FKBP1A | GeneID:2280 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2280 Official Symbol FKBP1A
Locus RP11-314N13.2 Gene Type protein-coding
Synonyms FKBP-12; FKBP1; FKBP12; FKBP12C; PKC12; PKCI2; PPIASE
Full Name FK506 binding protein 1A, 12kDa
Description FK506 binding protein 1A, 12kDa
Chromosome 20p13
Also Known As FK506-binding protein 1; FK506-binding protein 12; FK506-binding protein 1A (12kD); FK506-binding protein, T-cell, 12-kD; OTTHUMP00000029978; immunophilin FKBP12; peptidyl-prolyl cis-trans isomerase; protein kinase C inhibitor 2; rotamase
Summary The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It interacts with several intracellular signal transduction proteins including type I TGF-beta receptor. It also interacts with multiple intracellular calcium release channels, and coordinates multi-protein complex formation of the tetrameric skeletal muscle ryanodine receptor. In mouse, deletion of this homologous gene causes congenital heart disorder known as noncompaction of left ventricular myocardium. Multiple alternatively spliced variants, encoding the same protein, have been identified. The human genome contains five pseudogenes related to this gene, at least one of which is transcribed. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 105139

ID Symbol Protein Species
GeneID:2280 FKBP1A NP_000792.1 Homo sapiens
GeneID:14225 Fkbp1a NP_032045.1 Mus musculus
GeneID:25639 Fkbp1a XP_001053006.1 Rattus norvegicus
GeneID:539546 FKBP1A XP_587992.2 Bos taurus
GeneID:608169 FKBP1A XP_851390.1 Canis lupus familiaris
GeneID:749347 FKBP1A XP_001167897.1 Pan troglodytes

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab58072 FKBP12 antibody (ab58072); Mouse monoclonal to FKBP12
2 abcam ab24373 FKBP12 antibody (ab24373); Rabbit polyclonal to FKBP12
3 abcam ab2918 FKBP12 antibody (ab2918); Rabbit polyclonal to FKBP12
4 abgent AP7756c FKBP12 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
5 abnova H00002280-M01 FKBP1A monoclonal antibody (M01), clone 1E5-A12; Mouse monoclonal antibody raised against a full length recombinant FKBP1A.
6 acris SP5112P FKBP1A / FKBP12; antibody Ab
7 acris AP00290PU-N FKBP1A / FKBP12; antibody Ab
8 acris AP17380PU-N FKBP1A C-term; antibody Ab
9 acris AP17381PU-N FKBP1A N-term; antibody Ab
10 acris SP5112CP FKBP1A / FKBP12 Control Peptide; antibody Ab/CP
11 acris AP14539PU-N FKBP12 (Center); antibody Ab
12 scbt FKBP1A FKBP1A Antibody / FKBP1A Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of FKBP1A Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FKBP1A Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005829 Component cytosol
GO:0014802 Component terminal cisterna
GO:0048185 Function activin binding
GO:0005528 Function FK506 binding
GO:0016853 Function isomerase activity
GO:0003755 Function peptidyl-prolyl cis-trans isomerase activity
GO:0005219 Function ryanodine-sensitive calcium-release channel activity
GO:0004871 Function signal transducer activity
GO:0046332 Function SMAD binding
GO:0005024 Function transforming growth factor beta receptor activity
GO:0034713 Function type I transforming growth factor beta receptor binding
GO:0034205 Process beta-amyloid formation
GO:0006458 Process 'de novo' protein folding
GO:0043206 Process fibril organization
GO:0060347 Process heart trabecula formation
GO:0032513 Process negative regulation of protein phosphatase type 2B activity
GO:0043123 Process positive regulation of I-kappaB kinase/NF-kappaB cascade
GO:0032092 Process positive regulation of protein binding
GO:0031398 Process positive regulation of protein ubiquitination
GO:0022417 Process protein maturation by protein folding
