FKBP3 | GeneID:2287 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2287 Official Symbol FKBP3
Locus N/A Gene Type protein-coding
Synonyms FKBP-25; PPIase
Full Name FK506 binding protein 3, 25kDa
Description FK506 binding protein 3, 25kDa
Chromosome 14q21.3
Also Known As FK506 binding protein 3 (25kD); FK506-binding protein 25, T-cell; FK506-binding protein 3 (25kD); peptidyl-prolyl cis-trans isomerase; rapamycin binding protein; rapamycin-selective 25 kDa immunophilin; rotamase
Summary The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin, as well as histone deacetylases, the transcription factor YY1, casein kinase II, and nucleolin. It has a higher affinity for rapamycin than for FK506 and thus may be an important target molecule for immunosuppression by rapamycin. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 1525

ID Symbol Protein Species
GeneID:2287 FKBP3 NP_002004.1 Homo sapiens
GeneID:30795 Fkbp3 NP_038930.1 Mus musculus
GeneID:299104 Fkbp3 XP_216717.1 Rattus norvegicus
GeneID:368863 fkbp3 NP_001004519.1 Danio rerio
GeneID:395353 FKBP3 NP_989972.1 Gallus gallus
GeneID:452883 FKBP3 XP_509926.1 Pan troglodytes
GeneID:480306 FKBP3 XP_537428.1 Canis lupus familiaris
GeneID:515069 FKBP3 NP_001033201.1 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab38688 FKBP25 antibody (ab38688); Rabbit polyclonal to FKBP25
2 abcam ab16654 FKBP25 antibody (ab16654); Rabbit polyclonal to FKBP25
3 abcam ab50750 FKBP25 antibody [2364C3] (ab50750); Mouse monoclonal [2364C3] to FKBP25
4 abgent AP2784b FKBP3 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
5 abgent AP2784c FKBP3 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
6 acris AP12432PU-N FKBP3 / FKBP25 (C-term); antibody Ab
7 acris AP12433PU-N FKBP3 / FKBP25 (Center); antibody Ab
8 scbt FKBP3 FKBP3 Antibody / FKBP3 Antibodies;
9 sigma HPA000864 Anti-FKBP3 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of FKBP3 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FKBP3 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005634 Component nucleus
GO:0005528 Function FK506 binding
GO:0016853 Function isomerase activity
GO:0003755 Function peptidyl-prolyl cis-trans isomerase activity
GO:0004872 Function receptor activity
GO:0006457 Process protein folding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_002013  UCSC Browser NP_002004 B2R4Q9   Q00688  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000216330 MI0000060 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000216330 MI0000061 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000216330 MI0000062 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000216330 MI0000063 hsa-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENST00000216330 MI0000064 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENST00000216330 MI0000065 hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENST00000216330 MI0000066 hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENST00000216330 MI0000067 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000216330 MI0000068 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000216330 MI0000433 hsa-let-7g UGAGGUAGUAGUUUGUACAGUU
ENST00000216330 MI0000434 hsa-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENST00000216330 MI0000113 hsa-miR-106a* CUGCAAUGUAAGCACUUCUUAC
ENST00000216330 MI0000748 hsa-miR-130b* ACUCUUUCCCUGUUGCACUAC
ENST00000216330 MI0000457 hsa-miR-141* CAUCUUCCAGUACAGUGUUGGA
ENST00000216330 MI0000459 hsa-miR-143 UGAGAUGAAGCACUGUAGCUC
ENST00000216330 MI0000461 hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENST00000216330 MI0000253 hsa-miR-148a* AAAGUUCUGAGACACUCCGACU
ENST00000216330 MI0000809 hsa-miR-151-3p CUAGACUGAAGCUCCUUGAGG
ENST00000216330 MI0000070 hsa-miR-16-1* CCAGUAUUAACUGUGCUGCUGA
ENST00000216330 MI0000732 hsa-miR-194* CCAGUGGGGCUGCUGUUAUCUG
ENST00000216330 MI0000242 hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENST00000216330 MI0000281 hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENST00000216330 MI0000242 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000216330 MI0000281 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000216330 MI0000282 hsa-miR-199b-5p CCCAGUGUUUAGACUAUCUGUUC
ENST00000216330 MI0000073 hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENST00000216330 MI0000073 hsa-miR-19a* AGUUUUGCAUAGUUGCACUACA
ENST00000216330 MI0000296 hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG
ENST00000216330 MI0000078 hsa-miR-22* AGUUCUUCAGUGGCAAGCUUUA
ENST00000216330 MI0000083 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000216330 MI0000750 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000216330 MI0000744 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
ENST00000216330 MI0000088 hsa-miR-30a UGUAAACAUCCUCGACUGGAAG
