FLNA | GeneID:2316 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2316 Official Symbol FLNA
Locus XX-FW83128A1.1 Gene Type protein-coding
Synonyms ABP-280; ABPX; DKFZp434P031; FLN; FLN1; FMD; MNS; NHBP; OPD; OPD1; OPD2
Full Name filamin A, alpha (actin binding protein 280)
Description filamin A, alpha (actin binding protein 280)
Chromosome Xq28
Also Known As OTTHUMP00000024320; endothelial actin-binding protein; filamin 1; filamin A, alpha; non-muscle filamin
Summary The protein encoded by this gene is an actin-binding protein that crosslinks actin filaments and links actin filaments to membrane glycoproteins. The encoded protein is involved in remodeling the cytoskeleton to effect changes in cell shape and migration. This protein interacts with integrins, transmembrane receptor complexes, and second messengers. Defects in this gene are a cause of several syndromes, including periventricular nodular heterotopias (PVNH1, PVNH4), otopalatodigital syndromes (OPD1, OPD2), frontometaphyseal dysplasia (FMD), Melnick-Needles syndrome (MNS), and X-linked congenital idiopathic intestinal pseudoobstruction (CIIPX). Two transcript variants encoding different isoforms have been found for this gene.

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 1119

ID Symbol Protein Species
GeneID:2316 FLNA NP_001447.2 Homo sapiens
GeneID:192176 Flna NP_034357.2 Mus musculus
GeneID:281165 FLNA XP_614269.3 Bos taurus
GeneID:293860 Flna XP_238167.4 Rattus norvegicus
GeneID:481084 FLNA XP_867483.1 Canis lupus familiaris
GeneID:1274482 AgaP_AGAP004335 XP_313613.2 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab51229 Filamin A (phospho S2152) antibody (ab51229); Rabbit polyclonal to Filamin A (phospho S2152)
2 abcam ab51217 Filamin A antibody (ab51217); Rabbit polyclonal to Filamin A
3 abcam ab11074 Filamin A antibody (ab11074); Goat polyclonal to Filamin A
4 abcam ab3261 Filamin A antibody [FLMN01 (PM6/317)] (ab3261); Mouse monoclonal [FLMN01 (PM6/317)] to Filamin A
5 abcam ab20716 Filamin A antibody [PM6/317] (ab20716); Mouse monoclonal [PM6/317] to Filamin A
6 abcam ab68424 Filamin A (phospho S1458) antibody [EP2309Y] (ab68424); Rabbit monoclonal [EP2309Y] to Filamin A (phospho S1458)
7 abcam ab54172 Filamin A antibody [SPM182], prediluted (ab54172); Mouse monoclonal [SPM182] to Filamin A, prediluted
8 abgent AP7770a FLNA Antibody (Y1046); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
9 abgent AP3528a Phospho-FLNA-pY1046 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
10 abgent AP3401a Phospho-FLNA-S2522 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
11 abgent AP3379a Phospho-FLNA-S2151 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
12 abnova H00002316-M01 FLNA monoclonal antibody (M01), clone 4E10-1B2; Mouse monoclonal antibody raised against a full length recombinant FLNA.