GO:0042026 Process protein refolding
GO:0032925 Process regulation of activin receptor signaling pathway
GO:0050776 Process regulation of immune response
GO:0060314 Process regulation of ryanodine-sensitive calcium-release channel activity
GO:0007183 Process SMAD protein complex assembly
GO:0042110 Process T cell activation
GO:0055010 Process ventricular cardiac muscle morphogenesis

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000801  UCSC Browser NP_000792 P62942   Q0VDC6  
2 NM_054014  UCSC Browser NP_463460

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000381719 MI0000111 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENST00000381719 MI0000112 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENST00000381719 MI0000252 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENST00000381719 MI0000473 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENST00000381719 MI0000810 hsa-miR-135b* AUGUAGGGCUAAAAGCCAUGGG
ENST00000381719 MI0000455 hsa-miR-138-2* GCUAUUUCACGACACCAGGGUU
ENST00000381719 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENST00000381719 MI0000478 hsa-miR-149* AGGGAGGGACGGGGGCUGUGC
ENST00000381719 MI0000269 hsa-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENST00000381719 MI0000289 hsa-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENST00000381719 MI0000289 hsa-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENST00000381719 MI0000271 hsa-miR-181c AACAUUCAACCUGUCGGUGAGU
ENST00000381719 MI0000271 hsa-miR-181c* AACCAUCGACCGUUGAGUGGAC
ENST00000381719 MI0000273 hsa-miR-183 UAUGGCACUGGUAGAAUUCACU
ENST00000381719 MI0000234 hsa-miR-192* CUGCCAAUUCCAUAGGUCACAG
ENST00000381719 MI0000737 hsa-miR-200a UAACACUGUCUGGUAACGAUGU
ENST00000381719 MI0000293 hsa-miR-217 UACUGCAUCAGGAACUGAUUGGA
ENST00000381719 MI0000296 hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG
ENST00000381719 MI0000078 hsa-miR-22 AAGCUGCCAGUUGAAGAACUGU
ENST00000381719 MI0000744 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU
ENST00000381719 MI0000744 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
ENST00000381719 MI0000735 hsa-miR-29c* UGACCGAUUUCUCCUGGUGUUC
ENST00000381719 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENST00000381719 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENST00000381719 MI0000743 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC
ENST00000381719 MI0000783 hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
ENST00000381719 MI0000776 hsa-miR-376c AACAUAGAGGAAAUUCCACGU
ENST00000381719 MI0001735 hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU
ENST00000381719 MI0001446 hsa-miR-424* CAAAACGUGAGGCGCUGCUAU
ENST00000381719 MI0001648 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENST00000381719 MI0003673 hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
ENST00000381719 MI0003123 hsa-miR-488 UUGAAAGGCUAUUUCUUGGUC
ENST00000381719 MI0003514 hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU
ENST00000381719 MI0005565 hsa-miR-543 AAACAUUCGCGGUGCACUUCUU
ENST00000381719 MI0003592 hsa-miR-585 UGGGCGUAUCUGUAUGCUA
ENST00000381719 MI0003595 hsa-miR-587 UUUCCAUAGGUGAUGAGUCAC
ENST00000381719 MI0003623 hsa-miR-610 UGAGCUAAAUGUGUGCUGGGA
ENST00000381719 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENST00000381719 MI0003639 hsa-miR-625 AGGGGGAAAGUUCUAUAGUCC
ENST00000381719 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENST00000381719 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENST00000381719 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENST00000381719 MI0003684 hsa-miR-660 UACCCAUUGCAUAUCGGAGUUG
ENST00000381719 MI0005543 hsa-miR-708* CAACUAGACUGUGAGCUUCUAG
ENST00000381719 MI0005116 hsa-miR-765 UGGAGGAGAAGGAAGGUGAUG