ENST00000216330 MI0000088 hsa-miR-30a* CUUUCAGUCGGAUGUUUGCAGC
ENST00000216330 MI0000441 hsa-miR-30b UGUAAACAUCCUACACUCAGCU
ENST00000216330 MI0000254 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000216330 MI0000736 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000216330 MI0000255 hsa-miR-30d UGUAAACAUCCCCGACUGGAAG
ENST00000216330 MI0000255 hsa-miR-30d* CUUUCAGUCAGAUGUUUGCUGC
ENST00000216330 MI0000749 hsa-miR-30e UGUAAACAUCCUUGACUGGAAG
ENST00000216330 MI0000749 hsa-miR-30e* CUUUCAGUCGGAUGUUUACAGC
ENST00000216330 MI0000814 hsa-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENST00000216330 MI0000268 hsa-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENST00000216330 MI0000762 hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU
ENST00000216330 MI0000775 hsa-miR-367* ACUGUUGCUAAUAUGCAACUCU
ENST00000216330 MI0000781 hsa-miR-373* ACUCAAAAUGGGGGCGCUUUCC
ENST00000216330 MI0000782 hsa-miR-374a UUAUAAUACAACCUGAUAAGUG
ENST00000216330 MI0005531 hsa-miR-450b-3p UUGGGAUCAUUUUGCAUCCAUA
ENST00000216330 MI0005531 hsa-miR-450b-5p UUUUGCAAUAUGUUCCUGAAUA
ENST00000216330 MI0003135 hsa-miR-495 AAACAAACAUGGUGCACUUCUU
ENST00000216330 MI0003136 hsa-miR-496 UGAGUAUUACAUGGCCAAUCUC
ENST00000216330 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENST00000216330 MI0003169 hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG
ENST00000216330 MI0003686 hsa-miR-542-5p UCGGGGAUCAUCAUGUCACGAGA
ENST00000216330 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENST00000216330 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENST00000216330 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU
ENST00000216330 MI0003569 hsa-miR-563 AGGUUGACAUACGUUUCCC
ENST00000216330 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENST00000216330 MI0003602 hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENST00000216330 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENST00000216330 MI0003629 hsa-miR-616* ACUCAAAACCCUUCAGUGACUU
ENST00000216330 MI0003643 hsa-miR-629 UGGGUUUACGUUGGGAGAACU
ENST00000216330 MI0003644 hsa-miR-630 AGUAUUCUGUACCAGGGAAGGU
ENST00000216330 MI0003648 hsa-miR-633 CUAAUAGUAUCUACCACAAUAAA
ENST00000216330 MI0003906 hsa-miR-802 CAGUAACAAAGAUUCAUCCUUGU
ENST00000216330 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENST00000216330 MI0002399 mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA
ENST00000216330 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENST00000216330 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000216330 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000216330 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000216330 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENST00000216330 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENST00000216330 MI0004647 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENST00000216330 MI0004648 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENST00000216330 MI0004660 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENST00000216330 MI0004661 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENST00000216330 MI0004685 mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
4-anisidine
  • 4-anisidine results in increased expression of FKBP3 mRNA
12929121
Alendronate
  • Alendronate affects the expression of FKBP3 mRNA
16079270
alpha-hexachlorocyclohexane
  • alpha-hexachlorocyclohexane results in increased expression of FKBP3 mRNA
17785943
Clofibric Acid
  • Clofibric Acid affects the expression of FKBP3 mRNA
17602206
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of FKBP3 mRNA
16079270
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of FKBP3 mRNA
17557909
Hydroxyurea
  • Hydroxyurea results in increased expression of FKBP3 mRNA
12929121
Lindane
  • Lindane affects the expression of FKBP3 mRNA
17785943
Paclitaxel
  • Paclitaxel results in increased expression of FKBP3 mRNA
12929121
Raloxifene
  • Raloxifene affects the expression of FKBP3 mRNA
16079270

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Albuminuria inferred via Raloxifene 17308373, 17451421
Alzheimer Disease inferred via Raloxifene 15800139
Brain Injuries inferred via Raloxifene 16580743
Breast Neoplasms inferred via Raloxifene 17242785, 15775269, 17440819, 16912660, 16837676, 17893378, 17595753, 17952589, 15758505, 15572757, 17261762, 17049068
Carcinoma, Transitional Cell inferred via Raloxifene 17572228
Cardiovascular Diseases inferred via Raloxifene 15775269
Cognition Disorders inferred via Raloxifene 15800139
Depressive Disorder, Major inferred via Raloxifene 17474826
Diabetic Nephropathies inferred via Raloxifene 17308373, 15920148, 17451421
Edema inferred via Raloxifene 15860553
Encephalomyelitis, Autoimmune, Experimental inferred via Raloxifene 15845917
Fatty Liver inferred via Raloxifene 17473493
