FLT1 | GeneID:2321 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2321 Official Symbol FLT1
Locus N/A Gene Type protein-coding
Synonyms FLT; VEGFR1
Full Name fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)
Description fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)
Chromosome 13q12
Also Known As fms-related tyrosine kinase 1; vascular endothelial growth factor receptor 1
Summary This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 20463

ID Symbol Protein Species
GeneID:2321 FLT1 NP_002010.2 Homo sapiens
GeneID:14254 Flt1 NP_034358.2 Mus musculus
GeneID:54251 Flt1 NP_062179.1 Rattus norvegicus
GeneID:173049 W04G5.10 NP_492969.1 Caenorhabditis elegans
GeneID:173050 kin-23 NP_492970.1 Caenorhabditis elegans
GeneID:174498 kin-15 NP_741035.1 Caenorhabditis elegans
GeneID:174499 kin-16 NP_496017.1 Caenorhabditis elegans
GeneID:174501 R09D1.12 NP_496025.1 Caenorhabditis elegans
GeneID:175182 ver-1 NP_497162.2 Caenorhabditis elegans
GeneID:180021 T01G5.1 NP_506728.1 Caenorhabditis elegans
GeneID:180032 kin-30 NP_506771.2 Caenorhabditis elegans
GeneID:181289 ver-3 NP_509836.1 Caenorhabditis elegans
GeneID:182433 C08H9.8 NP_496124.2 Caenorhabditis elegans
GeneID:186632 ver-4 NP_509835.1 Caenorhabditis elegans
GeneID:187740 R09D1.13 NP_496022.1 Caenorhabditis elegans
GeneID:191737 old-1 NP_496130.1 Caenorhabditis elegans
GeneID:191738 old-2 NP_496123.1 Caenorhabditis elegans
GeneID:374100 FLT1 NP_989583.1 Gallus gallus
GeneID:403727 FLT1 XP_534520.2 Canis lupus familiaris
GeneID:452512 FLT1 XP_509605.2 Pan troglodytes
GeneID:503620 FLT1 XP_001249769.1 Bos taurus
GeneID:544667 flt1 NP_001014829.2 Danio rerio
GeneID:3565593 Y50D4B.6 NP_503375.2 Caenorhabditis elegans

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab17544 VEGF Receptor 1 antibody (ab17544); Rabbit polyclonal to VEGF Receptor 1
2 abcam ab2350 VEGF Receptor 1 antibody (ab2350); Rabbit polyclonal to VEGF Receptor 1
3 abcam ab9545 VEGF Receptor 1 antibody (ab9545); Rabbit polyclonal to VEGF Receptor 1
4 abcam ab66184 VEGF Receptor 1 antibody [FLT-11] (ab66184); Mouse monoclonal [FLT-11] to VEGF Receptor 1
5 abcam ab9541 VEGF Receptor 1 antibody [Flt-1/EIC] (ab9541); Mouse monoclonal [Flt-1/EIC] to VEGF Receptor 1
6 abcam ab9540 VEGF Receptor 1 antibody [Flt-1/EWC] (ab9540); Mouse monoclonal [Flt-1/EWC] to VEGF Receptor 1
7 abcam ab11934 VEGF Receptor 1 antibody [Flt-1/EWF] (ab11934); Mouse monoclonal [Flt-1/EWF] to VEGF Receptor 1
8 abcam ab15294 VEGF Receptor 1 antibody, prediluted (ab15294); Rabbit polyclonal to VEGF Receptor 1, prediluted
9 abcam ab36844 VEGFR 1 / VEGFR 2 antibody (ab36844); Rabbit polyclonal to VEGFR 1 / VEGFR 2
10 abcam ab33025 VEGF Receptor 1 antibody (ab33025); Chicken polyclonal to VEGF Receptor 1
11 abcam ab32152 VEGF Receptor 1 antibody [Y103] (ab32152); Rabbit monoclonal [Y103] to VEGF Receptor 1
12 abcam ab62183 VEGF Receptor 1 (phospho Y1333) antibody (ab62183); Rabbit polyclonal to VEGF Receptor 1 (phospho Y1333)
13 abcam ab59277 VEGF Receptor 1 antibody (ab59277); Rabbit polyclonal to VEGF Receptor 1
14 abcam ab56300 VEGF Receptor 1 antibody [AP-MAB0702] (ab56300); Mouse monoclonal [AP-MAB0702] to VEGF Receptor 1
15 abgent AP7642a FLT1 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
16 abgent AP7642b FLT1 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
17 abnova H00002321-M01 FLT1 monoclonal antibody (M01), clone 4H5; Mouse monoclonal antibody raised against a partial recombinant FLT1.
