FIGF | GeneID:2277 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2277 Official Symbol FIGF
Locus N/A Gene Type protein-coding
Synonyms VEGF-D; VEGFD
Full Name c-fos induced growth factor (vascular endothelial growth factor D)
Description c-fos induced growth factor (vascular endothelial growth factor D)
Chromosome Xp22.31
Also Known As OTTHUMP00000022960; vascular endothelial growth factor D
Summary The protein encoded by this gene is a member of the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family and is active in angiogenesis, lymphangiogenesis, and endothelial cell growth. This secreted protein undergoes a complex proteolytic maturation, generating multiple processed forms which bind and activate VEGFR-2 and VEGFR-3 receptors. This protein is structurally and functionally similar to vascular endothelial growth factor C. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3288

ID Symbol Protein Species
GeneID:2277 FIGF NP_004460.1 Homo sapiens
GeneID:14205 Figf NP_034346.1 Mus musculus
GeneID:286799 FIGF XP_590821.2 Bos taurus
GeneID:360457 Figf NP_113949.1 Rattus norvegicus
GeneID:395255 FIGF NP_989899.1 Gallus gallus
GeneID:465508 FIGF XP_520946.2 Pan troglodytes
GeneID:491749 FIGF XP_548869.2 Canis lupus familiaris
GeneID:678512 figf NP_001035268.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab2394 VEGFD antibody (ab2394); Rabbit polyclonal to VEGFD
2 abcam ab10969 VEGFD antibody (ab10969); Goat polyclonal to VEGFD
3 abcam ab63068 VEGFD antibody (ab63068); Rabbit polyclonal to VEGFD
4 abcam ab38687 VEGFD antibody [28AT743.288.48] (ab38687); Mouse monoclonal [28AT743.288.48] to VEGFD
5 abgent AP2043a VEGF4 Antibody; Purified Rabbit Polyclonal Antibody (Pab)
6 abgent AM1101a VEGF4 Antibody; Purified Mouse Monoclonal Antibody (Mab)
7 abgent AP6292b VEGF4 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
8 abgent AP6292c VEGF4 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
9 acris AP13297PU-N VEGF-D / FIGF (C-term); antibody Ab
10 acris AP00242PU-N VEGF-D / FIGF; antibody Ab
11 acris DP3508 VEGF-D / FIGF; antibody Ab
12 acris DP3508S VEGF-D / FIGF; antibody Ab
13 acris AM11020PU-N VEGF-D / FIGF; antibody Ab
14 scbt FIGF FIGF Antibody / FIGF Antibodies;
15 sigma V0885 Anti-Vascular Endothelial Growth Factor D antibody produced in goat ;

Exon, Intron and UTRs

Exon, Intron and UTRs of FIGF Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FIGF Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005576 Component extracellular region
GO:0005615 Component extracellular space
GO:0016020 Component membrane
GO:0031093 Component platelet alpha granule lumen
GO:0008083 Function growth factor activity
GO:0005161 Function platelet-derived growth factor receptor binding
GO:0042803 Function protein homodimerization activity
GO:0043185 Function vascular endothelial growth factor receptor 3 binding
GO:0001525 Process angiogenesis
GO:0030154 Process cell differentiation
GO:0007275 Process multicellular organismal development
GO:0008284 Process positive regulation of cell proliferation
GO:0048010 Process vascular endothelial growth factor receptor signaling pathway

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_004469  UCSC Browser NP_004460 B2R7Z3   O43915  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000297904 MI0000108 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000297904 MI0000109 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000297904 MI0000114 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENST00000297904 MI0000452 hsa-miR-135a* UAUAGGGAUUGGAGCCGUGGCG
ENST00000297904 MI0000455 hsa-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENST00000297904 MI0000476 hsa-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENST00000297904 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENST00000297904 MI0000809 hsa-miR-151-3p CUAGACUGAAGCUCCUUGAGG