ENST00000381719 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENST00000381719 MI0005712 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA
ENST00000381719 MI0005716 hsa-miR-924 AGAGUCUUGUGAUGUCUUGC
ENST00000381719 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENST00000381719 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENST00000381719 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENST00000381719 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENST00000381719 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENST00000381719 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000381719 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000381719 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000381719 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENST00000381719 MI0004310 mmu-miR-764-3p AGGAGGCCAUAGUGGCAACUGU
ENST00000381742 MI0000472 hsa-miR-127-5p CUGAAGCUCAGAGGGCUCUGAU
ENST00000381742 MI0000810 hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENST00000381742 MI0000458 hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
ENST00000381742 MI0000484 hsa-miR-188-5p CAUCCCUUGCAUGGUGGAGGG
ENST00000381742 MI0000255 hsa-miR-30d UGUAAACAUCCCCGACUGGAAG
ENST00000381742 MI0000814 hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG
ENST00000381742 MI0000743 hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG
ENST00000381742 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENST00000381742 MI0005533 hsa-miR-890 UACUUGGAAAGGCAUCAGUUG
ENST00000381742 MI0005712 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA
ENST00000381742 MI0004640 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENST00000381742 MI0004641 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENST00000381742 MI0004642 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENST00000381742 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of FKBP1A mRNA
17562736
Benzene
  • Benzene results in increased expression of FKBP1A protein
14673790
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of FKBP1A mRNA
16239168
Carmustine
  • Carmustine results in decreased expression of FKBP1A mRNA
15980968
Indomethacin
  • Indomethacin results in increased expression of FKBP1A mRNA
  • rebamipide inhibits the reaction [Indomethacin results in increased expression of FKBP1A mRNA]
18299717
pirinixic acid
  • pirinixic acid results in increased expression of FKBP1A mRNA
18301758, 15375163
rebamipide
  • rebamipide inhibits the reaction [Indomethacin results in increased expression of FKBP1A mRNA]
18299717
Sirolimus
  • [Sirolimus binds to FKBP1A protein] which results in decreased expression of IL2RG mRNA
  • [Sirolimus binds to FKBP1A protein] which results in decreased expression of IL2RG protein
  • [Sirolimus binds to FKBP1A protein] which results in decreased expression of IL4R mRNA
  • [Sirolimus binds to FKBP1A protein] which results in decreased expression of IL4R protein
12531798
Sirolimus
  • Sirolimus inhibits the reaction [FKBP1A protein binds to RYR1 protein]
16411661
Sirolimus
  • Sirolimus inhibits the reaction [FKBP1A protein binds to ITPR1 protein]
16278292
Tacrolimus
  • Tacrolimus results in increased expression of FKBP1A protein
11041285
Tacrolimus
  • Tacrolimus inhibits the reaction [FKBP1A protein binds to RYR1 protein]
16411661
Tacrolimus
  • Tacrolimus inhibits the reaction [FKBP1A protein binds to ITPR1 protein]
16278292
tert-Butylhydroperoxide
  • tert-Butylhydroperoxide results in increased expression of FKBP1A mRNA
15336504
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin results in increased expression of FKBP1A mRNA