18 acris AP07105PU-N VEGFR-1 / Flt-1 (C-term); antibody Ab
19 acris DP077 VEGFR-1 / Flt-1; antibody Ab
20 acris AP06592PU-N VEGFR-1 / Flt-1; antibody Ab
21 acris AP14349PU-N VEGFR-1 / Flt-1 (C-term); antibody Ab
22 acris DM3506B VEGFR-1 / Flt-1; antibody Ab
23 acris DM3504 VEGFR-1 / Flt-1; antibody Ab
24 acris AP00464PU-N VEGFR-1 / Flt-1 (N-term); antibody Ab
25 acris DM3507 VEGFR-1 / Flt-1; antibody Ab
26 acris DP3510S VEGFR-1 / Flt-1; antibody Ab
27 acris AP15557PU-N VEGFR-1 / Flt-1 (C-term); antibody Ab
28 acris AP15557PU-S VEGFR-1 / Flt-1 (C-term); antibody Ab
29 acris DM3506 VEGFR-1 / Flt-1; antibody Ab
30 acris DM3506BX VEGFR-1 / Flt-1; antibody Ab
31 acris AM05663SU-N VEGFR-1 / Flt-1; antibody Ab
32 acris DM3504B VEGFR-1 / Flt-1; antibody Ab
33 acris DM3504BX VEGFR-1 / Flt-1; antibody Ab
34 acris DM3505 VEGFR-1 / Flt-1; antibody Ab
35 acris DP3510 VEGFR-1 / Flt-1; antibody Ab
36 acris AP14348PU-N VEGFR-1 / Flt-1 (N-term); antibody Ab
37 acris DP3522 VEGFR-1 / Flt-1 (Peptide); antibody Ab
38 acris AP01883PU-N VEGFR-1 / Flt-1 pTyr1333; antibody Ab
39 acris DP077-05 VEGFR-1 / Flt-1; antibody Ab
40 acris DP3522S VEGFR-1 / Flt-1 (Peptide); antibody Ab
41 scbt FLT1 FLT1 Antibody / FLT1 Antibodies;
42 sigma V4262 Monoclonal Anti-Vascular Endothelial Growth Factor Receptor-1 antibody produced in mouse ;
43 sigma V4762 Monoclonal Anti-Vascular Endothelial Growth Factor Receptor-1 antibody produced in mouse ;

Exon, Intron and UTRs

Exon, Intron and UTRs of FLT1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FLT1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005576 Component extracellular region
GO:0005615 Component extracellular space
GO:0005887 Component integral to plasma membrane
GO:0005886 Component plasma membrane
GO:0005524 Function ATP binding
GO:0019838 Function growth factor binding
GO:0042802 Function identical protein binding
GO:0000166 Function nucleotide binding
GO:0004872 Function receptor activity
GO:0016740 Function transferase activity
GO:0005021 Function vascular endothelial growth factor receptor activity
GO:0030154 Process cell differentiation
GO:0016477 Process cell migration
GO:0007565 Process female pregnancy
GO:0007275 Process multicellular organismal development
GO:0001569 Process patterning of blood vessels
GO:0008284 Process positive regulation of cell proliferation
GO:0030949 Process positive regulation of vascular endothelial growth factor receptor signaling pathway
GO:0006468 Process protein amino acid phosphorylation
GO:0007169 Process transmembrane receptor protein tyrosine kinase signaling pathway

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001160030  UCSC Browser NP_001153502
2 NM_001160031  UCSC Browser NP_001153503
3 NM_002019  UCSC Browser NP_002010 B0LPF1   P17948  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000282397 MI0000458 hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
ENST00000282397 MI0000809 hsa-miR-151-5p UCGAGGAGCUCACAGUCUAGU
ENST00000282397 MI0000737 hsa-miR-200a* CAUCUUACCGGACAGUGCUGGA
ENST00000282397 MI0000342 hsa-miR-200b* CAUCUUACUGGGCAGCAUUGGA
ENST00000282397 MI0000296 hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG
ENST00000282397 MI0000776 hsa-miR-376c AACAUAGAGGAAAUUCCACGU
ENST00000282397 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENST00000282397 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENST00000282397 MI0000263 hsa-miR-7-1* CAACAAAUCACAGUCUGCCAUA
ENST00000282397 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENST00000282397 MI0004700 mmu-miR-715 CUCCGUGCACACCCCCGCGUG
ENST00000282397 MI0004704 mmu-miR-717 CUCAGACAGAGAUACCUUCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.2580G>T1
c.2022C>A1
