FGR | GeneID:2268 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2268 Official Symbol FGR
Locus N/A Gene Type protein-coding
Synonyms FLJ43153; MGC75096; SRC2; c-fgr; c-src2; p55c-fgr; p58c-fgr
Full Name Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog
Description Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog
Chromosome 1p36.2-p36.1
Also Known As OTTHUMP00000003601; OTTHUMP00000003602; OTTHUMP00000003603; c-fgr protooncogene; c-src-2 proto-oncogene; p55-c-fgr protein; proto-oncogene tyrosine-protein kinase FGR
Summary This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to plasma membrane ruffles, and functions as a negative regulator of cell migration and adhesion triggered by the beta-2 integrin signal transduction pathway. Infection with Epstein-Barr virus results in the overexpression of this gene. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3842

ID Symbol Protein Species
GeneID:2268 FGR NP_001036194.1 Homo sapiens
GeneID:14191 Fgr NP_034338.2 Mus musculus
GeneID:79113 Fgr NP_077059.2 Rattus norvegicus
GeneID:487341 FGR XP_544467.2 Canis lupus familiaris
GeneID:516133 FGR XP_883725.2 Bos taurus
GeneID:792089 LOC792089 XP_001331678.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab71680 FGR antibody - Aminoterminal end (ab71680); Rabbit polyclonal to FGR - Aminoterminal end
2 abcam ab65007 FGR antibody (ab65007); Rabbit polyclonal to FGR
3 abcam ab58228 FGR antibody (ab58228); Mouse monoclonal to FGR
4 abcam ab14468 FGR antibody (ab14468); Rabbit polyclonal to FGR
5 abcam ab815 FGR antibody (ab815); Goat polyclonal to FGR
6 abgent AP7707a FGR Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
7 abnova H00002268-M03 FGR monoclonal antibody (M03), clone 1B12; Mouse monoclonal antibody raised against a partial recombinant FGR.
8 abnova H00002268-M07 FGR monoclonal antibody (M07), clone 4C12; Mouse monoclonal antibody raised against a partial recombinant FGR.
9 abnova H00002268-M08 FGR monoclonal antibody (M08), clone 3F2; Mouse monoclonal antibody raised against a partial recombinant FGR.
10 abnova H00002268-M01 FGR monoclonal antibody (M01), clone 3G10; Mouse monoclonal antibody raised against a partial recombinant FGR.
11 abnova H00002268-M02 FGR monoclonal antibody (M02), clone 3B11; Mouse monoclonal antibody raised against a partial recombinant FGR.
12 acris AP14465PU-N FGR / SRC2 (N-term); antibody Ab
13 acris SP1367P FGR / SRC2; antibody Ab
14 acris AP06661PU-N FGR / SRC2; antibody Ab
15 acris AP15929PU-N FGR / SRC2 (C-term); antibody Ab
16 scbt FGR FGR Antibody / FGR Antibodies;
17 sigma HPA002024 Anti-FGR antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of FGR Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FGR Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005524 Function ATP binding
GO:0004715 Function non-membrane spanning protein tyrosine kinase activity
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0016740 Function transferase activity
GO:0050830 Process defense response to Gram-positive bacterium
GO:0006468 Process protein amino acid phosphorylation
GO:0009615 Process response to virus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001042729  UCSC Browser NP_001036194 P09769   P78453  
2 NM_001042747  UCSC Browser NP_001036212
3 NM_005248  UCSC Browser NP_005239

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000374003 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENST00000374003 MI0000272 hsa-miR-182* UGGUUCUAGACUUGCCAACUA
ENST00000374003 MI0003137 hsa-miR-193b* CGGGGUUUUGAGGGCGAGAUGA
ENST00000374003 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENST00000374003 MI0000808 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
ENST00000374003 MI0000803 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC
ENST00000374003 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENST00000374003 MI0000785 hsa-miR-377* AGAGGUUGCCCUUGGUGAAUUC
ENST00000374003 MI0001733 hsa-miR-452* CUCAUCUGCAAAGAAGUAAGUG
ENST00000374003 MI0001727 hsa-miR-453 AGGUUGUCCGUGGUGAGUUCGCA