ENST00000297904 MI0000480 hsa-miR-154* AAUCAUACACGGUUGACCUAUU
ENST00000297904 MI0000269 hsa-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENST00000297904 MI0000289 hsa-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENST00000297904 MI0000270 hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENST00000297904 MI0000683 hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENST00000297904 MI0003139 hsa-miR-181d AACAUUCAUUGUUGUCGGUGGGU
ENST00000297904 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENST00000297904 MI0000273 hsa-miR-183 UAUGGCACUGGUAGAAUUCACU
ENST00000297904 MI0000242 hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENST00000297904 MI0000281 hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENST00000297904 MI0000293 hsa-miR-217 UACUGCAUCAGGAACUGAUUGGA
ENST00000297904 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENST00000297904 MI0000824 hsa-miR-325 CCUAGUAGGUGUCCAGUAAGUGU
ENST00000297904 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENST00000297904 MI0000791 hsa-miR-383 AGAUCAGAAGGUGAUUGUGGCU
ENST00000297904 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENST00000297904 MI0001448 hsa-miR-425 AAUGACACGAUCACUCCCGUUGA
ENST00000297904 MI0001733 hsa-miR-452* CUCAUCUGCAAAGAAGUAAGUG
ENST00000297904 MI0002471 hsa-miR-487a AAUCAUACAGGGACAUCCAGUU
ENST00000297904 MI0003530 hsa-miR-487b AAUCGUACAGGGUCAUCCACUU
ENST00000297904 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENST00000297904 MI0003138 hsa-miR-497 CAGCAGCACACUGUGGUUUGU
ENST00000297904 MI0003515 hsa-miR-544 AUUCUGCAUUUUUAGCAAGUUC
ENST00000297904 MI0003572 hsa-miR-566 GGGCGCCUGUGAUCCCAAC
ENST00000297904 MI0003589 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU
ENST00000297904 MI0003639 hsa-miR-625* GACUAUAGAACUUUCCCCCUCA
ENST00000297904 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENST00000297904 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENST00000297904 MI0000263 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000297904 MI0000264 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000297904 MI0000265 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000297904 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENST00000297904 MI0005533 hsa-miR-890 UACUUGGAAAGGCAUCAGUUG
ENST00000297904 MI0005534 hsa-miR-891b UGCAACUUACCUGAGUCAUUGA
ENST00000297904 MI0005712 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA
ENST00000297904 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENST00000297904 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENST00000297904 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENST00000297904 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENST00000297904 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENST00000297904 MI0004640 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENST00000297904 MI0004641 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENST00000297904 MI0004642 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENST00000297904 MI0004691 mmu-miR-707 CAGUCAUGCCGCUUGCCUACG
ENST00000297904 MI0005473 mmu-miR-880 UACUCCAUCCUCUCUGAGUAGA
ENST00000297904 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AJ000185   AK223160   AK313173   BC027948   D89630   NM_004469   Y12863  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.529G>A1
Primary Site / Histology (Top 10)Mutations (sites * observations)
breast / carcinoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
arsenite
  • [arsenite co-treated with Benzo(a)pyrene] results in decreased expression of FIGF mRNA
  • arsenite results in decreased expression of FIGF mRNA
15894712
Benzo(a)pyrene
  • Benzo(a)pyrene results in decreased expression of FIGF mRNA
  • [arsenite co-treated with Benzo(a)pyrene] results in decreased expression of FIGF mRNA