13 acris AP14559PU-N FLNA Y1046; antibody Ab
14 acris AP12942PU-N FLNA pTyr1046; antibody Ab
15 acris AP12823PU-N FLNA pSer2522; antibody Ab
16 acris AP01587PU-N Filamin A pSer2152; antibody Ab
17 acris AP06123PU-N Filamin-A / FLNA; antibody Ab
18 acris AP12814PU-N FLNA pSer2151; antibody Ab
19 scbt FLNA FLNA Antibody / FLNA Antibodies;
20 sigma HPA001115 Anti-FLNA antibody produced in rabbit ;
21 sigma HPA002925 Anti-FLNA antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of FLNA Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FLNA Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0015629 Component actin cytoskeleton
GO:0005938 Component cell cortex
GO:0005737 Component cytoplasm
GO:0005634 Component nucleus
GO:0005886 Component plasma membrane
GO:0051015 Function actin filament binding
GO:0034988 Function Fc-gamma receptor I complex binding
GO:0001948 Function glycoprotein binding
GO:0034989 Function GTP-Ral binding
GO:0042803 Function protein homodimerization activity
GO:0048365 Function Rac GTPase binding
GO:0004871 Function signal transducer activity
GO:0031267 Function small GTPase binding
GO:0008134 Function transcription factor binding
GO:0051764 Process actin crosslink formation
GO:0031532 Process actin cytoskeleton reorganization
GO:0051220 Process cytoplasmic sequestering of protein
GO:0045184 Process establishment of protein localization
GO:0007195 Process inhibition of adenylate cyclase activity by dopamine receptor signaling pathway
GO:0042177 Process negative regulation of protein catabolic process
GO:0043433 Process negative regulation of transcription factor activity
GO:0043123 Process positive regulation of I-kappaB kinase/NF-kappaB cascade
GO:0042993 Process positive regulation of transcription factor import into nucleus
GO:0034394 Process protein localization at cell surface
GO:0050821 Process protein stabilization
GO:0043113 Process receptor clustering

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001110556  UCSC Browser NP_001104026 P21333   Q5HY55  
2 NM_001456  UCSC Browser NP_001447 P21333   Q5HY53  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000360319 MI0000433 hsa-let-7g* CUGUACAGGCCACUGCCUUGC
ENST00000360319 MI0000108 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000360319 MI0000109 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000360319 MI0000114 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENST00000360319 MI0000469 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENST00000360319 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000360319 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000360319 MI0000810 hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENST00000360319 MI0000479 hsa-miR-150* CUGGUACAGGCCUGGGGGACAG
ENST00000360319 MI0000071 hsa-miR-17* ACUGCAGUGAAGGCACUUGUAG
ENST00000360319 MI0000484 hsa-miR-188-5p CAUCCCUUGCAUGGUGGAGGG
ENST00000360319 MI0000285 hsa-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENST00000360319 MI0000294 hsa-miR-218-1* AUGGUUCCGUCAAGCACCAUGG
ENST00000360319 MI0005536 hsa-miR-220c ACACAGGGCUGUUGUGAAGACU
ENST00000360319 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENST00000360319 MI0000747 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENST00000360319 MI0000742 hsa-miR-34b* UAGGCAGUGUCAUUAGCUGAUUG
ENST00000360319 MI0002464 hsa-miR-412 ACUUCACCUGGUCCACUAGCCGU
ENST00000360319 MI0001445 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENST00000360319 MI0003133 hsa-miR-432* CUGGAUGGCUCCUCCAUGUCU
ENST00000360319 MI0003820 hsa-miR-454* ACCCUAUCAAUAUUGUCUCUGC
ENST00000360319 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENST00000360319 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000360319 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENST00000360319 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENST00000360319 MI0003557 hsa-miR-552 AACAGGUGACUGGUUAGACAA
ENST00000360319 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENST00000360319 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENST00000360319 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENST00000360319 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000360319 MI0003657 hsa-miR-642 GUCCCUCUCCAAAUGUGUCUUG
