ACIN1 | GeneID:22985 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 22985 Official Symbol ACIN1
Locus N/A Gene Type protein-coding
Synonyms ACINUS; ACN; DKFZp667N107; KIAA0670; fSAP152
Full Name apoptotic chromatin condensation inducer 1
Description apoptotic chromatin condensation inducer 1
Chromosome 14q11.2
Also Known As OTTHUMP00000164548; apoptotic chromatin condensation inducer in the nucleus; functional spliceosome-associated protein 152
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22853

ID Symbol Protein Species
GeneID:22985 ACIN1 NP_055792.1 Homo sapiens
GeneID:35173 hkl NP_724153.1 Drosophila melanogaster
GeneID:56215 Acin1 NP_075679.1 Mus musculus
GeneID:172030 cogc-5 NP_491344.1 Caenorhabditis elegans
GeneID:305884 Acin1 XP_240178.3 Rattus norvegicus
GeneID:327495 acin1b XP_694912.3 Danio rerio
GeneID:452792 ACIN1 XP_509847.2 Pan troglodytes
GeneID:480247 ACIN1 XP_858297.1 Canis lupus familiaris
GeneID:534600 ACIN1 XP_614421.3 Bos taurus
GeneID:1280192 AgaP_AGAP009237 XP_320014.2 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab18519 Acinus antibody (ab18519); Rabbit polyclonal to Acinus
2 abcam ab55938 Acinus antibody (ab55938); Rabbit polyclonal to Acinus
3 abcam ab50827 Acinus antibody [2005C3a] (ab50827); Mouse monoclonal [2005C3a] to Acinus
4 abcam ab7352 Acinus antibody (ab7352); Rabbit polyclonal to Acinus
5 abcam ab7353 Acinus antibody (ab7353); Rabbit polyclonal to Acinus
6 abcam ab7354 Acinus antibody (ab7354); Rabbit polyclonal to Acinus
7 abcam ab7355 Acinus antibody (ab7355); Rabbit polyclonal to Acinus
8 abcam ab1143 Acinus antibody (ab1143); Rabbit polyclonal to Acinus
9 abcam ab1144 Acinus antibody (ab1144); Rabbit polyclonal to Acinus
10 acris AP05824PU-S Acinus / ACIN1; antibody Ab
11 acris AP05824PU-N Acinus / ACIN1; antibody Ab
12 acris AP05827PU-N Acinus / ACIN1; antibody Ab
13 acris AP05827PU-S Acinus / ACIN1; antibody Ab
14 acris AP05087PU-N Acinus / ACIN1; antibody
15 acris AP05825PU-S Acinus / ACIN1; antibody Ab
16 acris AP05826PU-S Acinus / ACIN1; antibody Ab
17 acris AP05086PU-N Acinus / ACIN1; antibody
18 acris AP05825PU-N Acinus / ACIN1; antibody Ab
19 acris AP05826PU-N Acinus / ACIN1; antibody Ab
20 acris AP05085PU-N Acinus / ACIN1; antibody
21 acris AP05088PU-N Acinus / ACIN1; antibody
22 scbt ACIN1 ACIN1 Antibody / ACIN1 Antibodies;
23 sigma HPA000657 Anti-ACIN1 antibody produced in rabbit ;
24 sigma A1351 Anti-Acinus antibody produced in rabbit ;
25 sigma A1476 Anti-Acinus, C-Terminal antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACIN1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACIN1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005829 Component cytosol
GO:0005730 Component nucleolus
GO:0005634 Component nucleus
GO:0016887 Function ATPase activity
GO:0019899 Function enzyme binding
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding
GO:0006915 Process apoptosis
GO:0030263 Process apoptotic chromosome condensation
GO:0030218 Process erythrocyte differentiation
GO:0045657 Process positive regulation of monocyte differentiation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_014977  UCSC Browser NP_055792

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000262710 MI0000446 hsa-miR-125b-1* ACGGGUUAGGCUCUUGGGAGCU
ENST00000262710 MI0000810 hsa-miR-135b* AUGUAGGGCUAAAAGCCAUGGG
ENST00000262710 MI0000458 hsa-miR-142-5p CAUAAAGUAGAAAGCACUACU
ENST00000262710 MI0000478 hsa-miR-149 UCUGGCUCCGUGUCUUCACUCCC
ENST00000262710 MI0000284 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENST00000262710 MI0000084 hsa-miR-26b* CCUGUUCUCCAUUACUUGGCUC
ENST00000262710 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENST00000262710 MI0005775 hsa-miR-297 AUGUAUGUGUGCAUGUGCAUG
ENST00000262710 MI0000812 hsa-miR-331-3p GCCCCUGGGCCUAUCCUAGAA
ENST00000262710 MI0000762 hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU
ENST00000262710 MI0003131 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU
ENST00000262710 MI0003186 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA
ENST00000262710 MI0005717 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG
ENST00000262710 MI0003196 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENST00000262710 MI0005530 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENST00000262710 MI0003197 hsa-miR-510 UACUCAGGAGAGUGGCAAUCAC
ENST00000262710 MI0003556 hsa-miR-551a GCGACCCACUCUUGGUUUCCA
ENST00000262710 MI0003575 hsa-miR-551b GCGACCCAUACUUGGUUUCAG
ENST00000262710 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENST00000262710 MI0003572 hsa-miR-566 GGGCGCCUGUGAUCCCAAC
ENST00000262710 MI0003579 hsa-miR-572 GUCCGCUCGGCGGUGGCCCA
ENST00000262710 MI0003586 hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU
ENST00000262710 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENST00000262710 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENST00000262710 MI0003655 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU
ENST00000262710 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENST00000262710 MI0003676 hsa-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENST00000262710 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENST00000262710 MI0000263 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000262710 MI0000264 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000262710 MI0000265 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000262710 MI0005567 hsa-miR-760 CGGCUCUGGGUCUGUGGGGA
ENST00000262710 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENST00000262710 MI0005527 hsa-miR-886-5p CGGGUCGGAGUUAGCUCAAGCGG
ENST00000262710 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENST00000262710 MI0000630 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENST00000262710 MI0005495 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENST00000262710 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENST00000262710 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENST00000262710 MI0004647 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENST00000262710 MI0004648 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENST00000262710 MI0004650 mmu-miR-686 AUUGCUUCCCAGACGGUGAAGA
ENST00000262710 MI0004693 mmu-miR-709 GGAGGCAGAGGCAGGAGGA
ENST00000262710 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG
ENST00000262710 MI0005474 mmu-miR-881 AACUGUGUCUUUUCUGAAUAGA
ENST00000262710 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU
ENST00000262710 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU
ENST00000262710 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Cocaine
  • Cocaine affects the expression of ACIN1 mRNA
15681117
Hydralazine
  • [Hydralazine co-treated with Valproic Acid] results in increased expression of ACIN1 mRNA
17183730
panduratin A
  • panduratin A results in increased degradation of ACIN1 protein
16497706
Tretinoin
  • Tretinoin results in decreased expression of ACIN1 mRNA
16169686
Valproic Acid
  • [Hydralazine co-treated with Valproic Acid] results in increased expression of ACIN1 mRNA
17183730