  • Tetrachlorodibenzodioxin results in increased expression of FKBP1A mRNA
16960034

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Duodenal Ulcer inferred via Tacrolimus 17202747
Graft vs Host Disease inferred via Tacrolimus 16376943
Neurodegenerative Diseases inferred via Tacrolimus 15081597
Stomach Neoplasms inferred via rebamipide 15993841
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Adenoma inferred via Indomethacin 11497255
Alzheimer Disease inferred via Indomethacin 15579461
Breast Neoplasms inferred via Indomethacin 17401462
Carcinoma, Hepatocellular inferred via Indomethacin 16391822
Colonic Neoplasms inferred via Indomethacin 11260862, 15786552, 15963497
Colorectal Neoplasms inferred via Indomethacin 18059344, 12606626, 17054584
Duodenal Ulcer inferred via Indomethacin 17045617, 16699067, 17202747
Edema inferred via Indomethacin 8985016
Enteritis inferred via Indomethacin 16328016
Esophageal Neoplasms inferred via Indomethacin 11005569
Glioblastoma inferred via Indomethacin 12870263
Hyperlipidemias inferred via Indomethacin 17546600
Ileal Diseases inferred via Indomethacin 10574470
Intestinal Diseases inferred via Indomethacin 15610444, 10210152, 17329856, 15831440
Jejunal Diseases inferred via Indomethacin 10574470
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via Indomethacin 10785260
Leukemia, Myeloid, Acute inferred via Indomethacin 18360721
Lung Neoplasms inferred via Indomethacin 11497255
Pain inferred via Indomethacin 17440234
Stomach Diseases inferred via Indomethacin 17207306
Stomach Ulcer inferred via Indomethacin 16934674, 10878458, 15104355, 12077510, 17654042, 12467913, 18299717
Ulcer inferred via Indomethacin 10574470
Brain Neoplasms inferred via Carmustine 16187019
Glioblastoma inferred via Carmustine 16187019
Melanoma inferred via Carmustine 12393984
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 15673190, 16011737, 15700767, 16124888, 16227642, 10355542, 16097048, 16050911
Fatty Liver inferred via Carbon Tetrachloride 16045604, 15959796, 17595544, 12631006, 61145, 12795759, 16239168
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15027814, 15968718, 16227642, 15998439, 16177239, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 17334410, 16943688, 16221502, 16239168
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 15925388, 17525996, 17557913, 18156304, 16638106, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18395095, 17976157, 17805973, 16248980, 16116963
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15720792, 16964402, 17285989, 15830285
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Anemia, Aplastic inferred via Benzene 14761424, 11369114, 17661222
Bone Marrow Diseases inferred via Benzene 16183116
Breast Neoplasms inferred via Benzene 11921183, 17162533
Dermatitis inferred via Benzene 15902427
Hematologic Diseases inferred via Benzene 16183116
Hypertension inferred via Benzene 17940673
Leukemia inferred via Benzene 15935818, 18335105, 17119257, 14694614
Leukemia, Myeloid inferred via Benzene 17506065
Lung Diseases, Interstitial inferred via Benzene 14698565
Lymphoma inferred via Benzene 17119257, 17584886
Multiple Myeloma inferred via Benzene 17119195
Occupational Diseases inferred via Benzene 17479406, 15727169, 15935809, 17178637, 15913788, 15576619, 15612468, 16737584, 17119257
Thymus Neoplasms inferred via Benzene 10850423
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17562736, 16177239, 15968718, 16227642, 14986274, 17522070, 16081117
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
BMPR1A BMPR1A / FKBP1A Two-hybrid Kurozumi K (1998)
DHFR FKBP1A / DHFR Biochemical Activity Braun PD (2003)