Heart Diseases inferred via Raloxifene 11110106
Hypertension inferred via Raloxifene 15787275, 17577099
Leiomyoma inferred via Raloxifene 16973256
Mixed Tumor, Mullerian inferred via Raloxifene 15863610
Multiple Myeloma inferred via Raloxifene 16497877
Myxoma inferred via Raloxifene 16343187
Osteoporosis inferred via Raloxifene 15775268, 17882678
Osteoporosis, Postmenopausal inferred via Raloxifene 15758505, 15579764, 17893378, 17823083
Prostatic Neoplasms inferred via Raloxifene 16220300, 16536755, 15731164
Purpura inferred via Raloxifene 15770314
Stroke inferred via Raloxifene 16837676
Urinary Bladder Neoplasms inferred via Raloxifene 17572228
Venous Thromboembolism inferred via Raloxifene 16837676
Vulvar Neoplasms inferred via Raloxifene 16343187
Breast Neoplasms inferred via Paclitaxel 16244791, 18234424, 18323546, 15136595, 11325840
Carcinoma, Hepatocellular inferred via Paclitaxel 16313753
Liposarcoma inferred via Paclitaxel 17353645
Lymphoma, Non-Hodgkin inferred via Paclitaxel 14749477
Melanoma inferred via Paclitaxel 16342250, 12040289
Multiple Myeloma inferred via Paclitaxel 14749477
Ovarian Neoplasms inferred via Paclitaxel 11161223
Prostatic Neoplasms inferred via Paclitaxel 16356831, 17136230, 16729912
Agricultural Workers' Diseases inferred via Lindane 12661182
Breast Neoplasms inferred via Lindane 14688026
Neoplasms inferred via Lindane 16818664, 12807735
Prostatic Neoplasms inferred via Lindane 14688026, 12661182
Seizures inferred via Lindane 7539098
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16919318, 17681005, 16105132, 11677210, 15861022, 17333356
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Liver Neoplasms inferred via Clofibric Acid 17602206
Osteoporosis inferred via Alendronate 17882678

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
HDAC1 FKBP3 / HDAC1 Affinity Capture-Western Yang WM (2001)
HDAC1 HDAC1 / FKBP3 Affinity Capture-Western Yang WM (2001)
HDAC2 FKBP3 / HDAC2 Affinity Capture-Western Yang WM (2001)
HDAC2 HDAC2 / FKBP3 Affinity Capture-Western Yang WM (2001)
MTA2 FKBP3 / MTA2 Reconstituted Complex Yao YL (2003)
YY1 FKBP3 / YY1 Affinity Capture-Western Yang WM (2001)
YY1 YY1 / FKBP3 Affinity Capture-Western Yang WM (2001)
YY1 FKBP3 / YY1 Reconstituted Complex Yang WM (2001)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ochocka AM, et al. (2009) "FKBP25, a novel regulator of the p53 pathway, induces the degradation of MDM2 and activation of p53." FEBS Lett. 583(4):621-626. PMID:19166840
  2. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  3. [ + ] Won J, et al. (2005) "A magnetic nanoprobe technology for detecting molecular interactions in live cells." Science. 309(5731):121-125. PMID:15994554
  4. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  5. [ + ] Brandenberger R, et al. (2004) "Transcriptome characterization elucidates signaling networks that control human ES cell growth and differentiation." Nat Biotechnol. 22(6):707-716. PMID:15146197
  6. [ + ] Yao YL, et al. (2003) "The metastasis-associated proteins 1 and 2 form distinct protein complexes with histone deacetylase activity." J Biol Chem. 278(43):42560-42568. PMID:12920132
  7. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  8. [ + ] Meng X, et al. (2002) "Cloning and identification of a novel cDNA which may be associated with FKBP25." Biochem Genet. 40(9-10):303-310. PMID:12392168
  9. [ + ] Yang WM, et al. (2001) "The FK506-binding protein 25 functionally associates with histone deacetylases and with transcription factor YY1." EMBO J. 20(17):4814-4825. PMID:11532945
  10. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  11. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298
  12. [ + ] Cross SH, et al. (1994) "Purification of CpG islands using a methylated DNA binding column." Nat Genet. 6(3):236-244. PMID:8012384
  13. [ + ] Jin YJ, et al. (1993) "The 25-kDa FK506-binding protein is localized in the nucleus and associates with casein kinase II and nucleolin." Proc Natl Acad Sci U S A. 90(16):7769-7773. PMID:7689229
  14. [ + ] Jin YJ, et al. (1992) "Molecular cloning of a 25-kDa high affinity rapamycin binding protein, FKBP25." J Biol Chem. 267(16):10942-10945. PMID:1375932
  15. [ + ] Porat R, et al. (1992) "Interleukin-1 (IL-1) receptor blockade reduces endotoxin and Borrelia burgdorferi-stimulated IL-8 synthesis in human mononuclear cells." FASEB J. 6(7):2482-2486. PMID:1532945
  16. [ + ] Wiederrecht G, et al. (1992) "Isolation of a human cDNA encoding a 25 kDa FK-506 and rapamycin binding protein." Biochem Biophys Res Commun. 185(1):298-303. PMID:1376117
  17. [ + ] Hung DT, et al. (1992) "cDNA cloning of a human 25 kDa FK506 and rapamycin binding protein." Biochem Biophys Res Commun. 184(2):733-738. PMID:1374240