FKBP1B | GeneID:2281 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2281 Official Symbol FKBP1B
Locus N/A Gene Type protein-coding
Synonyms FKBP12.6; FKBP1L; OTK4; PKBP1L; PPIase
Full Name FK506 binding protein 1B, 12.6 kDa
Description FK506 binding protein 1B, 12.6 kDa
Chromosome 2p23.3
Also Known As FK506-binding protein 1-like; FK506-binding protein 12.6; OTTHUMP00000116040; OTTHUMP00000116041; calstabin 2; immunophilin FKBP12.6; peptidyl-prolyl cis-trans isomerase; rotamase
Summary The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It is highly similar to the FK506-binding protein 1A. Its physiological role is thought to be in excitation-contraction coupling in cardiac muscle. There are two alternatively spliced transcript variants of this gene encoding different isoforms. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68380

ID Symbol Protein Species
GeneID:2281 FKBP1B NP_004107.1 Homo sapiens
GeneID:14226 Fkbp1b NP_058559.3 Mus musculus
GeneID:393785 fkbp1b NP_957106.1 Danio rerio
GeneID:395254 FKBP1B NP_989898.1 Gallus gallus
GeneID:612965 FKBP1B XP_853461.1 Canis lupus familiaris
GeneID:741549 FKBP1B XP_001144201.1 Pan troglodytes
GeneID:785179 FKBP1B XP_001252956.1 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab58075 FKBP1B antibody (ab58075); Mouse monoclonal to FKBP1B
2 abgent AP7868a FKBP1B Antibody (N-term E6); Purified Rabbit Polyclonal Antibody (Pab)
3 abnova H00002281-M01 FKBP1B monoclonal antibody (M01), clone 4H5-1B6; Mouse monoclonal antibody raised against a full length recombinant FKBP1B.
4 acris AP14715PU-N FKBP1B (N-term); antibody Ab
5 acris AP17382PU-N FKBP1B N-term; antibody Ab
6 scbt FKBP1B FKBP1B Antibody / FKBP1B Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of FKBP1B Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FKBP1B Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0034704 Component calcium channel complex
GO:0005737 Component cytoplasm
GO:0005829 Component cytosol
GO:0005528 Function FK506 binding
GO:0016853 Function isomerase activity
GO:0003755 Function peptidyl-prolyl cis-trans isomerase activity
GO:0005102 Function receptor binding
GO:0005219 Function ryanodine-sensitive calcium-release channel activity
GO:0006458 Process 'de novo' protein folding
GO:0006936 Process muscle contraction
GO:0010459 Process negative regulation of heart rate
GO:0032513 Process negative regulation of protein phosphatase type 2B activity
GO:0022417 Process protein maturation by protein folding
GO:0042026 Process protein refolding
GO:0032234 Process regulation of calcium ion transport via store-operated calcium channel activity
GO:0010881 Process regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion
GO:0060314 Process regulation of ryanodine-sensitive calcium-release channel activity
GO:0051775 Process response to redox state

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_004116  UCSC Browser NP_004107 Q53TM2   P68106  
2 NM_054033  UCSC Browser NP_473374

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000380986 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENST00000380986 MI0000060 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000380986 MI0000061 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000380986 MI0000062 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000380986 MI0000063 hsa-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENST00000380986 MI0000064 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENST00000380986 MI0000065 hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENST00000380986 MI0000066 hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENST00000380986 MI0000067 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000380986 MI0000068 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000380986 MI0000433 hsa-let-7g UGAGGUAGUAGUUUGUACAGUU
ENST00000380986 MI0000434 hsa-let-7i* CUGCGCAAGCUACUGCCUUGCU
ENST00000380986 MI0000442 hsa-miR-122* AACGCCAUUAUCACACUAAAUA
ENST00000380986 MI0000469 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA
ENST00000380986 MI0000474 hsa-miR-134 UGUGACUGGUUGACCAGAGGGG
ENST00000380986 MI0000455 hsa-miR-138-2* GCUAUUUCACGACACCAGGGUU
ENST00000380986 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENST00000380986 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENST00000380986 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENST00000380986 MI0000478 hsa-miR-149 UCUGGCUCCGUGUCUUCACUCCC
ENST00000380986 MI0000480 hsa-miR-154* AAUCAUACACGGUUGACCUAUU
ENST00000380986 MI0000681 hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGGU
ENST00000380986 MI0000438 hsa-miR-15b UAGCAGCACAUCAUGGUUUACA
