ABLIM3 | GeneID:22885 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 22885 Official Symbol ABLIM3
Locus N/A Gene Type protein-coding
Synonyms HMFN1661
Full Name actin binding LIM protein family, member 3
Description actin binding LIM protein family, member 3
Chromosome 5q33.1
Also Known As
Summary The LIM domain is a double zinc finger structure that promotes protein-protein interactions. LIM domain proteins, such as ABLIM3, play roles in embryonic development, cell lineage determination, and cancer (Krupp et al., 2006 [PubMed 16328021]).[supplied by OMIM]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 69175

ID Symbol Protein Species
GeneID:22885 ABLIM3 NP_055760.1 Homo sapiens
GeneID:307395 Ablim3 XP_225889.3 Rattus norvegicus
GeneID:319713 Ablim3 NP_941051.2 Mus musculus
GeneID:416201 ABLIM3 XP_414527.2 Gallus gallus
GeneID:566821 zgc:158673 NP_001074067.1 Danio rerio
GeneID:612309 ABLIM3 XP_855146.1 Canis lupus familiaris
GeneID:613794 ABLIM3 XP_871015.2 Bos taurus
GeneID:741703 ABLIM3 XP_001162953.1 Pan troglodytes
GeneID:100005712 LOC100005712 XP_001340859.2 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab67721 ABLIM3 antibody (ab67721); Mouse polyclonal to ABLIM3
2 sigma HPA003245 Anti-ABLIM3 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABLIM3 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABLIM3 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0003779 Function actin binding
GO:0046872 Function metal ion binding
GO:0008270 Function zinc ion binding
GO:0007010 Process cytoskeleton organization
GO:0045944 Process positive regulation of transcription from RNA polymerase II promoter

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_014945  UCSC Browser NP_055760

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000309868 MI0000807 hsa-miR-323-3p CACAUUACACGGUCGACCUCU
ENST00000309868 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENST00000309868 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENST00000309868 MI0003145 hsa-miR-519e* UUCUCCAAAAGGGAGCACUUUC
ENST00000309868 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENST00000309868 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
pirinixic acid
  • pirinixic acid results in increased expression of ABLIM3 mRNA
18301758
Raloxifene
  • Raloxifene affects the expression of ABLIM3 mRNA
14699072
Tamoxifen
  • Tamoxifen affects the expression of ABLIM3 mRNA
14699072
testosterone enanthate
  • testosterone enanthate affects the expression of ABLIM3 mRNA
17440010

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
HIV Wasting Syndrome inferred via testosterone enanthate 17440010
Breast Neoplasms inferred via Tamoxifen 16202921, 17242785, 15668708, 17440819, 17893378, 17261762, 17049068, 16873071, 16818667, 11161223, 15565566
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 14580682, 16827153
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Albuminuria inferred via Raloxifene 17308373, 17451421
Alzheimer Disease inferred via Raloxifene 15800139
Brain Injuries inferred via Raloxifene 16580743
Breast Neoplasms inferred via Raloxifene 17242785, 15758505, 17595753, 16837676, 15775269, 17440819, 16912660, 17893378, 17952589, 17261762, 15572757, 17049068
Carcinoma, Transitional Cell inferred via Raloxifene 17572228
Cardiovascular Diseases inferred via Raloxifene 15775269
Cognition Disorders inferred via Raloxifene 15800139
Depressive Disorder, Major inferred via Raloxifene 17474826
Diabetic Nephropathies inferred via Raloxifene 17308373, 17451421, 15920148
Edema inferred via Raloxifene 15860553
Encephalomyelitis, Autoimmune, Experimental inferred via Raloxifene 15845917
Fatty Liver inferred via Raloxifene 17473493
Heart Diseases inferred via Raloxifene 11110106
Hypertension inferred via Raloxifene 15787275, 17577099
Leiomyoma inferred via Raloxifene 16973256
Mixed Tumor, Mullerian inferred via Raloxifene 15863610
Multiple Myeloma inferred via Raloxifene 16497877
Myxoma inferred via Raloxifene 16343187
Osteoporosis inferred via Raloxifene 15775268, 17882678
Osteoporosis, Postmenopausal inferred via Raloxifene 15758505, 17823083, 17893378, 15579764
Prostatic Neoplasms inferred via Raloxifene 16220300, 16536755, 15731164
Purpura inferred via Raloxifene 15770314
Stroke inferred via Raloxifene 16837676
Urinary Bladder Neoplasms inferred via Raloxifene 17572228
Venous Thromboembolism inferred via Raloxifene 16837676
Vulvar Neoplasms inferred via Raloxifene 16343187
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ACTC ABLIM3 / ACTC Affinity Capture-Western Zheng B (2004)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Barrientos T, et al. (2007) "Two novel members of the ABLIM protein family, ABLIM-2 and -3, associate with STARS and directly bind F-actin." J Biol Chem. 282(11):8393-8403. PMID:17194709
  2. [ + ] Krupp M, et al. (2006) "Actin binding LIM protein 3 (abLIM3)." Int J Mol Med. 17(1):129-133. PMID:16328021
  3. [ + ] Olsen JV, et al. (2006) "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell. 127(3):635-648. PMID:17081983
  4. [ + ] Mehrle A, et al. (2006) "The LIFEdb database in 2006." Nucleic Acids Res. 34(Database issue):D415-D418. PMID:16381901
  5. [ + ] Zheng B, et al. (2004) "hhLIM protein is involved in cardiac hypertrophy." Biochim Biophys Acta. 1690(1):1-10. PMID:15337165
  6. [ + ] Yamada S, et al. (2004) "Expression profiling and differential screening between hepatoblastomas and the corresponding normal livers: identification of high expression of the PLK1 oncogene as a poor-prognostic indicator of hepatoblastomas." Oncogene. 23(35):5901-5911. PMID:15221005
  7. [ + ] Suzuki Y, et al. (2004) "Sequence comparison of human and mouse genes reveals a homologous block structure in the promoter regions." Genome Res. 14(9):1711-1718. PMID:15342556
  8. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  9. [ + ] Wiemann S, et al. (2004) "From ORFeome to biology: a functional genomics pipeline." Genome Res. 14(10B):2136-2144. PMID:15489336
  10. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  11. [ + ] Wiemann S, et al. (2001) "Toward a catalog of human genes and proteins: sequencing and analysis of 500 novel complete protein coding human cDNAs." Genome Res. 11(3):422-435. PMID:11230166
  12. [ + ] Hartley JL, et al. (2000) "DNA cloning using in vitro site-specific recombination." Genome Res. 10(11):1788-1795. PMID:11076863
  13. [ + ] Nagase T, et al. (1998) "Prediction of the coding sequences of unidentified human genes. XII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro." DNA Res. 5(6):355-364. PMID:10048485
  14. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  15. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298