ABCF1 | GeneID:23 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 23 Official Symbol ABCF1
Locus DADB-129D20.7 Gene Type protein-coding
Synonyms ABC27; ABC50
Full Name ATP-binding cassette, sub-family F (GCN20), member 1
Description ATP-binding cassette, sub-family F (GCN20), member 1
Chromosome 6p21.33
Also Known As ATP-binding cassette 50 (TNF-alpha stimulated); ATP-binding cassette, sub-family F, member 1; OTTHUMP00000029110; OTTHUMP00000029111; TNFalpha-inducible ATP-binding protein
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the GCN20 subfamily. Unlike other members of the superfamily, this protein lacks the transmembrane domains which are characteristic of most ABC transporters. This protein may be regulated by tumor necrosis factor-alpha and play a role in enhancement of protein synthesis and the inflammation process. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 849

ID Symbol Protein Species
GeneID:23 ABCF1 NP_001020262.1 Homo sapiens
GeneID:32112 CG1703 NP_572736.1 Drosophila melanogaster
GeneID:85493 Abcf1 XP_001062137.1 Rattus norvegicus
GeneID:179748 abcf-1 NP_506192.1 Caenorhabditis elegans
GeneID:224742 Abcf1 NP_038882.1 Mus musculus
GeneID:406467 abcf1 NP_998351.1 Danio rerio
GeneID:462543 ABCF1 NP_001035838.1 Pan troglodytes
GeneID:474826 ABCF1 XP_532056.2 Canis lupus familiaris
GeneID:525343 ABCF1 XP_603695.3 Bos taurus
GeneID:824619 ATGCN4 NP_567001.1 Arabidopsis thaliana
GeneID:1280440 AgaP_AGAP012249 XP_320293.2 Anopheles gambiae
GeneID:2539509 SPCC825.01 NP_588051.1 Schizosaccharomyces pombe
GeneID:4333216 Os03g0441500 NP_001050461.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab50976 ABCF1 antibody [ABC5H06] (ab50976); Mouse monoclonal [ABC5H06] to ABCF1
2 abnova H00000023-M01 ABCF1 monoclonal antibody (M01), clone 1B4; Mouse monoclonal antibody raised against a partial recombinant ABCF1.
3 scbt ABCF1 ABCF1 Antibody / ABCF1 Antibodies;
4 sigma HPA017578 Anti-ABCF1 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCF1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCF1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0008135 Function translation factor activity, nucleic acid binding
GO:0006954 Process inflammatory response
GO:0006412 Process translation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001025091  UCSC Browser NP_001020262 Q8NE71   A2BF75  
2 NM_001090  UCSC Browser NP_001081 Q2L6I2   Q8NE71  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000326195 MI0000470 hsa-miR-125b-2* UCACAAGUCAGGCUCUUGGGAC
ENST00000326195 MI0000072 hsa-miR-18a* ACUGCCCUAAGUGCUCCUUCUGG
ENST00000326195 MI0001518 hsa-miR-18b* UGCCCUAAAUGCCCCUUCUGGC
ENST00000326195 MI0000087 hsa-miR-29a UAGCACCAUCUGAAAUCGGUUA
ENST00000326195 MI0000105 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000326195 MI0000107 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000326195 MI0000735 hsa-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENST00000326195 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENST00000326195 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENST00000326195 MI0003133 hsa-miR-432* CUGGAUGGCUCCUCCAUGUCU
ENST00000326195 MI0005531 hsa-miR-450b-3p UUGGGAUCAUUUUGCAUCCAUA
ENST00000326195 MI0002469 hsa-miR-485-5p AGAGGCUGGCCGUGAUGAAUUC
ENST00000326195 MI0003599 hsa-miR-589* UCAGAACAAAUGCCGGUUCCCAGA
ENST00000326195 MI0003605 hsa-miR-593* AGGCACCAGCCAGGCAUUGCUCAGC
ENST00000326195 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENST00000326195 MI0005543 hsa-miR-708 AAGGAGCUUACAAUCUAGCUGGG
ENST00000326195 MI0005543 hsa-miR-708* CAACUAGACUGUGAGCUUCUAG
ENST00000326195 MI0005527 hsa-miR-886-5p CGGGUCGGAGUUAGCUCAAGCGG
ENST00000326195 MI0000097 hsa-miR-95 UUCAACGGGUAUUUAUUGAGCA
ENST00000326195 MI0000101 hsa-miR-99a* CAAGCUCGCUUCUAUGGGUCUG
ENST00000326195 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENST00000326195 MI0003518 mmu-miR-540-3p AGGUCAGAGGUCGAUCCUGG
ENST00000326195 MI0003518 mmu-miR-540-5p CAAGGGUCACCCUCUGACUCUGU
ENST00000326195 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG
ENST00000326195 MI0004694 mmu-miR-710 CCAAGUCUUGGGGAGAGUUGAG
ENST00000326195 MI0004651 mmu-miR-719 AUCUCGGCUACAGAAAAAUGUU
ENST00000326195 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ABCF1 mRNA
17562736
arsenic trisulfide
  • arsenic trisulfide affects the expression of ABCF1 mRNA
12015082

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16177239, 15968718, 16227642, 14986274, 16081117, 17562736, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ITGB4BP ITGB4BP / ABCF1 Two-hybrid Stelzl U (2005)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Paytubi S, et al. (2008) "The N-terminal region of ABC50 interacts with eukaryotic initiation factor eIF2 and is a target for regulatory phosphorylation by CK2." Biochem J. 409(1):223-231. PMID:17894550
  3. [ + ] You KT, et al. (2007) "Selective translational repression of truncated proteins from frameshift mutation-derived mRNAs in tumors." PLoS Biol. 5(5):e109. PMID:17456004
  4. [ + ] Ota M, et al. (2007) "Two critical genes (HLA-DRB1 and ABCF1)in the HLA region are associated with the susceptibility to autoimmune pancreatitis." Immunogenetics. 59(1):45-52. PMID:17119950
  5. [ + ] Beausoleil SA, et al. (2006) "A probability-based approach for high-throughput protein phosphorylation analysis and site localization." Nat Biotechnol. 24(10):1285-1292. PMID:16964243
  6. [ + ] Olsen JV, et al. (2006) "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell. 127(3):635-648. PMID:17081983
  7. [ + ] Stelzl U, et al. (2005) "A human protein-protein interaction network: a resource for annotating the proteome." Cell. 122(6):957-968. PMID:16169070
  8. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  9. [ + ] Beausoleil SA, et al. (2004) "Large-scale characterization of HeLa cell nuclear phosphoproteins." Proc Natl Acad Sci U S A. 101(33):12130-12135. PMID:15302935
  10. [ + ] Ballif BA, et al. (2004) "Phosphoproteomic analysis of the developing mouse brain." Mol Cell Proteomics. 3(11):1093-1101. PMID:15345747
  11. [ + ] Mungall AJ, et al. (2003) "The DNA sequence and analysis of human chromosome 6." Nature. 425(6960):805-811. PMID:14574404
  12. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  13. [ + ] Tyzack JK, et al. (2000) "ABC50 interacts with eukaryotic initiation factor 2 and associates with the ribosome in an ATP-dependent manner." J Biol Chem. 275(44):34131-34139. PMID:10931828
  14. [ + ] Klein I, et al. (1999) "An inventory of the human ABC proteins." Biochim Biophys Acta. 1461(2):237-262. PMID:10581359
  15. [ + ] Richard M, et al. (1998) "ABC50, a novel human ATP-binding cassette protein found in tumor necrosis factor-alpha-stimulated synoviocytes." Genomics. 53(2):137-145. PMID:9790762