c.3181C>G1
c.1264C>A1
c.2342G>A1
Primary Site / Histology (Top 10)Mutations (sites * observations)
lung / carcinoma2
urinary tract / carcinoma1
breast / carcinoma1
central nervous system / glioma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
3-(5-methyl-2-(2-oxo-1,2-dihydroindol-3-ylidenemethyl)-1H-pyrrol-3-yl)propionic acid
  • 3-(5-methyl-2-(2-oxo-1,2-dihydroindol-3-ylidenemethyl)-1H-pyrrol-3-yl)propionic acid results in decreased activity of FLT1 protein
12766257
6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid
  • 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid results in decreased expression of FLT1 protein
17992120
Acetaminophen
  • Acetaminophen affects the expression of FLT1 mRNA
17562736
Acetylcysteine
  • Acetylcysteine results in increased expression of FLT1 protein
17992120
arsenic trioxide
  • arsenic trioxide results in increased expression of FLT1 mRNA
15073043
Cloprostenol
  • Cloprostenol results in decreased expression of FLT1 mRNA
14991729
Corticosterone
  • Corticosterone results in increased expression of FLT1 mRNA
15755911
epigallocatechin gallate
  • epigallocatechin gallate does not affect the expression of FLT1 protein
17992120
Estradiol
  • Estradiol does not affect the expression of FLT1 mRNA
15367264
Flavonoids
  • Flavonoids results in decreased expression of FLT1 mRNA
18035473
Furosemide
  • Furosemide results in increased expression of FLT1 mRNA
16526316
Phenobarbital
  • Phenobarbital results in increased expression of FLT1 mRNA
12832660
Progesterone
  • Progesterone affects the expression of FLT1 mRNA
17251523
resveratrol
  • resveratrol results in decreased expression of FLT1 protein
17992120
sodium arsenite
  • sodium arsenite results in decreased expression of FLT1 mRNA
12634122
Vitamin A
  • Vitamin A results in decreased expression of FLT1 mRNA
17426644
Zinc
  • Zinc results in increased expression of FLT1 mRNA
17074742
Zinc Sulfate
  • Zinc Sulfate results in increased expression of FLT1 mRNA
17074742

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Carcinoma, Renal Cell therapeutic 16596207
Hepatolenticular Degeneration inferred via Zinc Sulfate 17063115
Acrodermatitis inferred via Zinc 17190629, 16889938, 17202136
Alzheimer Disease inferred via Zinc 17119284, 16325427, 16580781, 16410023
Anemia, Sickle Cell inferred via Zinc 16916123
Asthma inferred via Zinc 17085522
Brain Injuries inferred via Zinc 17109824
Carcinoma, Squamous Cell inferred via Zinc 16543248
Cardiovascular Diseases inferred via Zinc 16936243
Diabetes Mellitus inferred via Zinc 16479319
Esophageal Neoplasms inferred via Zinc 16543248
Gastritis inferred via Zinc 17241300
Growth Disorders inferred via Zinc 17217573
Heart Failure inferred via Zinc 17162251
Heart Injuries inferred via Zinc 17074742
Helicobacter Infections inferred via Zinc 17241300
Hepatolenticular Degeneration inferred via Zinc 17276780
Ischemia inferred via Zinc 16584753
Kidney Diseases inferred via Zinc 16960431
Kidney Failure, Chronic inferred via Zinc 16518626
Mammary Neoplasms, Experimental inferred via Zinc 12773700
Pre-Eclampsia inferred via Zinc 17114810
Prostatic Neoplasms inferred via Zinc 12429649, 16700911, 16606632, 16517595
Retinal Degeneration inferred via Zinc 16584753
Tongue Neoplasms inferred via Zinc 16543248
Anemia inferred via Vitamin A 16960172
Anemia, Iron-Deficiency inferred via Vitamin A 16960172
Asthma inferred via Vitamin A 16732791
Bronchopulmonary Dysplasia inferred via Vitamin A 17426644, 17377406
Child Nutrition Disorders inferred via Vitamin A 16153327
Cholestasis inferred via Vitamin A 16175620
Cleft Palate inferred via Vitamin A 16054864
Colonic Neoplasms inferred via Vitamin A 17219422, 16267017