FKBP1A FKBP1A / FKBP1A Co-crystal Structure Rollins CT (2000)
FKBP1A FKBP1A / FKBP1A Co-crystal Structure Schultz LW (1998)
Frap1 FKBP1A / Frap1 Affinity Capture-Western Edinger AL (2003)
Frap1 Frap1 / FKBP1A Reconstituted Complex Hara K (1997)
FRAP1 FKBP1A / FRAP1 Affinity Capture-Western Jacinto E (2004)
FRAP1 FKBP1A / FRAP1 Affinity Capture-Western Sarbassov DD (2004)
FRAP1 FKBP1A / FRAP1 Co-crystal Structure Choi J (1996)
FRAP1 FRAP1 / FKBP1A Reconstituted Complex Banaszynski LA (2005)
FRAP1 FKBP1A / FRAP1 Reconstituted Complex Sabers CJ (1995)
FRAP1 FRAP1 / FKBP1A Two-hybrid Luker KE (2004)
GLMN FKBP1A / GLMN Reconstituted Complex Chambraud B (1996)
GLMN FKBP1A / GLMN Reconstituted Complex Neye H (2001)
GLMN GLMN / FKBP1A Two-hybrid Chambraud B (1996)
GLMN FKBP1A / GLMN Two-hybrid Neye H (2001)
ITPR1 ITPR1 / FKBP1A Affinity Capture-Western MacMillan D (2005)
ITPR1 ITPR1 / FKBP1A Two-hybrid Cameron AM (1997)
N/A FKBP1A / N/A Affinity Capture-Western Jacinto E (2004)
N/A FKBP1A / N/A Affinity Capture-Western Sarbassov DD (2004)
RYR1 RYR1 / FKBP1A Affinity Capture-Western Avila G (2003)
RYR1 RYR1 / FKBP1A Affinity Capture-Western Bultynck G (2001)
RYR1 FKBP1A / RYR1 Reconstituted Complex Bultynck G (2001)
RYR1 RYR1 / FKBP1A Reconstituted Complex Gaburjakova M (2001)
RYR3 FKBP1A / RYR3 Reconstituted Complex Bultynck G (2001)
RYR3 RYR3 / FKBP1A Reconstituted Complex Bultynck G (2001)
TGFBR1 FKBP1A / TGFBR1 Affinity Capture-Western Wang T (1994)
TGFBR1 FKBP1A / TGFBR1 Two-hybrid Liu F (1995)
TGFBR1 FKBP1A / TGFBR1 Two-hybrid Wang T (1994)
YY1 YY1 / FKBP1A Two-hybrid Yang WM (1995)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Gerard M, et al. (2008) "FK506 binding protein 12 differentially accelerates fibril formation of wild type alpha-synuclein and its clinical mutants A30P or A53T." J Neurochem. 106(1):121-133. PMID:18346205
  2. [ + ] Bauriedel G, et al. (2008) "Neointimal expression of rapamycin receptor FK506-binding protein FKBP12: postinjury animal and human in-stent restenosis tissue characteristics." J Vasc Res. 45(2):173-178. PMID:17962721
  3. [ + ] Shor B, et al. (2008) "A new pharmacologic action of CCI-779 involves FKBP12-independent inhibition of mTOR kinase activity and profound repression of global protein synthesis." Cancer Res. 68(8):2934-2943. PMID:18413763
  4. [ + ] Knappe TA, et al. (2007) "Insertion of a chaperone domain converts FKBP12 into a powerful catalyst of protein folding." J Mol Biol. 368(5):1458-1468. PMID:17397867
  5. [ + ] Wear MA, et al. (2007) "A kinetically trapped intermediate of FK506 binding protein forms in vitro: chaperone machinery dominates protein folding in vivo." Protein Expr Purif. 51(1):80-95. PMID:16908189
  6. [ + ] Seidler T, et al. (2007) "Overexpression of FK-506 binding protein 12.0 modulates excitation contraction coupling in adult rabbit ventricular cardiomyocytes." Circ Res. 101(10):1020-1029. PMID:17872463
  7. [ + ] Ikura T, et al. (2007) "Requirements for peptidyl-prolyl isomerization activity: a comprehensive mutational analysis of the substrate-binding cavity of FK506-binding protein 12." Protein Sci. 16(12):2618-2625. PMID:18029417
  8. [ + ] Yamaguchi T, et al. (2006) "FKBP12 functions as an adaptor of the Smad7-Smurf1 complex on activin type I receptor." J Mol Endocrinol. 36(3):569-579. PMID:16720724
  9. [ + ] Gerard M, et al. (2006) "The aggregation of alpha-synuclein is stimulated by FK506 binding proteins as shown by fluorescence correlation spectroscopy." FASEB J. 20(3):524-526. PMID:16410343
  10. [ + ] Banaszynski LA, et al. (2005) "Characterization of the FKBP.rapamycin.FRB ternary complex." J Am Chem Soc. 127(13):4715-4721. PMID:15796538