15894712
Carbon Tetrachloride
  • Carbon Tetrachloride affects the expression of FIGF mRNA
12734012
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of FIGF mRNA
17484886
Dietary Fats
  • Dietary Fats results in decreased expression of FIGF mRNA
18042831
isobutyl nitrite
  • isobutyl nitrite results in increased expression of FIGF mRNA
16288974
methylformamide
  • methylformamide analog results in increased expression of FIGF mRNA
  • methylformamide results in increased expression of FIGF mRNA
17040096
palm oil
  • palm oil results in decreased expression of FIGF mRNA
18042831
Polycyclic Hydrocarbons, Aromatic
  • Polycyclic Hydrocarbons, Aromatic results in increased expression of FIGF mRNA
16002475
Progesterone
  • Progesterone affects the expression of FIGF mRNA
17251523

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Reperfusion Injury marker 16526316
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15845082, 15380490
Breast Neoplasms inferred via Progesterone 17614352, 16175315, 15562024
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 15673190, 16097048, 16050911, 16011737, 15700767, 16124888, 16227642, 10355542
Fatty Liver inferred via Carbon Tetrachloride 16045604, 15959796, 16239168, 12795759, 61145, 12631006, 17595544
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 16227642, 15027814, 15968718, 15998439, 11566570, 16177239
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 16239168, 17334410
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 15925388, 16248980, 16116963, 17525996, 17557913, 18156304, 16638106, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 18395095, 17976157, 17805973
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15720792, 17285989, 15830285, 16964402
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Esophageal Neoplasms inferred via Benzo(a)pyrene 16530937
Lung Neoplasms inferred via Benzo(a)pyrene 17053015
Urinary Bladder Neoplasms inferred via Benzo(a)pyrene 17053015
Colonic Neoplasms inferred via arsenite 15037631
Lung Neoplasms inferred via arsenite 16809336
Neovascularization, Pathologic inferred via arsenite 15738583

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
KDR FIGF / KDR Reconstituted Complex Achen MG (1998)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Karkkainen AM, et al. (2009) "Vascular endothelial growth factor-D transgenic mice show enhanced blood capillary density, improved postischemic muscle regeneration, and increased susceptibility to tumor formation." Blood. 113(18):4468-4475. PMID:19074006
  2. [ + ] Kim KE, et al. (2009) "Expression of ADAM33 is a novel regulatory mechanism in IL-18-secreted process in gastric cancer." J Immunol. 182(6):3548-3555. PMID:19265133
  3. [ + ] Arigami T, et al. (2009) "Vascular endothelial growth factor-C and -D expression correlates with lymph node micrometastasis in pN0 early gastric cancer." J Surg Oncol. 99(3):148-153. PMID:19117016
  4. [ + ] Goodyear SM, et al. (2009) "Role of the VEGFR3/VEGFD receptor axis in TGFbeta1 activation of primary prostate cell lines." Prostate. 69(9):982-990. PMID:19301310
  5. [ + ] Al-Moundhri MS, et al. (2008) "Measurement of circulating levels of VEGF-A, -C, and -D and their receptors, VEGFR-1 and -2 in gastric adenocarcinoma." World J Gastroenterol. 14(24):3879-3883. PMID:18609713
  6. [ + ] Ferrell RE, et al. (2008) "Candidate gene analysis in primary lymphedema." Lymphat Res Biol. 6(2):69-76. PMID:18564921
  7. [ + ] Liu B, et al. (2008) "Lymphangiogenesis and its relationship with lymphatic metastasis and prognosis in malignant melanoma." Anat Rec (Hoboken). 291(10):1227-1235. PMID:18561194
  8. [ + ] Gu Y, et al. (2008) "Lymphangiogenesis induced by VEGF-C and VEGF-D promotes metastasis and a poor outcome in breast carcinoma: a retrospective study of 61 cases." Clin Exp Metastasis. 25(7):717-725. PMID:18512120