ENST00000360319 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENST00000360319 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENST00000360319 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENST00000360319 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENST00000360319 MI0005559 hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENST00000360319 MI0005541 hsa-miR-875-5p UAUACCUCAGUUUUAUCAGGUG
ENST00000360319 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENST00000360319 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENST00000360319 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENST00000360319 MI0005527 hsa-miR-886-5p CGGGUCGGAGUUAGCUCAAGCGG
ENST00000360319 MI0005715 hsa-miR-923 GUCAGCGGAGGAAAAGAAACU
ENST00000360319 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENST00000360319 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000360319 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000360319 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000360319 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENST00000360319 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC
ENST00000360319 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU
ENST00000360319 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU
ENST00000369850 MI0000066 hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENST00000369850 MI0000108 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000369850 MI0000109 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000369850 MI0000114 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENST00000369850 MI0000469 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENST00000369850 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000369850 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000369850 MI0000479 hsa-miR-150* CUGGUACAGGCCUGGGGGACAG
ENST00000369850 MI0000071 hsa-miR-17* ACUGCAGUGAAGGCACUUGUAG
ENST00000369850 MI0005536 hsa-miR-220c ACACAGGGCUGUUGUGAAGACU
ENST00000369850 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENST00000369850 MI0000747 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENST00000369850 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENST00000369850 MI0001445 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENST00000369850 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000369850 MI0005539 hsa-miR-541 UGGUGGGCACAGAAUCUGGACU
ENST00000369850 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENST00000369850 MI0003557 hsa-miR-552 AACAGGUGACUGGUUAGACAA
ENST00000369850 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENST00000369850 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000369850 MI0003657 hsa-miR-642 GUCCCUCUCCAAAUGUGUCUUG
ENST00000369850 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENST00000369850 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENST00000369850 MI0003676 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC
ENST00000369850 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENST00000369850 MI0005559 hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENST00000369850 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENST00000369850 MI0005527 hsa-miR-886-5p CGGGUCGGAGUUAGCUCAAGCGG
ENST00000369850 MI0005715 hsa-miR-923 GUCAGCGGAGGAAAAGAAACU
ENST00000369850 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENST00000369863 MI0000060 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000369863 MI0000061 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000369863 MI0000062 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000369863 MI0000065 hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENST00000369863 MI0000066 hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENST00000369863 MI0000067 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000369863 MI0000068 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000369863 MI0000434 hsa-let-7i* CUGCGCAAGCUACUGCCUUGCU