  11. [ + ] Vanwetswinkel S, et al. (2005) "TINS, target immobilized NMR screening: an efficient and sensitive method for ligand discovery." Chem Biol. 12(2):207-216. PMID:15734648
  12. [ + ] Ozdamar B, et al. (2005) "Regulation of the polarity protein Par6 by TGFbeta receptors controls epithelial cell plasticity." Science. 307(5715):1603-1609. PMID:15761148
  13. [ + ] MacMillan D, et al. (2005) "In smooth muscle, FK506-binding protein modulates IP3 receptor-evoked Ca2+ release by mTOR and calcineurin." J Cell Sci. 118(Pt 23):5443-5451. PMID:16278292
  14. [ + ] Nakazawa T, et al. (2005) "Genomic organization, chromosomal localization, and promoter of human gene for FK506-binding protein 12.6." Gene. 360(1):55-64. PMID:16122887
  15. [ + ] Kihira T, et al. (2005) "Expression of FKBP12 and ryanodine receptors (RyRs) in the spinal cord of MND patients." Amyotroph Lateral Scler Other Motor Neuron Disord. 6(2):94-99. PMID:16036432
  16. [ + ] Won J, et al. (2005) "A magnetic nanoprobe technology for detecting molecular interactions in live cells." Science. 309(5731):121-125. PMID:15994554
  17. [ + ] Spencer DS, et al. (2005) "Effects of pH, salt, and macromolecular crowding on the stability of FK506-binding protein: an integrated experimental and theoretical study." J Mol Biol. 351(1):219-232. PMID:15992823
  18. [ + ] Jacinto E, et al. (2004) "Mammalian TOR complex 2 controls the actin cytoskeleton and is rapamycin insensitive." Nat Cell Biol. 6(11):1122-1128. PMID:15467718
  19. [ + ] Gestwicki JE, et al. (2004) "Harnessing chaperones to generate small-molecule inhibitors of amyloid beta aggregation." Science. 306(5697):865-869. PMID:15514157
  20. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  21. [ + ] Luker KE, et al. (2004) "Kinetics of regulated protein-protein interactions revealed with firefly luciferase complementation imaging in cells and living animals." Proc Natl Acad Sci U S A. 101(33):12288-12293. PMID:15284440
  22. [ + ] Sarbassov DD, et al. (2004) "Rictor, a novel binding partner of mTOR, defines a rapamycin-insensitive and raptor-independent pathway that regulates the cytoskeleton." Curr Biol. 14(14):1296-1302. PMID:15268862
  23. [ + ] Sinkins WG, et al. (2004) "Association of immunophilins with mammalian TRPC channels." J Biol Chem. 279(33):34521-34529. PMID:15199065
  24. [ + ] Van Acker K, et al. (2004) "The 12 kDa FK506-binding protein, FKBP12, modulates the Ca(2+)-flux properties of the type-3 ryanodine receptor." J Cell Sci. 117(Pt 7):1129-1137. PMID:14970260
  25. [ + ] Fulton KF, et al. (2003) "Energetic and structural analysis of the role of tryptophan 59 in FKBP12." Biochemistry. 42(8):2364-2372. PMID:12600203
  26. [ + ] Edinger AL, et al. (2003) "Differential effects of rapamycin on mammalian target of rapamycin signaling functions in mammalian cells." Cancer Res. 63(23):8451-8460. PMID:14679009
  27. [ + ] Russo AT, et al. (2003) "Osmolyte effects on kinetics of FKBP12 C22A folding coupled with prolyl isomerization." J Mol Biol. 330(4):851-866. PMID:12850152
  28. [ + ] Braun PD, et al. (2003) "A bifunctional molecule that displays context-dependent cellular activity." J Am Chem Soc. 125(25):7575-7580. PMID:12812497
  29. [ + ] Matsuda A, et al. (2003) "Large-scale identification and characterization of human genes that activate NF-kappaB and MAPK signaling pathways." Oncogene. 22(21):3307-3318. PMID:12761501
  30. [ + ] Avila G, et al. (2003) "FKBP12 binding to RyR1 modulates excitation-contraction coupling in mouse skeletal myotubes." J Biol Chem. 278(25):22600-22608. PMID:12704193