  9. [ + ] Schafer G, et al. (2008) "Regulation of vascular endothelial growth factor D by orphan receptors hepatocyte nuclear factor-4 alpha and chicken ovalbumin upstream promoter transcription factors 1 and 2." Cancer Res. 68(2):457-466. PMID:18199540
  10. [ + ] Xu H, et al. (2008) "Vascular endothelial growth factor attenuates hepatic sinusoidal capillarization in thioacetamide-induced cirrhotic rats." World J Gastroenterol. 14(15):2349-2357. PMID:18416461
  11. [ + ] Tzao C, et al. (2008) "Expression of hypoxia-inducible factor (HIF)-1alpha and vascular endothelial growth factor (VEGF)-D as outcome predictors in resected esophageal squamous cell carcinoma." Dis Markers. 25(3):141-148. PMID:19096126
  12. [ + ] Liu YH, et al. (2008) "Up-regulation of vascular endothelial growth factor-D expression in clear cell renal cell carcinoma by CD74: a critical role in cancer cell tumorigenesis." J Immunol. 181(9):6584-6594. PMID:18941249
  13. [ + ] Teramoto S, et al. (2008) "Role of vascular endothelial growth factor-C and -D mRNA in breast cancer." Hiroshima J Med Sci. 57(2):73-78. PMID:18717190
  14. [ + ] McColl BK, et al. (2007) "Proprotein convertases promote processing of VEGF-D, a critical step for binding the angiogenic receptor VEGFR-2." FASEB J. 21(4):1088-1098. PMID:17242158
  15. [ + ] Maekawa S, et al. (2007) "Correlation between lymph node metastasis and the expression of VEGF-C, VEGF-D and VEGFR-3 in T1 lung adenocarcinoma." Anticancer Res. 27(6A):3735-3741. PMID:17970036
  16. [ + ] Duff SE, et al. (2007) "Lymphatic vessel density, microvessel density and lymphangiogenic growth factor expression in colorectal cancer." Colorectal Dis. 9(9):793-800. PMID:17931169
  17. [ + ] Pazgal I, et al. (2007) "Expression of VEGF-C, VEGF-D and their receptor VEGFR-3 in diffuse large B-cell lymphomas." Leuk Lymphoma. 48(11):2213-2220. PMID:17926187
  18. [ + ] Bardelli M, et al. (2007) "VEGF-D is expressed in activated lymphoid cells and in tumors of hematopoietic and lymphoid tissues." Leuk Lymphoma. 48(10):2014-2021. PMID:17917969
  19. [ + ] Herrmann E, et al. (2007) "[Lymphangiogenesis axis in bladder carcinoma. An analysis with tissue microarray technology]" Urologe A. 46(9):1254-1256. PMID:17676294
  20. [ + ] van der Schaft DW, et al. (2007) "Absence of lymphangiogenesis in ductal breast cancer at the primary tumor site." Cancer Lett. 254(1):128-136. PMID:17442484
  21. [ + ] Kivela R, et al. (2007) "Localisation of lymphatic vessels and vascular endothelial growth factors-C and -D in human and mouse skeletal muscle with immunohistochemistry." Histochem Cell Biol. 127(1):31-40. PMID:16924525
  22. [ + ] Timoshenko AV, et al. (2006) "COX-2-mediated stimulation of the lymphangiogenic factor VEGF-C in human breast cancer." Br J Cancer. 94(8):1154-1163. PMID:16570043
  23. [ + ] Akahane M, et al. (2006) "Vascular endothelial growth factor-D is a survival factor for human breast carcinoma cells." Int J Cancer. 118(4):841-849. PMID:16152591
  24. [ + ] Miyata Y, et al. (2006) "Lymphangiogenesis and angiogenesis in bladder cancer: prognostic implications and regulation by vascular endothelial growth factors-A, -C, and -D." Clin Cancer Res. 12(3 Pt 1):800-806. PMID:16467091
  25. [ + ] Orlandini M, et al. (2006) "Vascular endothelial growth factor-D activates VEGFR-3 expressed in osteoblasts inducing their differentiation." J Biol Chem. 281(26):17961-17967. PMID:16624815
  26. [ + ] Karpanen T, et al. (2006) "Functional interaction of VEGF-C and VEGF-D with neuropilin receptors." FASEB J. 20(9):1462-1472. PMID:16816121
  27. [ + ] Seyama K, et al. (2006) "Vascular endothelial growth factor-D is increased in serum of patients with lymphangioleiomyomatosis." Lymphat Res Biol. 4(3):143-152. PMID:17034294