Diabetes Mellitus, Type 1 inferred via Vitamin A 16506275
Dry Eye Syndromes inferred via Vitamin A 16146918
Ectromelia inferred via Vitamin A 16054864
Fetal Resorption inferred via Vitamin A 16054864
Heart Defects, Congenital inferred via Vitamin A 16080930
Hernia, Diaphragmatic inferred via Vitamin A 17436238, 16877224, 16292552, 16863852, 16490937
HIV Infections inferred via Vitamin A 16960176
HIV Seropositivity inferred via Vitamin A 17209195
Hypervitaminosis A inferred via Vitamin A 16054864
Limb Deformities, Congenital inferred via Vitamin A 16054864
Liver Cirrhosis inferred via Vitamin A 16256175
Liver Cirrhosis, Experimental inferred via Vitamin A 16248980
Liver Diseases inferred via Vitamin A 16175620
Liver Diseases, Alcoholic inferred via Vitamin A 16762690
Liver Neoplasms, Experimental inferred via Vitamin A 17113696
Lung Diseases inferred via Vitamin A 16863852
Multiple Myeloma inferred via Vitamin A 16374440
Neural Tube Defects inferred via Vitamin A 17400914
Respiratory Distress Syndrome, Newborn inferred via Vitamin A 16877224
Vitamin A Deficiency inferred via Vitamin A 16960172, 16175781, 16146918
Adrenal Gland Neoplasms inferred via sodium arsenite 15276417
Adrenocortical Adenoma inferred via sodium arsenite 16712894
Carcinoma, Hepatocellular inferred via sodium arsenite 15276417, 16507464
Carcinoma, Squamous Cell inferred via sodium arsenite 18572023
Genital Neoplasms, Female inferred via sodium arsenite 16452187
Hodgkin Disease inferred via sodium arsenite 12676792
Liver Neoplasms inferred via sodium arsenite 15276417, 16712894
Lung Neoplasms inferred via sodium arsenite 15276417, 16712894, 17077188
Melanoma inferred via sodium arsenite 16487513
Neoplasms inferred via sodium arsenite 11559025
Neural Tube Defects inferred via sodium arsenite 12854658
Ovarian Neoplasms inferred via sodium arsenite 15276417
Prostatic Neoplasms inferred via sodium arsenite 16039940
Skin Neoplasms inferred via sodium arsenite 18572023
Spinal Dysraphism inferred via sodium arsenite 12854658
Urinary Bladder Neoplasms inferred via sodium arsenite 11723127, 16712894, 16452187
Uterine Cervical Neoplasms inferred via sodium arsenite 11813266
Vascular Diseases inferred via sodium arsenite 17056641
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 17534123, 16393696
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 17935668, 17049120, 16490592, 16267019, 17164350
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 16525036, 16317513, 16456233, 17015251, 17125593
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 15767336, 16731767, 17718901, 17636462, 17804756
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 17520802, 16317513, 15827377, 16314181
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15380490, 15845082
Breast Neoplasms inferred via Progesterone 17614352, 15562024, 16175315
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Dystonia inferred via Phenobarbital 1851702
Epilepsy, Absence inferred via Phenobarbital 6401628
Liver Neoplasms inferred via Phenobarbital 15975961, 8742319
Myoclonic Epilepsies, Progressive inferred via Phenobarbital 17484760
Osteomalacia inferred via Phenobarbital 17016548
Pancreatic Neoplasms inferred via Phenobarbital 16965848
Pseudolymphoma inferred via Phenobarbital 12752131
Seizures, Febrile inferred via Phenobarbital 6407741
Dyspnea inferred via Furosemide 16935035
Edema inferred via Furosemide 11834646
Heart Failure inferred via Furosemide 16011733, 16845234, 12660669
Hypercalcemia inferred via Furosemide 17652376
Hypercalciuria inferred via Furosemide 17652376
Hyperparathyroidism, Secondary inferred via Furosemide 15086907
Hypertension, Pregnancy-Induced inferred via Furosemide 16612254