ENST00000374003 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000374003 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000374003 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000374003 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENST00000374003 MI0003514 hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU
ENST00000374003 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENST00000374003 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000374003 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENST00000374003 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENST00000374003 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENST00000374003 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENST00000374003 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENST00000374003 MI0005567 hsa-miR-760 CGGCUCUGGGUCUGUGGGGA
ENST00000374003 MI0000466 hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENST00000374003 MI0000467 hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENST00000374003 MI0000468 hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENST00000374003 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENST00000374003 MI0004635 mmu-miR-678 GUCUCGGUGCAAGGACUGGAGG
ENST00000374003 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA
ENST00000374003 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENST00000374004 MI0000810 hsa-miR-135b* AUGUAGGGCUAAAAGCCAUGGG
ENST00000374004 MI0000272 hsa-miR-182* UGGUUCUAGACUUGCCAACUA
ENST00000374004 MI0000762 hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU
ENST00000374004 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENST00000374004 MI0000785 hsa-miR-377* AGAGGUUGCCCUUGGUGAAUUC
ENST00000374004 MI0000786 hsa-miR-378 ACUGGACUUGGAGUCAGAAGG
ENST00000374004 MI0001444 hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC
ENST00000374004 MI0001733 hsa-miR-452* CUCAUCUGCAAAGAAGUAAGUG
ENST00000374004 MI0001727 hsa-miR-453 AGGUUGUCCGUGGUGAGUUCGCA
ENST00000374004 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENST00000374004 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENST00000374004 MI0003589 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU
ENST00000374004 MI0003613 hsa-miR-600 ACUUACAGACAAGAGCCUUGCUC
ENST00000374004 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000374004 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENST00000374004 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENST00000374004 MI0003643 hsa-miR-629* GUUCUCCCAACGUAAGCCCAGC
ENST00000374004 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENST00000374004 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENST00000374004 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENST00000374004 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENST00000374004 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENST00000374004 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENST00000374004 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENST00000374004 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENST00000374004 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000374004 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000374004 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000374004 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000374004 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENST00000374005 MI0000810 hsa-miR-135b* AUGUAGGGCUAAAAGCCAUGGG
ENST00000374005 MI0000272 hsa-miR-182* UGGUUCUAGACUUGCCAACUA
ENST00000374005 MI0000762 hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU
ENST00000374005 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENST00000374005 MI0000783 hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
ENST00000374005 MI0000786 hsa-miR-378 ACUGGACUUGGAGUCAGAAGG
ENST00000374005 MI0001444 hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC
ENST00000374005 MI0001733 hsa-miR-452* CUCAUCUGCAAAGAAGUAAGUG
ENST00000374005 MI0001727 hsa-miR-453 AGGUUGUCCGUGGUGAGUUCGCA
ENST00000374005 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENST00000374005 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENST00000374005 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENST00000374005 MI0003514 hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU
ENST00000374005 MI0003589 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU
ENST00000374005 MI0003613 hsa-miR-600 ACUUACAGACAAGAGCCUUGCUC
ENST00000374005 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000374005 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENST00000374005 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENST00000374005 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENST00000374005 MI0005524 hsa-miR-891a UGCAACGAACCUGAGCCACUGA
ENST00000374005 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENST00000374005 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENST00000374005 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENST00000374005 MI0005494 mmu-miR-343 UCUCCCUUCAUGUGCCCAGA
ENST00000374005 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENST00000374005 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENST00000374005 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000374005 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000374005 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000374005 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000374005 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.1425C>T1
Primary Site / Histology (Top 10)Mutations (sites * observations)
skin / malignant melanoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
arsenic trioxide
  • arsenic trioxide results in increased expression of FGR mRNA
15761015
Diethylstilbestrol
  • Diethylstilbestrol results in increased expression of FGR mRNA
15766595
Dust
  • Dust results in increased expression of FGR mRNA
17805423
Lipopolysaccharides
  • Lipopolysaccharides results in increased expression of FGR mRNA
12057914
polyphenols
  • polyphenols results in decreased expression of FGR mRNA
16293270
SKI606
  • SKI606 results in decreased activity of FGR protein
17114238
Tretinoin
  • Tretinoin results in increased expression of FGR mRNA
16054129

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16443354, 16166294
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 16823087, 15748426, 16788101, 16766008, 17506722, 16140955, 16331271, 17294898, 17361223, 17368321, 17301526, 17339181, 17217047, 17107899, 16935935, 12679006
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Colonic Neoplasms inferred via polyphenols 16293270
Inflammation inferred via polyphenols 16366677
Liver Diseases inferred via polyphenols 16698588
Hemolytic-Uremic Syndrome inferred via Lipopolysaccharides 16366002
Inflammation inferred via Lipopolysaccharides 17255318, 17963957
Iron Metabolism Disorders inferred via Lipopolysaccharides 17255318
Respiratory Hypersensitivity inferred via Lipopolysaccharides 10835634
Amyloidosis inferred via Diethylstilbestrol 15469931
Breast Neoplasms inferred via Diethylstilbestrol 15324884, 17129689
Carcinoma, Hepatocellular inferred via Diethylstilbestrol 16924424, 15948411
Cryptorchidism inferred via Diethylstilbestrol 12952375, 16002989
Endometrial Hyperplasia inferred via Diethylstilbestrol 16402032
Endometrial Neoplasms inferred via Diethylstilbestrol 15700306, 16804899
Female Urogenital Diseases inferred via Diethylstilbestrol 16513791, 16534752, 16002989, 15751030, 16611131
Genital Neoplasms, Female inferred via Diethylstilbestrol 16452187
Hyperplasia inferred via Diethylstilbestrol 12960047, 14722030
Hypospadias inferred via Diethylstilbestrol 16002989
Infertility inferred via Diethylstilbestrol 15036965
Kidney Neoplasms inferred via Diethylstilbestrol 15003126, 14681315, 16762066
Liver Neoplasms inferred via Diethylstilbestrol 16712894, 15890375
Lupus Nephritis inferred via Diethylstilbestrol 15166399
Lymphoma inferred via Diethylstilbestrol 15700306
Male Urogenital Diseases inferred via Diethylstilbestrol 16002989
Neoplasms inferred via Diethylstilbestrol 15313581
Pituitary Diseases inferred via Diethylstilbestrol 14722030
Pituitary Neoplasms inferred via Diethylstilbestrol 15687265, 16977796
Prostatic Neoplasms inferred via Diethylstilbestrol 15846301, 15046698, 17136230
Spermatocele inferred via Diethylstilbestrol 16709447, 16002989