ENST00000380986 MI0000070 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000380986 MI0000115 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000380986 MI0000465 hsa-miR-191 CAACGGAAUCCCAAAAGCAGCUG
ENST00000380986 MI0000737 hsa-miR-200a UAACACUGUCUGGUAACGAUGU
ENST00000380986 MI0000342 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGA
ENST00000380986 MI0000650 hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENST00000380986 MI0000283 hsa-miR-203 GUGAAAUGUUUAGGACCACUAG
ENST00000380986 MI0000293 hsa-miR-217 UACUGCAUCAGGAACUGAUUGGA
ENST00000380986 MI0000440 hsa-miR-27b* AGAGCUUAGCUGAUUGGUGAAC
ENST00000380986 MI0000738 hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA
ENST00000380986 MI0000772 hsa-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENST00000380986 MI0000773 hsa-miR-302c UAAGUGCUUCCAUGUUUCAGUGG
ENST00000380986 MI0000774 hsa-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENST00000380986 MI0000816 hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU
ENST00000380986 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENST00000380986 MI0000802 hsa-miR-340* UCCGUCUCAGUUACUUUAUAGC
ENST00000380986 MI0000805 hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU
ENST00000380986 MI0000268 hsa-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENST00000380986 MI0000742 hsa-miR-34b* UAGGCAGUGUCAUUAGCUGAUUG
ENST00000380986 MI0000743 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC
ENST00000380986 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENST00000380986 MI0000781 hsa-miR-373* ACUCAAAAUGGGGGCGCUUUCC
ENST00000380986 MI0000785 hsa-miR-377 AUCACACAAAGGCAACUUUUGU
ENST00000380986 MI0001648 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENST00000380986 MI0003673 hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
ENST00000380986 MI0002471 hsa-miR-487a AAUCAUACAGGGACAUCCAGUU
ENST00000380986 MI0003530 hsa-miR-487b AAUCGUACAGGGUCAUCCACUU
ENST00000380986 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENST00000380986 MI0003142 hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC
ENST00000380986 MI0003161 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU
ENST00000380986 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENST00000380986 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000380986 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000380986 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENST00000380986 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENST00000380986 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENST00000380986 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENST00000380986 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENST00000380986 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENST00000380986 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENST00000380986 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENST00000380986 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENST00000380986 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENST00000380986 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENST00000380986 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENST00000380986 MI0003644 hsa-miR-630 AGUAUUCUGUACCAGGGAAGGU
ENST00000380986 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENST00000380986 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENST00000380986 MI0003676 hsa-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENST00000380986 MI0003676 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC
ENST00000380986 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENST00000380986 MI0005534 hsa-miR-891b UGCAACUUACCUGAGUCAUUGA
ENST00000380986 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENST00000380986 MI0005714 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC
ENST00000380986 MI0000100 hsa-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENST00000380986 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENST00000380986 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENST00000380986 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENST00000380986 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENST00000380986 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENST00000380986 MI0004635 mmu-miR-678 GUCUCGGUGCAAGGACUGGAGG
ENST00000380986 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENST00000380986 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENST00000380986 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA
ENST00000380991 MI0000060 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000380991 MI0000061 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000380991 MI0000062 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000380991 MI0000063 hsa-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENST00000380991 MI0000064 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENST00000380991 MI0000065 hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENST00000380991 MI0000066 hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENST00000380991 MI0000067 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000380991 MI0000068 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000380991 MI0000433 hsa-let-7g UGAGGUAGUAGUUUGUACAGUU
ENST00000380991 MI0000434 hsa-let-7i* CUGCGCAAGCUACUGCCUUGCU
ENST00000380991 MI0000469 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA
ENST00000380991 MI0000449 hsa-miR-132* ACCGUGGCUUUCGAUUGUUACU
ENST00000380991 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENST00000380991 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENST00000380991 MI0000650 hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENST00000380991 MI0000300 hsa-miR-223 UGUCAGUUUGUCAAAUACCCCA
ENST00000380991 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENST00000380991 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENST00000380991 MI0000805 hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU
ENST00000380991 MI0000268 hsa-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENST00000380991 MI0000742 hsa-miR-34b* UAGGCAGUGUCAUUAGCUGAUUG
ENST00000380991 MI0000743 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC
ENST00000380991 MI0000785 hsa-miR-377 AUCACACAAAGGCAACUUUUGU
ENST00000380991 MI0001648 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENST00000380991 MI0003673 hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
ENST00000380991 MI0003530 hsa-miR-487b AAUCGUACAGGGUCAUCCACUU
ENST00000380991 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENST00000380991 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENST00000380991 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENST00000380991 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENST00000380991 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENST00000380991 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENST00000380991 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENST00000380991 MI0003676 hsa-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENST00000380991 MI0003676 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC
ENST00000380991 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENST00000380991 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AF322070   BC002614   BC050998   BF969580   CR614690   CR616275   CR626535   D38037   L37086   NM_004116   NM_054033   S69800   S69815  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of FKBP1B mRNA
17562736
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of FKBP1B mRNA
17484886
nickel sulfate
  • nickel sulfate results in decreased expression of FKBP1B mRNA
16780908
Tacrolimus
  • Tacrolimus binds to FKBP1B protein
16648664

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Duodenal Ulcer inferred via Tacrolimus 17202747
Graft vs Host Disease inferred via Tacrolimus 16376943
Neurodegenerative Diseases inferred via Tacrolimus 15081597
Dermatitis, Allergic Contact inferred via nickel sulfate 16780908
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16097048, 16050911, 15673190, 16011737, 15700767, 16124888, 16227642, 10355542
Fatty Liver inferred via Carbon Tetrachloride 16045604, 16239168, 12795759, 61145, 12631006, 17595544, 15959796
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15027814, 15968718, 16227642, 15998439, 16177239, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 17334410, 16943688, 16221502, 16239168
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 17525996, 17557913, 18156304, 16638106, 18418968, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 12666154, 18395095, 17976157, 17805973, 16248980, 15925388, 16116963
Liver Diseases inferred via Carbon Tetrachloride 16246199, 16964402, 17285989, 15830285, 15720792
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16177239, 15968718, 16227642, 14986274, 16081117, 17522070, 17562736
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
BMPR1A BMPR1A / FKBP1B Two-hybrid Nishanian TG (2004)
RYR2 FKBP1B / RYR2 Reconstituted Complex Masumiya H (2003)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Zissimopoulos S, et al. (2009) "FKBP12.6 binding of ryanodine receptors carrying mutations associated with arrhythmogenic cardiac disease." Biochem J. 419(2):273-278. PMID:19226252
