogos K, et al. (2009) "High VEGFR-3-positive circulating lymphatic/vascular endothelial progenitor cell level is associated with poor prognosis in human small cell lung cancer." Clin Cancer Res. 15(5):1741-1746. PMID:19240177
  6. [ + ] Ma GC, et al. (2008) "A recurrent ITGA9 missense mutation in human fetuses with severe chylothorax: possible correlation with poor response to fetal therapy." Prenat Diagn. 28(11):1057-1063. PMID:18973153
  7. [ + ] Liersch R, et al. (2008) "Expression of VEGF-C and its receptor VEGFR-3 in the bone marrow of patients with acute myeloid leukaemia." Leuk Res. 32(6):954-961. PMID:18006056
  8. [ + ] Han IB, et al. (2008) "The role of genetic factors in the development of hemifacial spasm: preliminary results." Acta Neurochir Suppl. 101():107-110. PMID:18642643
  9. [ + ] Sokolov DI, et al. (2008) "Expression of VEGF and VEGF-R3 receptor by placental endothelial cells in health and gestosis." Bull Exp Biol Med. 145(3):348-351. PMID:19039941
  10. [ + ] Tammela T, et al. (2008) "Blocking VEGFR-3 suppresses angiogenic sprouting and vascular network formation." Nature. 454(7204):656-660. PMID:18594512
  11. [ + ] Connell FC, et al. (2008) "Analysis of the coding regions of VEGFR3 and VEGFC in Milroy disease and other primary lymphoedemas." Hum Genet. ():. PMID:19002718
  12. [ + ] Jin P, et al. (2008) "Novel splice variants derived from the receptor tyrosine kinase superfamily are potential therapeutics for rheumatoid arthritis." Arthritis Res Ther. 10(4):R73. PMID:18593464
  13. [ + ] Finegold DN, et al. (2008) "HGF and MET mutations in primary and secondary lymphedema." Lymphat Res Biol. 6(2):65-68. PMID:18564920
  14. [ + ] Liu B, et al. (2008) "Lymphangiogenesis and its relationship with lymphatic metastasis and prognosis in malignant melanoma." Anat Rec (Hoboken). 291(10):1227-1235. PMID:18561194
  15. [ + ] Su JL, et al. (2008) "Further evidence for expression and function of the VEGF-C/VEGFR-3 axis in cancer cells." Cancer Cell. 13(6):557-560. PMID:18538739
  16. [ + ] Petrova TV, et al. (2008) "VEGFR-3 expression is restricted to blood and lymphatic vessels in solid tumors." Cancer Cell. 13(6):554-556. PMID:18538738
  17. [ + ] Park HR, et al. (2008) "Expression of vascular endothelial growth factor-C and its receptor in osteosarcomas." Pathol Res Pract. 204(8):575-582. PMID:18440723
  18. [ + ] Simiantonaki N, et al. (2008) "Hypoxia-induced epithelial VEGF-C/VEGFR-3 upregulation in carcinoma cell lines." Int J Oncol. 32(3):585-592. PMID:18292935
  19. [ + ] Futatani T, et al. (2008) "Molecular characterization of two novel VEGFR3 mutations in Japanese families with Milroy's disease." Pediatr Int. 50(1):116-118. PMID:18279219
  20. [ + ] Parsons A, et al. (2008) "Retiform hemangioendotheliomas usually do not express D2-40 and VEGFR-3." Am J Dermatopathol. 30(1):31-33. PMID:18212541
  21. [ + ] Lee JH, et al. (2008) "Single-nucleotide polymorphisms and haplotypes in the VEGF receptor 3 gene and the haplotype GC in the VEGFA gene are associated with psoriasis in Koreans." J Invest Dermatol. 128(6):1599-1603. PMID:18094729
  22. [ + ] Mints M, et al. (2007) "Expression of vascular endothelial growth factor receptor-3 in the endometrium in menorrhagia." Int J Mol Med. 19(6):909-913. PMID:17487423
  23. [ + ] Filho AL, et al. (2007) "Immunohistochemical expression and distribution of VEGFR-3 in malignant mesothelioma." Diagn Cytopathol. 35(12):786-791. PMID:18008346
  24. [ + ] Shawber CJ, et al. (2007) "Notch alters VEGF responsiveness in human and murine endothelial cells by direct regulation of VEGFR-3 expression." J Clin Invest. 117(11):3369-3382. PMID:17948123
  25. [ + ] Yu Z, et al. (2007) "Identification of a novel VEGFR-3 missense mutation in a Chinese family with hereditary lymphedema type I." J Genet Genomics. 34(10):861-867. PMID:17945164
  26. [ + ] Breslin JW, et al. (2007) "VEGF-C alters barrier function of cultured lymphatic endothelial cells through a VEGFR-3-dependent mechanism." Lymphat Res Biol. 5(2):105-113. PMID:17935478
  27. [ + ] Pazgal I, et al. (2007) "Expression of VEGF-C, VEGF-D and their receptor VEGFR-3 in diffuse large B-cell lymphomas." Leuk Lymphoma. 48(11):2213-2220. PMID:17926187
  28. [ + ] Kilic N, et al. (2007) "Lymphatic reprogramming of microvascular endothelial cells by CEA-related cell adhesion molecule-1 via interaction with VEGFR-3 and Prox1." Blood. 110(13):4223-4233. PMID:17761831
