SIK2 | GeneID:23235 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 23235 Official Symbol SIK2
Locus N/A Gene Type protein-coding
Synonyms DKFZp434K1115; KIAA0781; LOH11CR1I; QIK; SNF1LK2
Full Name salt-inducible kinase 2
Description salt-inducible kinase 2
Chromosome 11q23.1
Also Known As SNF1-like kinase 2; salt-inducible serine/threonine kinase 2
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22875

ID Symbol Protein Species
GeneID:23235 SNF1LK2 NP_056006.1 Homo sapiens
GeneID:235344 Snf1lk2 NP_848825.2 Mus musculus
GeneID:451540 SNF1LK2 XP_508750.2 Pan troglodytes
GeneID:489410 SNF1LK2 XP_546528.2 Canis lupus familiaris
GeneID:539570 SNF1LK2 XP_588111.3 Bos taurus
GeneID:567919 snf1lk2b XP_696325.3 Danio rerio
GeneID:768557 SNF1LK2 XP_001231564.1 Gallus gallus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab53423 Snf1lk2 antibody (ab53423); Rabbit polyclonal to Snf1lk2
2 abcam ab57399 Snf1lk2 antibody (ab57399); Mouse monoclonal to Snf1lk2
3 abnova H00023235-M01 SNF1LK2 monoclonal antibody (M01), clone 4H6; Mouse monoclonal antibody raised against a partial recombinant SNF1LK2.
4 abnova H00023235-M03 SNF1LK2 monoclonal antibody (M03), clone 4C6; Mouse monoclonal antibody raised against a partial recombinant SNF1LK2.
5 acris AP08469PU-N SNF1LK2 / SIK2 (aa 100-150); antibody Ab
6 acris AM08328PU-N SIK2; antibody Ab
7 scbt SNF1LK2 SNF1LK2 Antibody / SNF1LK2 Antibodies;
8 sigma HPA016026 Anti-SNF1LK2 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of SIK2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of SIK2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005634 Component nucleus
GO:0005524 Function ATP binding
GO:0000287 Function magnesium ion binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0004674 Function protein serine/threonine kinase activity
GO:0016740 Function transferase activity
GO:0006468 Process protein amino acid phosphorylation
GO:0007243 Process protein kinase cascade
GO:0046626 Process regulation of insulin receptor signaling pathway

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_015191  UCSC Browser NP_056006 Q9H0K1   B0YJ94  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000304987 MI0000472 hsa-miR-127-3p UCGGAUCCGUCUGAGCUUGGCU
ENST00000304987 MI0000242 hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENST00000304987 MI0000281 hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENST00000304987 MI0000294 hsa-miR-218 UUGUGCUUGAUCUAACCAUGU
ENST00000304987 MI0000295 hsa-miR-218 UUGUGCUUGAUCUAACCAUGU
ENST00000304987 MI0002464 hsa-miR-412 ACUUCACCUGGUCCACUAGCCGU
ENST00000304987 MI0005543 hsa-miR-708 AAGGAGCUUACAAUCUAGCUGGG
ENST00000304987 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Dietary Fats
  • Dietary Fats results in decreased expression of SNF1LK2 mRNA
18042831
palm oil
  • palm oil results in decreased expression of SNF1LK2 mRNA
18042831

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Lizcano JM, et al. (2004) "LKB1 is a master kinase that activates 13 kinases of the AMPK subfamily, including MARK/PAR-1." EMBO J. 23(4):833-843. PMID:14976552
  2. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Screaton RA, et al. (2004) "The CREB coactivator TORC2 functions as a calcium- and cAMP-sensitive coincidence detector." Cell. 119(1):61-74. PMID:15454081
  5. [ + ] Katoh M, et al. (2004) "Identification and characterization of human FOXN5 and rat Foxn5 genes in silico." Int J Oncol. 24(5):1339-1344. PMID:15067358
  6. [ + ] Katoh Y, et al. (2004) "Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm." Eur J Biochem. 271(21):4307-4319. PMID:15511237
  7. [ + ] Katoh M, et al. (2003) "Identification and characterization of human KIAA1391 and mouse Kiaa1391 genes encoding novel RhoGAP family proteins with RA domain and ANXL repeats." Int J Oncol. 23(5):1471-1476. PMID:14532992
  8. [ + ] Horike N, et al. (2003) "Adipose-specific expression, phosphorylation of Ser794 in insulin receptor substrate-1, and activation in diabetic animals of salt-inducible kinase-2." J Biol Chem. 278(20):18440-18447. PMID:12624099
  9. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  10. [ + ] Nakajima D, et al. (2002) "Construction of expression-ready cDNA clones for KIAA genes: manual curation of 330 KIAA cDNA clones." DNA Res. 9(3):99-106. PMID:12168954
  11. [ + ] Wiemann S, et al. (2001) "Toward a catalog of human genes and proteins: sequencing and analysis of 500 novel complete protein coding human cDNAs." Genome Res. 11(3):422-435. PMID:11230166
  12. [ + ] Nagase T, et al. (1998) "Prediction of the coding sequences of unidentified human genes. XI. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro." DNA Res. 5(5):277-286. PMID:9872452
  13. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548