Hypoproteinemia inferred via Furosemide 16096441
Nephrocalcinosis inferred via Furosemide 15086907
Nocturnal Enuresis inferred via Furosemide 17945291
Polyuria inferred via Furosemide 17945291
Reperfusion Injury inferred via Furosemide 16526316
Respiratory Distress Syndrome, Adult inferred via Furosemide 12394941, 15912074, 16096441
Stomach Neoplasms inferred via Furosemide 17052386
Inflammation inferred via Flavonoids 17296493
Breast Neoplasms inferred via Estradiol 17289903, 12948864, 17261762, 14630087, 17018787, 18497071
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 11807958, 11408345, 16891317
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Asthma inferred via epigallocatechin gallate 16516891
Diabetes Mellitus, Type 2 inferred via epigallocatechin gallate 16988119
Liver Cirrhosis, Experimental inferred via epigallocatechin gallate 17481882
Melanoma inferred via epigallocatechin gallate 17992120, 11746506
Muscular Atrophy, Spinal inferred via epigallocatechin gallate 17962980
Mammary Neoplasms, Experimental inferred via Corticosterone 12807724
Adenocarcinoma inferred via arsenic trioxide 11798837
Blood Coagulation Disorders inferred via arsenic trioxide 16206674
Burkitt Lymphoma inferred via arsenic trioxide 11589617
Carcinoma, Hepatocellular inferred via arsenic trioxide 16217749, 14691202, 15553829, 11135700, 15073043
Carcinoma, Small Cell inferred via arsenic trioxide 12490120
Coronary Restenosis inferred via arsenic trioxide 12609071
Death, Sudden, Cardiac inferred via arsenic trioxide 15213294
Esophageal Neoplasms inferred via arsenic trioxide 12903497
Fatty Liver inferred via arsenic trioxide 15073043
Gallbladder Neoplasms inferred via arsenic trioxide 16904648
Leukemia inferred via arsenic trioxide 15070760
Leukemia-Lymphoma, Adult T-Cell inferred via arsenic trioxide 12560223, 17077332
Leukemia, Monocytic, Acute inferred via arsenic trioxide 16972261
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via arsenic trioxide 14633726
Leukemia, Myeloid, Acute inferred via arsenic trioxide 16467208, 16968895, 17050201
Leukemia, Promyelocytic, Acute inferred via arsenic trioxide 16891316, 16330433, 16966277, 11161223, 12679006, 16331271, 17217047, 17107899, 15748426, 15336539, 15213294, 11468182, 12712474, 15622746, 16823087
Leukemia, T-Cell inferred via arsenic trioxide 16882451
Liver Neoplasms inferred via arsenic trioxide 14682389
Long QT Syndrome inferred via arsenic trioxide 15213294
Lung Neoplasms inferred via arsenic trioxide 11798837
Multiple Myeloma inferred via arsenic trioxide 15949261, 11468182, 14977855
Myelodysplastic Syndromes inferred via arsenic trioxide 16105982, 16882451
Neoplasm Invasiveness inferred via arsenic trioxide 16624393
Ovarian Neoplasms inferred via arsenic trioxide 16624393, 12452020
Pancreatic Neoplasms inferred via arsenic trioxide 15580305
Sarcoma, Ewing's inferred via arsenic trioxide 16646077
Stomach Neoplasms inferred via arsenic trioxide 17007042
Torsades de Pointes inferred via arsenic trioxide 15213294
Urinary Bladder Neoplasms inferred via arsenic trioxide 12973940, 11780464, 12845720
Carcinoma, Squamous Cell inferred via Acetylcysteine 17015178
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 14986274, 16177239, 17562736, 17522070, 16227642, 15968718
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Melanoma inferred via 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid 17992120

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
KDR FLT1 / KDR Biochemical Activity Autiero M (2003)
PGF FLT1 / PGF Reconstituted Complex Davis-Smyth T (1998)
PLCG1 FLT1 / PLCG1 Reconstituted Complex Cunningham SA (1997)