Urinary Bladder Neoplasms inferred via Diethylstilbestrol 16712894, 16452187
Uterine Cervical Neoplasms inferred via Diethylstilbestrol 16175088
Uterine Diseases inferred via Diethylstilbestrol 14652134
Uterine Neoplasms inferred via Diethylstilbestrol 15809267, 16690809
Vaginal Neoplasms inferred via Diethylstilbestrol 16513791, 16002989
Adenocarcinoma inferred via arsenic trioxide 11798837
Blood Coagulation Disorders inferred via arsenic trioxide 16206674
Burkitt Lymphoma inferred via arsenic trioxide 11589617
Carcinoma, Hepatocellular inferred via arsenic trioxide 16217749, 15073043, 15553829, 14691202, 11135700
Carcinoma, Small Cell inferred via arsenic trioxide 12490120
Coronary Restenosis inferred via arsenic trioxide 12609071
Death, Sudden, Cardiac inferred via arsenic trioxide 15213294
Esophageal Neoplasms inferred via arsenic trioxide 12903497
Fatty Liver inferred via arsenic trioxide 15073043
Gallbladder Neoplasms inferred via arsenic trioxide 16904648
Leukemia inferred via arsenic trioxide 15070760
Leukemia-Lymphoma, Adult T-Cell inferred via arsenic trioxide 12560223, 17077332
Leukemia, Monocytic, Acute inferred via arsenic trioxide 16972261
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via arsenic trioxide 14633726
Leukemia, Myeloid, Acute inferred via arsenic trioxide 16467208, 16968895, 17050201
Leukemia, Promyelocytic, Acute inferred via arsenic trioxide 16891316, 16823087, 15622746, 16331271, 17107899, 15748426, 15336539, 15213294, 12679006, 11468182, 11161223, 12712474, 16966277, 17217047, 16330433
Leukemia, T-Cell inferred via arsenic trioxide 16882451
Liver Neoplasms inferred via arsenic trioxide 14682389
Long QT Syndrome inferred via arsenic trioxide 15213294
Lung Neoplasms inferred via arsenic trioxide 11798837
Multiple Myeloma inferred via arsenic trioxide 15949261, 14977855, 11468182
Myelodysplastic Syndromes inferred via arsenic trioxide 16105982, 16882451
Neoplasm Invasiveness inferred via arsenic trioxide 16624393
Ovarian Neoplasms inferred via arsenic trioxide 16624393, 12452020
Pancreatic Neoplasms inferred via arsenic trioxide 15580305
Sarcoma, Ewing's inferred via arsenic trioxide 16646077
Stomach Neoplasms inferred via arsenic trioxide 17007042
Torsades de Pointes inferred via arsenic trioxide 15213294
Urinary Bladder Neoplasms inferred via arsenic trioxide 12973940, 11780464, 12845720

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
CBL FGR / CBL Affinity Capture-Western Melander F (2003)
CCR3 CCR3 / FGR Affinity Capture-Western El-Shazly A (1999)
CD24 CD24 / FGR Affinity Capture-Western Zarn JA (1996)
DAB2 DAB2 / FGR Reconstituted Complex Zhou J (2003)
DOK1 DOK1 / FGR Reconstituted Complex van Dijk TB (2000)
HCLS1 HCLS1 / FGR Reconstituted Complex Brunati AM (1999)
NCOA6 NCOA6 / FGR Affinity Capture-Western Goo YH (2003)
PTK2 PTK2 / FGR Affinity Capture-Western Relou IA (2003)
SLAMF1 SLAMF1 / FGR Affinity Capture-Western Mikhalap SV (1999)
SYK SYK / FGR Affinity Capture-Western Vines CM (2001)
WAS FGR / WAS Affinity Capture-Western Banin S (1996)
WAS FGR / WAS Reconstituted Complex Banin S (1996)
WAS FGR / WAS Reconstituted Complex Finan PM (1996)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Heneghan AF, et al. (2007) "Coactivator assembly at the promoter: efficient recruitment of SRC2 is coupled to cooperative DNA binding by the progesterone receptor." Biochemistry. 46(39):11023-11032. PMID:17845055
  2. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  3. [ + ] Gregory SG, et al. (2006) "The DNA sequence and biological annotation of human chromosome 1." Nature. 441(7091):315-321. PMID:16710414
  4. [ + ] Continolo S, et al. (2005) "The proto-oncogene Fgr regulates cell migration and this requires its plasma membrane localization." Exp Cell Res. 302(2):253-269. PMID:15561106
  5. [ + ] Zhang H, et al. (2005) "The Src family kinases Hck and Fgr negatively regulate neutrophil and dendritic cell chemokine signaling via PIR-B." Immunity. 22(2):235-246. PMID:15723811
  6. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  7. [ + ] Hu Y, et al. (2004) "Requirement of Src kinases Lyn, Hck and Fgr for BCR-ABL1-induced B-lymphoblastic leukemia but not chronic myeloid leukemia." Nat Genet. 36(5):453-461. PMID:15098032