ENST00000369863 MI0000108 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000369863 MI0000109 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000369863 MI0000114 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENST00000369863 MI0000469 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENST00000369863 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000369863 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000369863 MI0000810 hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENST00000369863 MI0000479 hsa-miR-150* CUGGUACAGGCCUGGGGGACAG
ENST00000369863 MI0000071 hsa-miR-17* ACUGCAGUGAAGGCACUUGUAG
ENST00000369863 MI0000273 hsa-miR-183 UAUGGCACUGGUAGAAUUCACU
ENST00000369863 MI0000484 hsa-miR-188-5p CAUCCCUUGCAUGGUGGAGGG
ENST00000369863 MI0000284 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENST00000369863 MI0000285 hsa-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENST00000369863 MI0000287 hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
ENST00000369863 MI0000294 hsa-miR-218-1* AUGGUUCCGUCAAGCACCAUGG
ENST00000369863 MI0000295 hsa-miR-218-2* CAUGGUUCUGUCAAGCACCGCG
ENST00000369863 MI0005536 hsa-miR-220c ACACAGGGCUGUUGUGAAGACU
ENST00000369863 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENST00000369863 MI0000747 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENST00000369863 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENST00000369863 MI0000742 hsa-miR-34b* UAGGCAGUGUCAUUAGCUGAUUG
ENST00000369863 MI0000743 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC
ENST00000369863 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENST00000369863 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENST00000369863 MI0002464 hsa-miR-412 ACUUCACCUGGUCCACUAGCCGU
ENST00000369863 MI0001445 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENST00000369863 MI0003133 hsa-miR-432* CUGGAUGGCUCCUCCAUGUCU
ENST00000369863 MI0003820 hsa-miR-454* ACCCUAUCAAUAUUGUCUCUGC
ENST00000369863 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENST00000369863 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000369863 MI0003185 hsa-miR-501-5p AAUCCUUUGUCCCUGGGUGAGA
ENST00000369863 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENST00000369863 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENST00000369863 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENST00000369863 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENST00000369863 MI0003205 hsa-miR-532-3p CCUCCCACACCCAAGGCUUGCA
ENST00000369863 MI0005539 hsa-miR-541 UGGUGGGCACAGAAUCUGGACU
ENST00000369863 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENST00000369863 MI0003557 hsa-miR-552 AACAGGUGACUGGUUAGACAA
ENST00000369863 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENST00000369863 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENST00000369863 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENST00000369863 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENST00000369863 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENST00000369863 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000369863 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENST00000369863 MI0003657 hsa-miR-642 GUCCCUCUCCAAAUGUGUCUUG
ENST00000369863 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENST00000369863 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENST00000369863 MI0003676 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC
ENST00000369863 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENST00000369863 MI0003760 hsa-miR-671-5p AGGAAGCCCUGGAGGGGCUGGAG
ENST00000369863 MI0000263 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000369863 MI0000264 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000369863 MI0000265 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000369863 MI0005559 hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENST00000369863 MI0005541 hsa-miR-875-5p UAUACCUCAGUUUUAUCAGGUG
ENST00000369863 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENST00000369863 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENST00000369863 MI0005527 hsa-miR-886-5p CGGGUCGGAGUUAGCUCAAGCGG
ENST00000369863 MI0005715 hsa-miR-923 GUCAGCGGAGGAAAAGAAACU
ENST00000369863 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENST00000369863 MI0000389 mmu-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENST00000369863 MI0003539 mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC
ENST00000369863 MI0000391 mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU
ENST00000369863 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENST00000369863 MI0002399 mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA
ENST00000369863 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENST00000369863 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENST00000369863 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC
ENST00000369863 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENST00000369863 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC
ENST00000369863 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU
ENST00000369863 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of FLNA mRNA
17562736
Ellagic Acid
  • Ellagic Acid results in decreased expression of FLNA mRNA
12002526
phenethyl isothiocyanate
  • phenethyl isothiocyanate results in decreased expression of FLNA mRNA
17616710

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
AR AR / FLNA Two-hybrid Loy CJ (2003)
BRCA2 BRCA2 / FLNA Affinity Capture-Western Yuan Y (2001)
BRCA2 BRCA2 / FLNA Reconstituted Complex Yuan Y (2001)
BRCA2 BRCA2 / FLNA Two-hybrid Yuan Y (2001)
CASR FLNA / CASR Invitro Awata H (2001)
CASR FLNA / CASR Invivo Awata H (2001)
CASR FLNA / CASR Reconstituted Complex Hjalm G (2001)
CASR FLNA / CASR Two-hybrid Awata H (2001)
CASR FLNA / CASR Two-hybrid Hjalm G (2001)
CMIP CMIP / FLNA Affinity Capture-Western Grimbert P (2004)
CMIP FLNA / CMIP Two-hybrid Grimbert P (2004)
DCN DCN / FLNA Reconstituted Complex Yoshida K (2002)
DRD2 DRD2 / FLNA Affinity Capture-Western Binda AV (2002)
DRD3 FLNA / DRD3 Two-hybrid Li M (2002)
F3 FLNA / F3 Reconstituted Complex Ott I (1998)
FBLP-1 FBLP-1 / FLNA Affinity Capture-Western Tu Y (2003)
FBLP-1 FBLP-1 / FLNA Two-hybrid Tu Y (2003)
FLNB FLNA / FLNB Affinity Capture-Western Sheen VL (2002)
FLNB FLNA / FLNB Two-hybrid Sheen VL (2002)
GP1BA GP1BA / FLNA Affinity Capture-Western Williamson D (2002)
Grm7 Grm7 / FLNA Reconstituted Complex Enz R (2002)
ITGB1 ITGB1 / FLNA Affinity Capture-Western Loo DT (1998)
ITGB1 ITGB1 / FLNA Reconstituted Complex Loo DT (1998)
ITGB1 ITGB1 / FLNA Reconstituted Complex van der Flier A (2002)
ITGB1 ITGB1 / FLNA Two-hybrid Loo DT (1998)
ITGB1 FLNA / ITGB1 Two-hybrid van der Flier A (2002)
ITGB3 FLNA / ITGB3 Two-hybrid van der Flier A (2002)
ITGB6 FLNA / ITGB6 Two-hybrid van der Flier A (2002)
ITGB7 FLNA / ITGB7 Reconstituted Complex Calderwood DA (2001)
LNK FLNA / LNK Invivo He X (2000)
LNK FLNA / LNK Two-hybrid He X (2000)
NPHP1 NPHP1 / FLNA Affinity Capture-Western Donaldson JC (2002)
NPHP1 NPHP1 / FLNA Two-hybrid Donaldson JC (2002)
RALA FLNA / RALA Affinity Capture-Western Ohta Y (1999)
RALA FLNA / RALA Reconstituted Complex Ohta Y (1999)
SIGLEC10 FLNA / SIGLEC10 Two-hybrid Nagano T (2002)
TRAF2 TRAF2 / FLNA Affinity Capture-Western Leonardi A (2000)
TRIO TRIO / FLNA Reconstituted Complex Bellanger JM (2000)
TRIO FLNA / TRIO Two-hybrid Bellanger JM (2000)
TTID TTID / FLNA Affinity Capture-Western van der Ven PF (2000)
VHL VHL / FLNA Two-hybrid Tsuchiya H (1996)
VHL VHL / FLNA Two-hybrid Zhou MI (2002)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Kirk EP, et al. (2009) "The clinical variability of the MECP2 duplication syndrome: description of two families with duplications excluding L1CAM and FLNA." Clin Genet. 75(3):301-303. PMID:19018795
  2. [ + ] Seo MD, et al. (2009) "Crystal structure of the dimerization domain of human filamin A." Proteins. 75(1):258-263. PMID:19137608
  3. [ + ] Motallebipour M, et al. (2009) "Novel genes in cell cycle control and lipid metabolism with dynamically regulated binding sites for sterol regulatory element-binding protein 1 and RNA polymerase II in HepG2 cells detected by chromatin immunoprecipitation with microarray detection." FEBS J. 276(7):1878-1890. PMID:19292868
  4. [ + ] Fiori JL, et al. (2009) "Filamin A modulates kinase activation and intracellular trafficking of epidermal growth factor receptors in human melanoma cells." Endocrinology. 150(6):2551-2560. PMID:19213840
  5. [ + ] Ravid D, et al. (2008) "Filamin A is a novel caveolin-1-dependent target in IGF-I-stimulated cancer cell migration." Exp Cell Res. 314(15):2762-2773. PMID:18598695