  2. [ + ] Zissimopoulos S, et al. (2007) "Redox sensitivity of the ryanodine receptor interaction with FK506-binding protein." J Biol Chem. 282(10):6976-6983. PMID:17200109
  3. [ + ] Xiao J, et al. (2007) "Removal of FKBP12.6 does not alter the conductance and activation of the cardiac ryanodine receptor or the susceptibility to stress-induced ventricular arrhythmias." J Biol Chem. 282(48):34828-34838. PMID:17921453
  4. [ + ] Na T, et al. (2007) "Abrupt changes in FKBP12.6 and SERCA2a expression contribute to sudden occurrence of ventricular fibrillation on reperfusion and are prevented by CPU86017." Acta Pharmacol Sin. 28(6):773-782. PMID:17506935
  5. [ + ] Hunt DJ, et al. (2007) "K201 (JTV519) suppresses spontaneous Ca2+ release and [3H]ryanodine binding to RyR2 irrespective of FKBP12.6 association." Biochem J. 404(3):431-438. PMID:17313373
  6. [ + ] Aizawa Y, et al. (2005) "A novel mutation in FKBP12.6 binding region of the human cardiac ryanodine receptor gene (R2401H) in a Japanese patient with catecholaminergic polymorphic ventricular tachycardia." Int J Cardiol. 99(2):343-345. PMID:15749201
  7. [ + ] Nakazawa T, et al. (2005) "Genomic organization, chromosomal localization, and promoter of human gene for FK506-binding protein 12.6." Gene. 360(1):55-64. PMID:16122887
  8. [ + ] Won J, et al. (2005) "A magnetic nanoprobe technology for detecting molecular interactions in live cells." Science. 309(5731):121-125. PMID:15994554
  9. [ + ] Wehrens XH, et al. (2005) "Enhancing calstabin binding to ryanodine receptors improves cardiac and skeletal muscle function in heart failure." Proc Natl Acad Sci U S A. 102(27):9607-9612. PMID:15972811
  10. [ + ] Zissimopoulos S, et al. (2005) "Interaction of FKBP12.6 with the cardiac ryanodine receptor C-terminal domain." J Biol Chem. 280(7):5475-5485. PMID:15591045
  11. [ + ] Nishanian TG, et al. (2004) "Interaction of the BMPR-IA tumor suppressor with a developmentally relevant splicing factor." Biochem Biophys Res Commun. 323(1):91-97. PMID:15351706
  12. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  13. [ + ] Maalej A, et al. (2004) "Evidence of association between FKBP1B and thyroid autoimmune disorders in a large Tunisian family." Autoimmunity. 37(3):237-239. PMID:15497458
  14. [ + ] Benjafield AV, et al. (2003) "Association of EDNRA, but not WNK4 or FKBP1B, polymorphisms with essential hypertension." Clin Genet. 64(5):433-438. PMID:14616768
  15. [ + ] Masumiya H, et al. (2003) "Localization of the 12.6-kDa FK506-binding protein (FKBP12.6) binding site to the NH2-terminal domain of the cardiac Ca2+ release channel (ryanodine receptor)." J Biol Chem. 278(6):3786-3792. PMID:12446682
  16. [ + ] George CH, et al. (2003) "In situ modulation of the human cardiac ryanodine receptor (hRyR2) by FKBP12.6." Biochem J. 370(Pt 2):579-589. PMID:12443530
  17. [ + ] George CH, et al. (2003) "Dysregulated ryanodine receptors mediate cellular toxicity: restoration of normal phenotype by FKBP12.6." J Biol Chem. 278(31):28856-28864. PMID:12754204
  18. [ + ] Tiso N, et al. (2002) "The binding of the RyR2 calcium channel to its gating protein FKBP12.6 is oppositely affected by ARVD2 and VTSIP mutations." Biochem Biophys Res Commun. 299(4):594-598. PMID:12459180
  19. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  20. [ + ] Jeyakumar LH, et al. (2001) "FKBP binding characteristics of cardiac microsomes from diverse vertebrates." Biochem Biophys Res Commun. 281(4):979-986. PMID:11237759
  21. [ + ] Schiene-Fischer C, et al. (2001) "Receptor accessory folding helper enzymes: the functional role of peptidyl prolyl cis/trans isomerases." FEBS Lett. 495(1-2):1-6. PMID:11322937
  22. [ + ] Marx SO, et al. (2000) "PKA phosphorylation dissociates FKBP12.6 from the calcium release channel (ryanodine receptor): defective regulation in failing hearts." Cell. 101(4):365-376. PMID:10830164
  23. [ + ] Deivanayagam CC, et al. (2000) "Structure of FKBP12.6 in complex with rapamycin." Acta Crystallogr D Biol Crystallogr. 56(Pt 3):266-271. PMID:10713512
  24. [ + ] Noguchi N, et al. (1997) "Cyclic ADP-ribose binds to FK506-binding protein 12.6 to release Ca2+ from islet microsomes." J Biol Chem. 272(6):3133-3136. PMID:9013543
  25. [ + ] Lam E, et al. (1995) "A novel FK506 binding protein can mediate the immunosuppressive effects of FK506 and is associated with the cardiac ryanodine receptor." J Biol Chem. 270(44):26511-26522. PMID:7592869
  26. [ + ] Arakawa H, et al. (1994) "Molecular cloning and expression of a novel human gene that is highly homologous to human FK506-binding protein 12kDa (hFKBP-12) and characterization of two alternatively spliced transcripts." Biochem Biophys Res Commun. 200(2):836-843. PMID:7513996