  8. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  9. [ + ] Zhou J, et al. (2003) "Characterization of a novel negative regulator (DOC-2/DAB2) of c-Src in normal prostatic epithelium and cancer." J Biol Chem. 278(9):6936-6941. PMID:12473651
  10. [ + ] Goo YH, et al. (2003) "Activating signal cointegrator 2 belongs to a novel steady-state complex that contains a subset of trithorax group proteins." Mol Cell Biol. 23(1):140-149. PMID:12482968
  11. [ + ] Relou IA, et al. (2003) "Site-specific phosphorylation of platelet focal adhesion kinase by low-density lipoprotein." Biochem J. 369(Pt 2):407-416. PMID:12387730
  12. [ + ] Melander F, et al. (2003) "Fgr but not Syk tyrosine kinase is a target for beta 2 integrin-induced c-Cbl-mediated ubiquitination in adherent human neutrophils." Biochem J. 370(Pt 2):687-694. PMID:12435267
  13. [ + ] Stafford S, et al. (2002) "Lyn tyrosine kinase is important for IL-5-stimulated eosinophil differentiation." J Immunol. 168(4):1978-1983. PMID:11823534
  14. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  15. [ + ] Yamamoto Y, et al. (2002) "Expression and subcellular distribution of the active form of c-Src tyrosine kinase in differentiating human endometrial stromal cells." Mol Hum Reprod. 8(12):1117-1124. PMID:12468645
  16. [ + ] Mandine E, et al. (2002) "High-affinity Src-SH2 ligands which do not activate Tyr(527)-phosphorylated Src in an experimental in vivo system." Biochem Biophys Res Commun. 298(2):185-192. PMID:12387813
  17. [ + ] Nakamura T, et al. (2002) "Activation of Pyk2/RAFTK induces tyrosine phosphorylation of alpha-synuclein via Src-family kinases." FEBS Lett. 521(1-3):190-194. PMID:12096713
  18. [ + ] Carriero MV, et al. (2002) "Inhibition of receptor-dependent urokinase signaling by specific Ser to Glu substitutions." Biol Chem. 383(1):107-113. PMID:11928806
  19. [ + ] Negro A, et al. (2002) "Multiple phosphorylation of alpha-synuclein by protein tyrosine kinase Syk prevents eosin-induced aggregation." FASEB J. 16(2):210-212. PMID:11744621
  20. [ + ] Luciano F, et al. (2001) "Cleavage of Fyn and Lyn in their N-terminal unique regions during induction of apoptosis: a new mechanism for Src kinase regulation." Oncogene. 20(36):4935-4941. PMID:11526478
  21. [ + ] Vines CM, et al. (2001) "Inhibition of beta 2 integrin receptor and Syk kinase signaling in monocytes by the Src family kinase Fgr." Immunity. 15(4):507-519. PMID:11672534
  22. [ + ] De Franceschi L, et al. (2001) "K-Cl cotransport modulation by intracellular Mg in erythrocytes from mice bred for low and high Mg levels." Am J Physiol Cell Physiol. 281(4):C1385-C1395. PMID:11546677
  23. [ + ] Nakamura T, et al. (2001) "Activated Fyn phosphorylates alpha-synuclein at tyrosine residue 125." Biochem Biophys Res Commun. 280(4):1085-1092. PMID:11162638
  24. [ + ] Barlic J, et al. (2000) "Regulation of tyrosine kinase activation and granule release through beta-arrestin by CXCRI." Nat Immunol. 1(3):227-233. PMID:10973280
  25. [ + ] van Dijk TB, et al. (2000) "Stem cell factor induces phosphatidylinositol 3'-kinase-dependent Lyn/Tec/Dok-1 complex formation in hematopoietic cells." Blood. 96(10):3406-3413. PMID:11071635
  26. [ + ] Tatosyan AG, et al. (2000) "Kinases of the Src family: structure and functions." Biochemistry (Mosc). 65(1):49-58. PMID:10702640
  27. [ + ] Lowell CA, et al. (1999) "Integrin signal transduction in myeloid leukocytes." J Leukoc Biol. 65(3):313-320. PMID:10080533
  28. [ + ] Brunati AM, et al. (1999) "Molecular features underlying the sequential phosphorylation of HS1 protein and its association with c-Fgr protein-tyrosine kinase." J Biol Chem. 274(11):7557-7564. PMID:10066823
  29. [ + ] Mikhalap SV, et al. (1999) "CDw150 associates with src-homology 2-containing inositol phosphatase and modulates CD95-mediated apoptosis." J Immunol. 162(10):5719-5727. PMID:10229804
  30. [ + ] Snapper SB, et al. (1999) "The Wiskott-Aldrich syndrome protein (WASP): roles in signaling and cytoskeletal organization." Annu Rev Immunol. 17():905-929. PMID:10358777