  6. [ + ] Maceyka M, et al. (2008) "Filamin A links sphingosine kinase 1 and sphingosine-1-phosphate receptor 1 at lamellipodia to orchestrate cell migration." Mol Cell Biol. 28(18):5687-5697. PMID:18644866
  7. [ + ] Forestier M, et al. (2008) "Platelet microparticle suppressing antibody against GP Ibalpha acts independently of the filamin cleavage and increases protein tyrosine phosphorylation." Blood Coagul Fibrinolysis. 19(8):801-806. PMID:19002047
  8. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  9. [ + ] Oshikawa M, et al. (2008) "Fine expression profiling of full-length transcripts using a size-unbiased cDNA library prepared with the vector-capping method." DNA Res. 15(3):123-136. PMID:18487259
  10. [ + ] Lad Y, et al. (2008) "Structural basis of the migfilin-filamin interaction and competition with integrin beta tails." J Biol Chem. 283(50):35154-35163. PMID:18829455
  11. [ + ] Sarkisian MR, et al. (2008) "Trouble making the first move: interpreting arrested neuronal migration in the cerebral cortex." Trends Neurosci. 31(2):54-61. PMID:18201775
  12. [ + ] Onoprishvili I, et al. (2008) "Filamin A mutant lacking actin-binding domain restores mu opioid receptor regulation in melanoma cells." Neurochem Res. 33(10):2054-2061. PMID:18404377
  13. [ + ] Armstrong LJ, et al. (2008) "ECSM2, an endothelial specific filamin a binding protein that mediates chemotaxis." Arterioscler Thromb Vasc Biol. 28(9):1640-1646. PMID:18556573
  14. [ + ] Heuze ML, et al. (2008) "ASB2 targets filamins A and B to proteasomal degradation." Blood. 112(13):5130-5140. PMID:18799729
  15. [ + ] Beekman JM, et al. (2008) "Filamin A stabilizes Fc gamma RI surface expression and prevents its lysosomal routing." J Immunol. 180(6):3938-3945. PMID:18322202
  16. [ + ] Tsuneda SS, et al. (2008) "A new missense mutation found in the FLNA gene in a family with bilateral periventricular nodular heterotopia (BPNH) alters the splicing process." J Mol Neurosci. 35(2):195-200. PMID:18427995
  17. [ + ] Wang Y, et al. (2007) "A 90 kDa fragment of filamin A promotes Casodex-induced growth inhibition in Casodex-resistant androgen receptor positive C4-2 prostate cancer cells." Oncogene. 26(41):6061-6070. PMID:17420725
  18. [ + ] Marino-Enriquez A, et al. (2007) "Otopalatodigital syndrome type 2 in two siblings with a novel filamin A 629G>T mutation: clinical, pathological, and molecular findings." Am J Med Genet A. 143A(10):1120-1125. PMID:17431908
  19. [ + ] Cho EY, et al. (2007) "Roles of protein kinase C and actin-binding protein 280 in the regulation of intracellular trafficking of dopamine D3 receptor." Mol Endocrinol. 21(9):2242-2254. PMID:17536008
  20. [ + ] Thelin WR, et al. (2007) "Direct interaction with filamins modulates the stability and plasma membrane expression of CFTR." J Clin Invest. 117(2):364-374. PMID:17235394
  21. [ + ] Gargiulo A, et al. (2007) "Filamin A is mutated in X-linked chronic idiopathic intestinal pseudo-obstruction with central nervous system involvement." Am J Hum Genet. 80(4):751-758. PMID:17357080
  22. [ + ] Zhu TN, et al. (2007) "Filamin A-mediated down-regulation of the exchange factor Ras-GRF1 correlates with decreased matrix metalloproteinase-9 expression in human melanoma cells." J Biol Chem. 282(20):14816-14826. PMID:17389601
  23. [ + ] Kyndt F, et al. (2007) "Mutations in the gene encoding filamin A as a cause for familial cardiac valvular dystrophy." Circulation. 115(1):40-49. PMID:17190868
  24. [ + ] Lad Y, et al. (2007) "Structure of three tandem filamin domains reveals auto-inhibition of ligand binding." EMBO J. 26(17):3993-4004. PMID:17690686
  25. [ + ] Onoprishvili I, et al. (2007) "Chronic morphine treatment up-regulates mu opioid receptor binding in cells lacking filamin A." Brain Res. 1177():9-18. PMID:17897634
  26. [ + ] Jimenez-Baranda S, et al. (2007) "Filamin-A regulates actin-dependent clustering of HIV receptors." Nat Cell Biol. 9(7):838-846. PMID:17572668
  27. [ + ] Cukier IH, et al. (2007) "Cyclin B1/Cdk1 binds and phosphorylates Filamin A and regulates its ability to cross-link actin." FEBS Lett. 581(8):1661-1672. PMID:17408621