PLCG1 FLT1 / PLCG1 Two-hybrid Cunningham SA (1997)
SHC1 FLT1 / SHC1 Two-hybrid Warner AJ (2000)
SHC2 FLT1 / SHC2 Two-hybrid Warner AJ (2000)
VEGFB FLT1 / VEGFB Affinity Capture-Western Olofsson B (1998)
VEGFB FLT1 / VEGFB Reconstituted Complex Makinen T (1999)
VEGFB FLT1 / VEGFB Reconstituted Complex Olofsson B (1998)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Poyer F, et al. (2009) "Secretion of MMP-2 and MMP-9 induced by VEGF autocrine loop correlates with clinical features in childhood acute lymphoblastic leukemia." Leuk Res. 33(3):407-417. PMID:18829111
  2. [ + ] Heydarian M, et al. (2009) "Novel splice variants of sFlt1 are upregulated in preeclampsia." Placenta. 30(3):250-255. PMID:19147226
  3. [ + ] Jee BC, et al. (2009) "Expression of vascular endothelial growth factor-A and its receptor-1 in a luteal endometrium in patients with repeated in vitro fertilization failure." Fertil Steril. 91(2):528-534. PMID:18295763
  4. [ + ] Ito TK, et al. (2009) "Degradation of soluble VEGF receptor-1 by MMP-7 allows VEGF access to endothelial cells." Blood. 113(10):2363-2369. PMID:18974372
  5. [ + ] Ohkuchi A, et al. (2009) "Serum sFlt1:PlGF ratio, PlGF, and soluble endoglin levels in gestational proteinuria." Hypertens Pregnancy. 28(1):95-108. PMID:19165674
  6. [ + ] Jayasinghe C, et al. (2009) "Comparative study of human colonic tumor-derived endothelial cells (HCTEC) and normal colonic microvascular endothelial cells (HCMEC): Hypoxia-induced sVEGFR-1 and sVEGFR-2 levels." Oncol Rep. 21(4):933-939. PMID:19287991
  7. [ + ] Mittar S, et al. (2009) "VEGFR1 receptor tyrosine kinase localization to the Golgi apparatus is calcium-dependent." Exp Cell Res. 315(5):877-889. PMID:19162007
  8. [ + ] Artini PG, et al. (2009) "Vascular endothelial growth factor and its soluble receptor in patients with polycystic ovary syndrome undergoing IVF." Hum Fertil (Camb). 12(1):40-44. PMID:19330612
  9. [ + ] Staff AC, et al. (2009) "Maternal, gestational and neonatal characteristics and maternal angiogenic factors in normotensive pregnancies." Eur J Obstet Gynecol Reprod Biol. 143(1):29-33. PMID:19135290
  10. [ + ] Herse F, et al. (2009) "Prevalence of agonistic autoantibodies against the angiotensin II type 1 receptor and soluble fms-like tyrosine kinase 1 in a gestational age-matched case study." Hypertension. 53(2):393-398. PMID:19064815
  11. [ + ] Jia JB, et al. (2009) "Protein expression profiling of vascular endothelial growth factor and its receptors identifies subclasses of hepatocellular carcinoma and predicts survival." J Cancer Res Clin Oncol. 135(6):847-854. PMID:19066962
  12. [ + ] Kamarainen M, et al. (2009) "Smoking and sVEGFR-1: circulating maternal concentrations and placental expression." Mol Cell Endocrinol. 299(2):261-265. PMID:19103251
  13. [ + ] Yoo SA, et al. (2009) "Role of placenta growth factor and its receptor flt-1 in rheumatoid inflammation: a link between angiogenesis and inflammation." Arthritis Rheum. 60(2):345-354. PMID:19180491
  14. [ + ] Jayasinghe C, et al. (2009) "Hypoxia-induced reduction of sVEGFR-2 levels in human colonic microvascular endothelial cells in vitro: Comparative study with HUVEC." Int J Mol Med. 23(1):49-55. PMID:19082506
  15. [ + ] Mimori K, et al. (2008) "Hematogenous metastasis in gastric cancer requires isolated tumor cells and expression of vascular endothelial growth factor receptor-1." Clin Cancer Res. 14(9):2609-2616. PMID:18451223
  16. [ + ] Sela S, et al. (2008) "A novel human-specific soluble vascular endothelial growth factor receptor 1: cell-type-specific splicing and implications to vascular endothelial growth factor homeostasis and preeclampsia." Circ Res. 102(12):1566-1574. PMID:18515749