  31. [ + ] Gevaert K, et al. (2003) "Exploring proteomes and analyzing protein processing by mass spectrometric identification of sorted N-terminal peptides." Nat Biotechnol. 21(5):566-569. PMID:12665801
  32. [ + ] Krummrei U, et al. (2003) "The FKBP-associated protein FAP48 is an antiproliferative molecule and a player in T cell activation that increases IL2 synthesis." Proc Natl Acad Sci U S A. 100(5):2444-2449. PMID:12604780
  33. [ + ] Cheng SY, et al. (2002) "Suppressor of Fused represses Gli-mediated transcription by recruiting the SAP18-mSin3 corepressor complex." Proc Natl Acad Sci U S A. 99(8):5442-5447. PMID:11960000
  34. [ + ] Jia L, et al. (2002) "Gene expression profile of human bone marrow stromal cells: high-throughput expressed sequence tag sequencing analysis." Genomics. 79(1):7-17. PMID:11827452
  35. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  36. [ + ] Law BK, et al. (2002) "Rapamycin potentiates transforming growth factor beta-induced growth arrest in nontransformed, oncogene-transformed, and human cancer cells." Mol Cell Biol. 22(23):8184-8198. PMID:12417722
  37. [ + ] Minder D, et al. (2002) "Immunophilins and HIV-1 infection." Arch Virol. 147(8):1531-1542. PMID:12181673
  38. [ + ] Schiene-Fischer C, et al. (2001) "Receptor accessory folding helper enzymes: the functional role of peptidyl prolyl cis/trans isomerases." FEBS Lett. 495(1-2):1-6. PMID:11322937
  39. [ + ] Neye H, et al. (2001) "Mutation of FKBP associated protein 48 (FAP48) at proline 219 disrupts the interaction with FKBP12 and FKBP52." Regul Pept. 97(2-3):147-152. PMID:11164950
  40. [ + ] Bultynck G, et al. (2001) "Characterization and mapping of the 12 kDa FK506-binding protein (FKBP12)-binding site on different isoforms of the ryanodine receptor and of the inositol 1,4,5-trisphosphate receptor." Biochem J. 354(Pt 2):413-422. PMID:11171121
  41. [ + ] Jeyakumar LH, et al. (2001) "FKBP binding characteristics of cardiac microsomes from diverse vertebrates." Biochem Biophys Res Commun. 281(4):979-986. PMID:11237759
  42. [ + ] Zohlnhofer D, et al. (2001) "Gene expression profiling of human stent-induced neointima by cDNA array analysis of microscopic specimens retrieved by helix cutter atherectomy: Detection of FK506-binding protein 12 upregulation." Circulation. 103(10):1396-1402. PMID:11245643
  43. [ + ] Gaburjakova M, et al. (2001) "FKBP12 binding modulates ryanodine receptor channel gating." J Biol Chem. 276(20):16931-16935. PMID:11279144
  44. [ + ] Remy I, et al. (2001) "Visualization of biochemical networks in living cells." Proc Natl Acad Sci U S A. 98(14):7678-7683. PMID:11438723
  45. [ + ] Bultynck G, et al. (2001) "The conserved sites for the FK506-binding proteins in ryanodine receptors and inositol 1,4,5-trisphosphate receptors are structurally and functionally different." J Biol Chem. 276(50):47715-47724. PMID:11598113
  46. [ + ] Deloukas P, et al. (2001) "The DNA sequence and comparative analysis of human chromosome 20." Nature. 414(6866):865-871. PMID:11780052
  47. [ + ] Rollins CT, et al. (2000) "A ligand-reversible dimerization system for controlling protein-protein interactions." Proc Natl Acad Sci U S A. 97(13):7096-7101. PMID:10852943
  48. [ + ] Burkhard P, et al. (2000) "X-ray structures of small ligand-FKBP complexes provide an estimate for hydrophobic interaction energies." J Mol Biol. 295(4):953-962. PMID:10656803
  49. [ + ] Cunningham EB, et al. (1999) "An inositolphosphate-binding immunophilin, IPBP12." Blood. 94(8):2778-2789. PMID:10515881
  50. [ + ] Shou W, et al. (1998) "Cardiac defects and altered ryanodine receptor function in mice lacking FKBP12." Nature. 391(6666):489-492. PMID:9461216