  28. [ + ] Nakamura F, et al. (2007) "Structural basis of filamin A functions." J Cell Biol. 179(5):1011-1025. PMID:18056414
  29. [ + ] Hayashi K, et al. (2006) "Filamin A is required for T cell activation mediated by protein kinase C-theta." J Immunol. 177(3):1721-1728. PMID:16849481
  30. [ + ] Scott MG, et al. (2006) "Cooperative regulation of extracellular signal-regulated kinase activation and cell shape change by filamin A and beta-arrestins." Mol Cell Biol. 26(9):3432-3445. PMID:16611986
  31. [ + ] Nousiainen M, et al. (2006) "Phosphoproteome analysis of the human mitotic spindle." Proc Natl Acad Sci U S A. 103(14):5391-5396. PMID:16565220
  32. [ + ] Robertson SP, et al. (2006) "Frontometaphyseal dysplasia: mutations in FLNA and phenotypic diversity." Am J Med Genet A. 140(16):1726-1736. PMID:16835913
  33. [ + ] Zenker M, et al. (2006) "Genotype-epigenotype-phenotype correlations in females with frontometaphyseal dysplasia." Am J Med Genet A. 140(10):1069-1073. PMID:16596676
  34. [ + ] Ohta Y, et al. (2006) "FilGAP, a Rho- and ROCK-regulated GAP for Rac binds filamin A to control actin remodelling." Nat Cell Biol. 8(8):803-814. PMID:16862148
  35. [ + ] Hehr U, et al. (2006) "A filamin A splice mutation resulting in a syndrome of facial dysmorphism, periventricular nodular heterotopia, and severe constipation reminiscent of cerebro-fronto-facial syndrome." J Med Genet. 43(6):541-544. PMID:16299064
  36. [ + ] Gomez-Garre P, et al. (2006) "Ehlers-Danlos syndrome and periventricular nodular heterotopia in a Spanish family with a single FLNA mutation." J Med Genet. 43(3):232-237. PMID:15994863
  37. [ + ] Garcia E, et al. (2006) "Calcineurin dephosphorylates the C-terminal region of filamin in an important regulatory site: a possible mechanism for filamin mobilization and cell signaling." Arch Biochem Biophys. 446(2):140-150. PMID:16442073
  38. [ + ] Beausoleil SA, et al. (2006) "A probability-based approach for high-throughput protein phosphorylation analysis and site localization." Nat Biotechnol. 24(10):1285-1292. PMID:16964243
  39. [ + ] Tavano R, et al. (2006) "CD28 interaction with filamin-A controls lipid raft accumulation at the T-cell immunological synapse." Nat Cell Biol. 8(11):1270-1276. PMID:17060905
  40. [ + ] Olsen JV, et al. (2006) "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell. 127(3):635-648. PMID:17081983
  41. [ + ] Brown V, et al. (2006) "Binding specificity of Toll-like receptor cytoplasmic domains." Eur J Immunol. 36(3):742-753. PMID:16482509
  42. [ + ] Labeit S, et al. (2006) "Expression of distinct classes of titin isoforms in striated and smooth muscles by alternative splicing, and their conserved interaction with filamins." J Mol Biol. 362(4):664-681. PMID:16949617
  43. [ + ] Gontier Y, et al. (2005) "The Z-disc proteins myotilin and FATZ-1 interact with each other and are connected to the sarcolemma via muscle-specific filamins." J Cell Sci. 118(Pt 16):3739-3749. PMID:16076904
  44. [ + ] Kato S, et al. (2005) "Vector-capping: a simple method for preparing a high-quality full-length cDNA library." DNA Res. 12(1):53-62. PMID:16106752
  45. [ + ] Sheen VL, et al. (2005) "Filamin A mutations cause periventricular heterotopia with Ehlers-Danlos syndrome." Neurology. 64(2):254-262. PMID:15668422
  46. [ + ] Nakamura F, et al. (2005) "Ca2+ and calmodulin regulate the binding of filamin A to actin filaments." J Biol Chem. 280(37):32426-32433. PMID:16030015
  47. [ + ] Berry FB, et al. (2005) "FOXC1 transcriptional regulatory activity is impaired by PBX1 in a filamin A-mediated manner." Mol Cell Biol. 25(4):1415-1424. PMID:15684392
  48. [ + ] Stefanova M, et al. (2005) "A novel 9 bp deletion in the filamin a gene causes an otopalatodigital-spectrum disorder with a variable, intermediate phenotype." Am J Med Genet A. 132(4):386-390. PMID:15654694
  49. [ + ] Hidalgo-Bravo A, et al. (2005) "A novel filamin A D203Y mutation in a female patient with otopalatodigital type 1 syndrome and extremely skewed X chromosome inactivation." Am J Med Genet A. 136(2):190-193. PMID:15940695
  50. [ + ] Zhang M, et al. (2005) "High affinity interaction with filamin A protects against calcium-sensing receptor degradation." J Biol Chem. 280(12):11140-11146. PMID:15657061