  17. [ + ] Avouac J, et al. (2008) "Angiogenesis in systemic sclerosis: impaired expression of vascular endothelial growth factor receptor 1 in endothelial progenitor-derived cells under hypoxic conditions." Arthritis Rheum. 58(11):3550-3561. PMID:18975312
  18. [ + ] Mao K, et al. (2008) "The association of vascular endothelial growth factor receptor-1 with the risk of cancer progression following radical prostatectomy." Oncol Rep. 19(1):171-175. PMID:18097592
  19. [ + ] Ebihara I, et al. (2008) "Vascular endothelial growth factor and soluble fms-like tyrosine kinase-1 in septic shock patients treated with direct hemoperfusion with a polymyxin B-immobilized fiber column." Ther Apher Dial. 12(4):285-291. PMID:18789115
  20. [ + ] Jinnin M, et al. (2008) "Suppressed NFAT-dependent VEGFR1 expression and constitutive VEGFR2 signaling in infantile hemangioma." Nat Med. 14(11):1236-1246. PMID:18931684
  21. [ + ] Tripathi R, et al. (2008) "Soluble and membranous vascular endothelial growth factor receptor-1 in pregnancies complicated by pre-eclampsia." Ann Anat. 190(5):477-489. PMID:18992679
  22. [ + ] Kusmartsev S, et al. (2008) "Oxidative stress regulates expression of VEGFR1 in myeloid cells: link to tumor-induced immune suppression in renal cell carcinoma." J Immunol. 181(1):346-353. PMID:18566400
  23. [ + ] Muehlenbachs A, et al. (2008) "Natural selection of FLT1 alleles and their association with malaria resistance in utero." Proc Natl Acad Sci U S A. 105(38):14488-14491. PMID:18779584
  24. [ + ] Chang YT, et al. (2008) "Serum vascular endothelial growth factor/soluble vascular endothelial growth factor receptor 1 ratio is an independent prognostic marker in pancreatic cancer." Pancreas. 37(2):145-150. PMID:18665074
  25. [ + ] Hattori K, et al. (2008) "[Bone marrow-derived cells contribute to niche formation in cancer progression]" Clin Calcium. 18(4):480-487. PMID:18379030
  26. [ + ] Artini PG, et al. (2008) "Vascular endothelial growth factor and its soluble receptor in benign and malignant ovarian tumors." Biomed Pharmacother. 62(6):373-377. PMID:18037256
  27. [ + ] Tchaikovski V, et al. (2008) "The molecular basis of VEGFR-1 signal transduction pathways in primary human monocytes." Arterioscler Thromb Vasc Biol. 28(2):322-328. PMID:18079407
  28. [ + ] Kommineni VK, et al. (2008) "IFN-gamma acts as anti-angiogenic cytokine in the human cornea by regulating the expression of VEGF-A and sVEGF-R1." Biochem Biophys Res Commun. 374(3):479-484. PMID:18639520
  29. [ + ] Kakehashi A, et al. (2008) "Relationship among VEGF, VEGF receptor, AGEs, and macrophages in proliferative diabetic retinopathy." Diabetes Res Clin Pract. 79(3):438-445. PMID:18053608
  30. [ + ] El Tarhouny S, et al. (2008) "Comparison of serum VEGF and its soluble receptor sVEGFR1 with serum cell-free DNA in patients with breast tumor." Cytokine. 44(1):65-69. PMID:18691902
  31. [ + ] Kim SY, et al. (2008) "Dinucleotide repeat polymorphism in Fms-like tyrosine kinase-1 (Flt-1) gene is not associated with preeclampsia." BMC Med Genet. 9():68. PMID:18631405
  32. [ + ] Lin CI, et al. (2008) "Lysophosphatidic acid upregulates vascular endothelial growth factor-C and tube formation in human endothelial cells through LPA(1/3), COX-2, and NF-kappaB activation- and EGFR transactivation-dependent mechanisms." Cell Signal. 20(10):1804-1814. PMID:18627789
  33. [ + ] Skibola CF, et al. (2008) "Polymorphisms in the estrogen receptor 1 and vitamin C and matrix metalloproteinase gene families are associated with susceptibility to lymphoma." PLoS ONE. 3(7):e2816. PMID:18636124