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Dystonia inferred via Valproic Acid 1851702
Fatty Liver inferred via Valproic Acid 14986274
Leukemia, Myeloid, Acute inferred via Valproic Acid 16294345
Migraine Disorders inferred via Valproic Acid 18765137, 18803445
Pseudolymphoma inferred via Valproic Acid 12752131
Seizures inferred via Valproic Acid 11738929
Unverricht-Lundborg Syndrome inferred via Valproic Acid 3119515
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16166294, 16443354
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 16823087, 15748426, 16788101, 16766008, 17506722, 16140955, 16331271, 17294898, 17361223, 17368321, 17301526, 17339181, 17217047, 17107899, 16935935, 12679006
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Prostatic Neoplasms inferred via panduratin A 16497706
Hypertension, Pregnancy-Induced inferred via Hydralazine 16612254

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ABCF3 ABCF3 / ACIN1 Two-hybrid Stelzl U (2005)
PAFAH1B2 PAFAH1B2 / ACIN1 Two-hybrid Stelzl U (2005)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Rigou P, et al. (2009) "The antiapoptotic protein AAC-11 interacts with and regulates Acinus-mediated DNA fragmentation." EMBO J. 28(11):1576-1588. PMID:19387494
  2. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  3. [ + ] Joselin AP, et al. (2006) "Loss of Acinus inhibits oligonucleosomal DNA fragmentation but not chromatin condensation during apoptosis." J Biol Chem. 281(18):12475-12484. PMID:16537548
  4. [ + ] Shu Y, et al. (2006) "The ACIN1 gene is hypermethylated in early stage lung adenocarcinoma." J Thorac Oncol. 1(2):160-167. PMID:17409846
  5. [ + ] Olsen JV, et al. (2006) "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell. 127(3):635-648. PMID:17081983
  6. [ + ] Beausoleil SA, et al. (2006) "A probability-based approach for high-throughput protein phosphorylation analysis and site localization." Nat Biotechnol. 24(10):1285-1292. PMID:16964243
  7. [ + ] Kim JE, et al. (2005) "Global phosphoproteome of HT-29 human colon adenocarcinoma cells." J Proteome Res. 4(4):1339-1346. PMID:16083285
  8. [ + ] Stelzl U, et al. (2005) "A human protein-protein interaction network: a resource for annotating the proteome." Cell. 122(6):957-968. PMID:16169070
  9. [ + ] Hu Y, et al. (2005) "Akt phosphorylates acinus and inhibits its proteolytic cleavage, preventing chromatin condensation." EMBO J. 24(20):3543-3554. PMID:16177823
  10. [ + ] Jin J, et al. (2004) "Proteomic, functional, and domain-based analysis of in vivo 14-3-3 binding proteins involved in cytoskeletal regulation and cellular organization." Curr Biol. 14(16):1436-1450. PMID:15324660
  11. [ + ] Beausoleil SA, et al. (2004) "Large-scale characterization of HeLa cell nuclear phosphoproteins." Proc Natl Acad Sci U S A. 101(33):12130-12135. PMID:15302935
  12. [ + ] Shu H, et al. (2004) "Identification of phosphoproteins and their phosphorylation sites in the WEHI-231 B lymphoma cell line." Mol Cell Proteomics. 3(3):279-286. PMID:14729942
  13. [ + ] Sordet O, et al. (2002) "Specific involvement of caspases in the differentiation of monocytes into macrophages." Blood. 100(13):4446-4453. PMID:12393560
  14. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  15. [ + ] Zermati Y, et al. (2001) "Caspase activation is required for terminal erythroid differentiation." J Exp Med. 193(2):247-254. PMID:11208865
  16. [ + ] Sahara S, et al. (1999) "Acinus is a caspase-3-activated protein required for apoptotic chromatin condensation." Nature. 401(6749):168-173. PMID:10490026
  17. [ + ] Ishikawa K, et al. (1998) "Prediction of the coding sequences of unidentified human genes. X. The complete sequences of 100 new cDNA clones from brain which can code for large proteins in vitro." DNA Res. 5(3):169-176. PMID:9734811