  31. [ + ] El-Shazly A, et al. (1999) "Novel association of the src family kinases, hck and c-fgr, with CCR3 receptor stimulation: A possible mechanism for eotaxin-induced human eosinophil chemotaxis." Biochem Biophys Res Commun. 264(1):163-170. PMID:10527858
  32. [ + ] Ruzzene M, et al. (1997) "Sequence specificity of C-terminal Src kinase (CSK)--a comparison with Src-related kinases c-Fgr and Lyn." Eur J Biochem. 246(2):433-439. PMID:9208935
  33. [ + ] Zarn JA, et al. (1996) "Association of CD24 with the kinase c-fgr in a small cell lung cancer cell line and with the kinase lyn in an erythroleukemia cell line." Biochem Biophys Res Commun. 225(2):384-391. PMID:8753773
  34. [ + ] Agostinis P, et al. (1996) "A comparative study of the phosphotyrosyl phosphatase specificity of protein phosphatase type 2A and phosphotyrosyl phosphatase type 1B using phosphopeptides and the phosphoproteins p50/HS1, c-Fgr and Lyn." Eur J Biochem. 236(2):548-557. PMID:8612628
  35. [ + ] Finan PM, et al. (1996) "Identification of regions of the Wiskott-Aldrich syndrome protein responsible for association with selected Src homology 3 domains." J Biol Chem. 271(42):26291-26295. PMID:8824280
  36. [ + ] Banin S, et al. (1996) "Wiskott-Aldrich syndrome protein (WASp) is a binding partner for c-Src family protein-tyrosine kinases." Curr Biol. 6(8):981-988. PMID:8805332
  37. [ + ] Kefalas P, et al. (1995) "Identification of a phorbol ester responsive region in the myeloid-specific promoter of the c-fgr proto-oncogene." Biochem Biophys Res Commun. 209(1):60-65. PMID:7726865
  38. [ + ] Yan SR, et al. (1995) "Activation of p58c-fgr and p53/56lyn in adherent human neutrophils: evidence for a role of divalent cations in regulating neutrophil adhesion and protein tyrosine kinase activities." J Inflamm. 45(4):297-311. PMID:8867673
  39. [ + ] Link DC, et al. (1995) "The proto-oncogene c-fgr is expressed in normal mantle zone B lymphocytes and is developmentally regulated during myelomonocytic differentiation in vivo." Blood. 85(2):472-479. PMID:7812001
  40. [ + ] Marcilla A, et al. (1995) "Identification of the major tyrosine kinase substrate in signaling complexes formed after engagement of Fc gamma receptors." J Biol Chem. 270(16):9115-9120. PMID:7721825
  41. [ + ] Rivero-Lezcano OM, et al. (1995) "Wiskott-Aldrich syndrome protein physically associates with Nck through Src homology 3 domains." Mol Cell Biol. 15(10):5725-5731. PMID:7565724
  42. [ + ] Resh MD, et al. (1994) "Myristylation and palmitylation of Src family members: the fats of the matter." Cell. 76(3):411-413. PMID:8313462
  43. [ + ] Ruzzene M, et al. (1994) "Regulation of c-Fgr protein kinase by c-Src kinase (CSK) and by polycationic effectors." J Biol Chem. 269(22):15885-15891. PMID:7515063
  44. [ + ] MacAuley A, et al. (1993) "Phosphorylation of Src mutants at Tyr 527 in fibroblasts does not correlate with in vitro phosphorylation by CSK." Oncogene. 8(1):117-124. PMID:7678701
  45. [ + ] Patel MS, et al. (1992) "A polymorphic microsatellite repeat is located close to the promoter region of the c-fgr proto-oncogene (FGR) at chromosome 1p36.2-p36.1." Hum Mol Genet. 1(1):65. PMID:1339476
  46. [ + ] Link DC, et al. (1992) "Characterization of the 5' untranslated region of the human c-fgr gene and identification of the major myelomonocytic c-fgr promoter." Oncogene. 7(5):877-884. PMID:1373875
  47. [ + ] Gutkind JS, et al. (1991) "A novel c-fgr exon utilized in Epstein-Barr virus-infected B lymphocytes but not in normal monocytes." Mol Cell Biol. 11(3):1500-1507. PMID:1847500
  48. [ + ] Patel M, et al. (1991) "The c-fgr proto-oncogene: expression in Epstein-Barr-virus-infected B lymphocytes and in cells of the myelomonocytic and granulocytic lineages." Pathobiology. 59(4):289-292. PMID:1652975
  49. [ + ] Biondi A, et al. (1991) "Expression of lineage-restricted protein tyrosine kinase genes in human natural killer cells." Eur J Immunol. 21(3):843-846. PMID:1826268
  50. [ + ] Patel M, et al. (1990) "Structure of the complete human c-fgr proto-oncogene and identification of multiple transcriptional start sites." Oncogene. 5(2):201-206. PMID:1690869