  34. [ + ] Bianco R, et al. (2008) "Vascular endothelial growth factor receptor-1 contributes to resistance to anti-epidermal growth factor receptor drugs in human cancer cells." Clin Cancer Res. 14(16):5069-5080. PMID:18694994
  35. [ + ] Picard A, et al. (2008) "IGF-2 and FLT-1/VEGF-R1 mRNA levels reveal distinctions and similarities between congenital and common infantile hemangioma." Pediatr Res. 63(3):263-267. PMID:18287964
  36. [ + ] Banerjee S, et al. (2008) "VEGF-A165 induces human aortic smooth muscle cell migration by activating neuropilin-1-VEGFR1-PI3K axis." Biochemistry. 47(11):3345-3351. PMID:18284215
  37. [ + ] Chaiworapongsa T, et al. (2008) "The maternal plasma soluble vascular endothelial growth factor receptor-1 concentration is elevated in SGA and the magnitude of the increase relates to Doppler abnormalities in the maternal and fetal circulation." J Matern Fetal Neonatal Med. 21(1):25-40. PMID:18175242
  38. [ + ] Tsuchida R, et al. (2008) "Cisplatin treatment increases survival and expansion of a highly tumorigenic side-population fraction by upregulating VEGF/Flt1 autocrine signaling." Oncogene. 27(28):3923-3934. PMID:18332870
  39. [ + ] Cimpean AM, et al. (2008) "Immunohistochemical expression of vascular endothelial growth factor A (VEGF), and its receptors (VEGFR1, 2) in normal and pathologic conditions of the human thymus." Ann Anat. 190(3):238-245. PMID:18356031
  40. [ + ] Toft JH, et al. (2008) "Whole-genome microarray and targeted analysis of angiogenesis-regulating gene expression (ENG, FLT1, VEGF, PlGF) in placentas from pre-eclamptic and small-for-gestational-age pregnancies." J Matern Fetal Neonatal Med. 21(4):267-273. PMID:18330824
  41. [ + ] Nevo O, et al. (2008) "Placental expression of soluble fms-like tyrosine kinase 1 is increased in singletons and twin pregnancies with intrauterine growth restriction." J Clin Endocrinol Metab. 93(1):285-292. PMID:17956955
  42. [ + ] Gu Y, et al. (2008) "Placental productions and expressions of soluble endoglin, soluble fms-like tyrosine kinase receptor-1, and placental growth factor in normal and preeclamptic pregnancies." J Clin Endocrinol Metab. 93(1):260-266. PMID:17956952
  43. [ + ] Gutman G, et al. (2008) "Regulation of vascular endothelial growth factor-A and its soluble receptor sFlt-1 by luteinizing hormone in vivo: implication for ovarian follicle angiogenesis." Fertil Steril. 89(4):922-926. PMID:18343373
  44. [ + ] Schneider BP, et al. (2008) "Association of polymorphisms of angiogenesis genes with breast cancer." Breast Cancer Res Treat. 111(1):157-163. PMID:17891484
  45. [ + ] Jaroszewicz J, et al. (2008) "Circulating vascular endothelial growth factor and its soluble receptors in patients with liver cirrhosis: possible association with hepatic function impairment." Cytokine. 44(1):14-17. PMID:18656381
  46. [ + ] Chen CP, et al. (2008) "Trafficking of multipotent mesenchymal stromal cells from maternal circulation through the placenta involves vascular endothelial growth factor receptor-1 and integrins." Stem Cells. 26(2):550-561. PMID:17975225
  47. [ + ] Miyamoto N, et al. (2008) "PlGF-1 and VEGFR-1 pathway regulation of the external epithelial hemato-ocular barrier. A model for retinal edema." Ophthalmic Res. 40(3-4):203-207. PMID:18421240
  48. [ + ] Makrydimas G, et al. (2008) "Physiological distribution of placental growth factor and soluble Flt-1 in early pregnancy." Prenat Diagn. 28(3):175-179. PMID:18264952
  49. [ + ] Park HK, et al. (2008) "Distinct association of genetic variations of vascular endothelial growth factor, transforming growth factor-beta, and fibroblast growth factor receptors with atopy and airway hyperresponsiveness." Allergy. 63(4):447-453. PMID:18315732