  29. [ + ] Saintigny P, et al. (2007) "Vascular endothelial growth factor-C and its receptor VEGFR-3 in non-small-cell lung cancer: concurrent expression in cancer cells from primary tumour and metastatic lymph node." Lung Cancer. 58(2):205-213. PMID:17686546
  30. [ + ] Whitehurst B, et al. (2007) "Anti-VEGF-A therapy reduces lymphatic vessel density and expression of VEGFR-3 in an orthotopic breast tumor model." Int J Cancer. 121(10):2181-2191. PMID:17597103
  31. [ + ] Lian Z, et al. (2007) "Hepatitis B x antigen up-regulates vascular endothelial growth factor receptor 3 in hepatocarcinogenesis." Hepatology. 45(6):1390-1399. PMID:17539024
  32. [ + ] Butler MG, et al. (2007) "A novel VEGFR3 mutation causes Milroy disease." Am J Med Genet A. 143A(11):1212-1217. PMID:17458866
  33. [ + ] Schneider M, et al. (2006) "Role of lymphangiogenesis and lymphangiogenic factors during pancreatic cancer progression and lymphatic spread." Int J Oncol. 28(4):883-890. PMID:16525637
  34. [ + ] Takizawa H, et al. (2006) "The balance of VEGF-C and VEGFR-3 mRNA is a predictor of lymph node metastasis in non-small cell lung cancer." Br J Cancer. 95(1):75-79. PMID:16755294
  35. [ + ] Mirshahi P, et al. (2006) "Malignant hematopoietic cells induce an increased expression of VEGFR-1 and VEGFR-3 on bone marrow endothelial cells via AKT and mTOR signalling pathways." Biochem Biophys Res Commun. 349(3):1003-1010. PMID:16959214
  36. [ + ] Man XY, et al. (2006) "Immunolocalization and expression of vascular endothelial growth factor receptors (VEGFRs) and neuropilins (NRPs) on keratinocytes in human epidermis." Mol Med. 12(7-8):127-136. PMID:17088944
  37. [ + ] Debrah AY, et al. (2006) "Doxycycline reduces plasma VEGF-C/sVEGFR-3 and improves pathology in lymphatic filariasis." PLoS Pathog. 2(9):e92. PMID:17044733
  38. [ + ] Orlandini M, et al. (2006) "Vascular endothelial growth factor-D activates VEGFR-3 expressed in osteoblasts inducing their differentiation." J Biol Chem. 281(26):17961-17967. PMID:16624815
  39. [ + ] Su JL, et al. (2006) "The VEGF-C/Flt-4 axis promotes invasion and metastasis of cancer cells." Cancer Cell. 9(3):209-223. PMID:16530705
  40. [ + ] Kojima H, et al. (2005) "Clinical significance of vascular endothelial growth factor-C and vascular endothelial growth factor receptor 3 in patients with T1 lung adenocarcinoma." Cancer. 104(8):1668-1677. PMID:16116610
  41. [ + ] Zhang X, et al. (2005) "Extracellular matrix regulates endothelial functions through interaction of VEGFR-3 and integrin alpha5beta1." J Cell Physiol. 202(1):205-214. PMID:15389531
  42. [ + ] Tammela T, et al. (2005) "Angiopoietin-1 promotes lymphatic sprouting and hyperplasia." Blood. 105(12):4642-4648. PMID:15746084
  43. [ + ] Zhang X, et al. (2005) "Kaposi's sarcoma-associated herpesvirus activation of vascular endothelial growth factor receptor 3 alters endothelial function and enhances infection." J Biol Chem. 280(28):26216-26224. PMID:15878864
  44. [ + ] Jennbacken K, et al. (2005) "Expression of vascular endothelial growth factor C (VEGF-C) and VEGF receptor-3 in human prostate cancer is associated with regional lymph node metastasis." Prostate. 65(2):110-116. PMID:15880525
  45. [ + ] Liu T, et al. (2005) "Human plasma N-glycoproteome analysis by immunoaffinity subtraction, hydrazide chemistry, and mass spectrometry." J Proteome Res. 4(6):2070-2080. PMID:16335952
  46. [ + ] Fink AM, et al. (2004) "Serum level of VEGF-D in patients with primary lymphedema." Lymphology. 37(4):185-189. PMID:15693535
  47. [ + ] Zeng Y, et al. (2004) "Expression of vascular endothelial growth factor receptor-3 by lymphatic endothelial cells is associated with lymph node metastasis in prostate cancer." Clin Cancer Res. 10(15):5137-5144. PMID:15297417
  48. [ + ] Stearns ME, et al. (2004) "Expression of a flt-4 (VEGFR3) splicing variant in primary human prostate tumors. VEGF D and flt-4t(Delta773-1081) overexpression is diagnostic for sentinel lymph node metastasis." Lab Invest. 84(6):785-795. PMID:15107801
  49. [ + ] Wang JF, et al. (2004) "Activation of vascular endothelial growth factor receptor-3 and its downstream signaling promote cell survival under oxidative stress." J Biol Chem. 279(26):27088-27097. PMID:15102829
  50. [ + ] Liu XE, et al. (2004) "Expression and significance of VEGF-C and FLT-4 in gastric cancer." World J Gastroenterol. 10(3):352-355. PMID:14760756