  28. [ + ] Kaushal V, et al. (2005) "Stage-specific characterization of the vascular endothelial growth factor axis in prostate cancer: expression of lymphangiogenic markers is associated with advanced-stage disease." Clin Cancer Res. 11(2 Pt 1):584-593. PMID:15701844
  29. [ + ] Strauss L, et al. (2005) "Dual role of VEGF family members in the pathogenesis of head and neck cancer (HNSCC): possible link between angiogenesis and immune tolerance." Med Sci Monit. 11(8):BR280-BR292. PMID:16049374
  30. [ + ] Yasuoka H, et al. (2005) "VEGF-D expression and lymph vessels play an important role for lymph node metastasis in papillary thyroid carcinoma." Mod Pathol. 18(8):1127-1133. PMID:15803188
  31. [ + ] Vlahakis NE, et al. (2005) "The lymphangiogenic vascular endothelial growth factors VEGF-C and -D are ligands for the integrin alpha9beta1." J Biol Chem. 280(6):4544-4552. PMID:15590642
  32. [ + ] Fink AM, et al. (2004) "Serum level of VEGF-D in patients with primary lymphedema." Lymphology. 37(4):185-189. PMID:15693535
  33. [ + ] Kurahara H, et al. (2004) "Impact of vascular endothelial growth factor-C and -D expression in human pancreatic cancer: its relationship to lymph node metastasis." Clin Cancer Res. 10(24):8413-8420. PMID:15623620
  34. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  35. [ + ] Rissanen TT, et al. (2003) "VEGF-D is the strongest angiogenic and lymphangiogenic effector among VEGFs delivered into skeletal muscle via adenoviruses." Circ Res. 92(10):1098-1106. PMID:12714562
  36. [ + ] McColl BK, et al. (2003) "Plasmin activates the lymphangiogenic growth factors VEGF-C and VEGF-D." J Exp Med. 198(6):863-868. PMID:12963694
  37. [ + ] Orlandini M, et al. (2003) "Beta-catenin inversely regulates vascular endothelial growth factor-D mRNA stability." J Biol Chem. 278(45):44650-44656. PMID:12920128
  38. [ + ] Funaki H, et al. (2003) "Expression of vascular endothelial growth factor D is associated with lymph node metastasis in human colorectal carcinoma." Oncology. 64(4):416-422. PMID:12759540
  39. [ + ] Yokoyama Y, et al. (2003) "Vascular endothelial growth factor-D is an independent prognostic factor in epithelial ovarian carcinoma." Br J Cancer. 88(2):237-244. PMID:12610509
  40. [ + ] Nakamura Y, et al. (2003) "Prognostic significance of vascular endothelial growth factor D in breast carcinoma with long-term follow-up." Clin Cancer Res. 9(2):716-721. PMID:12576440
  41. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  42. [ + ] Stacker SA, et al. (1999) "Biosynthesis of vascular endothelial growth factor-D involves proteolytic processing which generates non-covalent homodimers." J Biol Chem. 274(45):32127-32136. PMID:10542248
  43. [ + ] Achen MG, et al. (1998) "Vascular endothelial growth factor D (VEGF-D) is a ligand for the tyrosine kinases VEGF receptor 2 (Flk1) and VEGF receptor 3 (Flt4)." Proc Natl Acad Sci U S A. 95(2):548-553. PMID:9435229
  44. [ + ] Wartiovaara U, et al. (1998) "Peripheral blood platelets express VEGF-C and VEGF which are released during platelet activation." Thromb Haemost. 80(1):171-175. PMID:9684805
  45. [ + ] Rocchigiani M, et al. (1998) "Human FIGF: cloning, gene structure, and mapping to chromosome Xp22.1 between the PIGA and the GRPR genes." Genomics. 47(2):207-216. PMID:9479493
  46. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  47. [ + ] Yamada Y, et al. (1997) "Molecular cloning of a novel vascular endothelial growth factor, VEGF-D." Genomics. 42(3):483-488. PMID:9205122
  48. [ + ] Orlandini M, et al. (1996) "Identification of a c-fos-induced gene that is related to the platelet-derived growth factor/vascular endothelial growth factor family." Proc Natl Acad Sci U S A. 93(21):11675-11680. PMID:8876195
  49. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298