FGFR4 | GeneID:2264 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2264 Official Symbol FGFR4
Locus N/A Gene Type protein-coding
Synonyms CD334; JTK2; MGC20292; TKF
Full Name fibroblast growth factor receptor 4
Description fibroblast growth factor receptor 4
Chromosome 5q35.1-qter
Also Known As OTTHUMP00000161430; hydroxyaryl-protein kinase; protein-tyrosine kinase; tyrosine kinase related to fibroblast growth factor receptor; tyrosylprotein kinase
Summary The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. The genomic organization of this gene, compared to members 1-3, encompasses 18 exons rather than 19 or 20. Although alternative splicing has been observed, there is no evidence that the C-terminal half of the IgIII domain of this protein varies between three alternate forms, as indicated for members 1-3. This particular family member preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 20461

ID Symbol Protein Species
GeneID:2264 FGFR4 NP_002002.3 Homo sapiens
GeneID:14186 Fgfr4 NP_032037.2 Mus musculus
GeneID:25114 Fgfr4 XP_344571.3 Rattus norvegicus
GeneID:317696 FGFR4 XP_602166.3 Bos taurus
GeneID:462301 FGFR4 XP_518127.2 Pan troglodytes
GeneID:489095 FGFR4 XP_546211.2 Canis lupus familiaris
GeneID:100000160 fgfr4 NP_571505.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab5481 FGFR4 antibody (ab5481); Rabbit polyclonal to FGFR4
2 abcam ab41948 FGFR4 antibody (ab41948); Rabbit polyclonal to FGFR4
3 abgent AM7936a FGFR4 Monoclonal Antibody (Ascites); Unpurified Mouse Monoclonal Antibody (Mab)
4 abgent AM7936b FGFR4 Monoclonal Antibody; Purified Mouse Monoclonal Antibody (Mab)
5 abgent AP7645b FLT4 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
6 abgent AP7639d FGFR4 Antibody; Purified Rabbit Polyclonal Antibody (Pab)
7 abgent AP7645a FLT4 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
8 abgent AP7639a FGFR4 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
9 abnova H00002264-M05 FGFR4 monoclonal antibody (M05), clone 1E2; Mouse monoclonal antibody raised against a partial recombinant FGFR4.
10 acris AP14344PU-N CD334 / FGFR4; antibody Ab
11 acris AM11075SU-N CD334 / FGFR4 Ascites; antibody Ab
12 acris AM11076PU-N CD334 / FGFR4; antibody Ab
13 acris AP14343PU-N CD334 / FGFR4 (N-term); antibody Ab
14 scbt FGFR4 FGFR4 Antibody / FGFR4 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of FGFR4 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FGFR4 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005887 Component integral to plasma membrane
GO:0005886 Component plasma membrane
GO:0005524 Function ATP binding
GO:0005007 Function fibroblast growth factor receptor activity
GO:0000166 Function nucleotide binding
GO:0004872 Function receptor activity
GO:0016740 Function transferase activity
GO:0008543 Process fibroblast growth factor receptor signaling pathway
GO:0001759 Process induction of an organ
GO:0030324 Process lung development
GO:0006468 Process protein amino acid phosphorylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_002011  UCSC Browser NP_002002
2 NM_022963  UCSC Browser NP_075252
3 NM_213647  UCSC Browser NP_998812

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000292408 MI0000060 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000292408 MI0000061 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000292408 MI0000062 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000292408 MI0000063 hsa-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENST00000292408 MI0000064 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENST00000292408 MI0000065 hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENST00000292408 MI0000066 hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENST00000292408 MI0000066 hsa-let-7e* CUAUACGGCCUCCUAGCUUUCC
ENST00000292408 MI0000067 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000292408 MI0000068 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000292408 MI0000433 hsa-let-7g* CUGUACAGGCCACUGCCUUGC
ENST00000292408 MI0000434 hsa-let-7i* CUGCGCAAGCUACUGCCUUGCU
ENST00000292408 MI0000442 hsa-miR-122* AACGCCAUUAUCACACUAAAUA
ENST00000292408 MI0000455 hsa-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENST00000292408 MI0000476 hsa-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENST00000292408 MI0003137 hsa-miR-193b* CGGGGUUUUGAGGGCGAGAUGA
ENST00000292408 MI0000073 hsa-miR-19a* AGUUUUGCAUAGUUGCACUACA
ENST00000292408 MI0000080 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000292408 MI0000081 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000292408 MI0000085 hsa-miR-27a* AGGGCUUAGCUGCUUGUGAGCA
ENST00000292408 MI0000441 hsa-miR-30b* CUGGGAGGUGGAUGUUUACUUC
ENST00000292408 MI0000089 hsa-miR-31 AGGCAAGAUGCUGGCAUAGCU
ENST00000292408 MI0000808 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
ENST00000292408 MI0000803 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC
ENST00000292408 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENST00000292408 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENST00000292408 MI0001446 hsa-miR-424* CAAAACGUGAGGCGCUGCUAU
ENST00000292408 MI0003513 hsa-miR-455-5p UAUGUGCCUUUGGACUACAUCG
ENST00000292408 MI0002468 hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENST00000292408 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000292408 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENST00000292408 MI0003138 hsa-miR-497 CAGCAGCACACUGUGGUUUGU
ENST00000292408 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENST00000292408 MI0003170 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENST00000292408 MI0003173 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENST00000292408 MI0003169 hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG
ENST00000292408 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000292408 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000292408 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENST00000292408 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENST00000292408 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENST00000292408 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENST00000292408 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENST00000292408 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENST00000292408 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENST00000292408 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENST00000292408 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENST00000292408 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENST00000292408 MI0002405 mmu-miR-470 UUCUUGGACUGGCACUGGUGAGU
ENST00000292408 MI0004601 mmu-miR-673-5p CUCACAGCUCUGGUCCUUGGAG
ENST00000292408 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.2195G>A1
c.2014C>A1
c.606G>A1
c.1528G>A1
Primary Site / Histology (Top 10)Mutations (sites * observations)
lung / carcinoma2
skin / malignant melanoma1
breast / carcinoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one
  • 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one does not affect the reaction [[FGF1 protein binds to and results in increased activity of FGFR4 protein] which results in increased phosphorylation of MAPK1 protein]
  • 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one inhibits the reaction [[FGF2 protein binds to and results in increased activity of FGFR4 protein] which results in increased phosphorylation of MAPK1 protein]
11336793
Acetaminophen
  • Acetaminophen affects the expression of FGFR4 mRNA
17562736
Benomyl
  • Benomyl results in increased expression of FGFR4 mRNA
15885261
Bile Acids and Salts
  • FGFR4 protein affects the metabolism of and affects the abundance of and affects the secretion of Bile Acids and Salts
10809780
Bile Acids and Salts
  • FGFR4 protein affects the abundance of Bile Acids and Salts
16213224
Bile Acids and Salts
  • FGFR4 protein results in decreased chemical synthesis of Bile Acids and Salts
15750181
Carbon Tetrachloride
  • FGFR4 protein results in chemical resistance to Carbon Tetrachloride
12466116
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of FGFR4 mRNA
17805973, 16644059
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of FGFR4 mRNA
17032414
Cholesterol
  • FGFR4 protein affects the metabolism of Cholesterol
11956156
Cholesterol
  • FGFR4 protein results in decreased metabolism of Cholesterol
15750181
Cholesterol, Dietary
  • FGFR4 protein affects the metabolism of and affects the abundance of Cholesterol, Dietary
10809780
Cyclosporine
  • Cyclosporine results in increased expression of FGFR4 protein
  • [Thioacetamide co-treated with Cyclosporine] results in decreased expression of FGFR4 protein
15770714
Dextran Sulfate
  • Dextran Sulfate binds to and results in increased phosphorylation of and results in increased activity of FGFR4 protein
7774576
Dichlorodiphenyl Dichloroethylene
  • Dichlorodiphenyl Dichloroethylene results in increased expression of FGFR4 mRNA
15885261
Dimethylnitrosamine
  • Dimethylnitrosamine results in increased expression of FGFR4 mRNA
17032414
Flutamide
  • Flutamide results in increased expression of FGFR4 mRNA
15885261
fucoidan
  • fucoidan binds to and results in increased phosphorylation of and results in increased activity of FGFR4 protein
7774576
Furosemide
  • Furosemide affects the expression of FGFR4 mRNA
16526316
Heparan Sulfate Proteoglycans
  • Heparan Sulfate Proteoglycans affects the reaction [FGF1 protein binds to FGFR4 protein]
  • Heparan Sulfate Proteoglycans affects the reaction [FGF2 protein binds to FGFR4 protein]
10336501
Heparin
  • Heparin promotes the reaction [FGFR4 protein binds to FGFR4 protein]
10736564
Heparin
  • Heparin analog binds to FGFR4 protein
11278860
Heparin
  • Heparin affects the reaction [FGF1 protein binds to FGFR4 protein]
  • Heparin affects the reaction [FGF2 protein binds to FGFR4 protein]
10336501
Heparin
  • Heparin promotes the reaction [FGF19 protein binds to FGFR4 protein]
10525310
Heparin
  • Heparin binds to and results in increased phosphorylation of and results in increased activity of FGFR4 protein
7774576
Heparitin Sulfate
  • Heparitin Sulfate analog binds to FGFR4 protein
11278860
Methylnitrosourea
  • Methylnitrosourea results in increased expression of and affects the localization of FGFR4 protein
15581186
Okadaic Acid
  • Okadaic Acid results in decreased phosphorylation of FGFR4 protein
8576110
Oligosaccharides
  • Oligosaccharides analog binds to FGFR4 protein
11278860
Oligosaccharides
  • Oligosaccharides promotes the reaction [FGF1 protein binds to FGFR4 protein]
9174673, 11714710
PD 173074
  • PD 173074 results in decreased activity of FGFR4 protein
15377668
PD 173074
  • PD 173074 inhibits the reaction [FGF1 protein results in increased phosphorylation of FGFR4 protein]
15709206
Phthalic Acids
  • Phthalic Acids results in decreased expression of FGFR4 mRNA
15728792
sodium arsenate
  • sodium arsenate results in decreased expression of FGFR4 mRNA
16882884
sodium arsenite
  • sodium arsenite results in increased expression of FGFR4 mRNA
12377979
Taurocholic Acid
  • FGFR4 protein affects the reaction [Taurocholic Acid results in decreased expression of CYP7A1 mRNA]
  • FGFR4 protein affects the reaction [Taurocholic Acid results in decreased expression of PON1 mRNA]
16284190
Thioacetamide
  • Thioacetamide results in increased expression of FGFR4 protein
  • [Thioacetamide co-treated with Cyclosporine] results in decreased expression of FGFR4 protein
15770714
Tretinoin
  • Tretinoin results in decreased expression of FGFR4 mRNA
7680553
Vanadates
  • Vanadates results in increased phosphorylation of FGFR4 protein
8576110
wortmannin
  • wortmannin does not affect the reaction [[FGF1 protein binds to and results in increased activity of FGFR4 protein] which results in increased phosphorylation of MAPK1 protein]
  • wortmannin inhibits the reaction [[FGF2 protein binds to and results in increased activity of FGFR4 protein] which results in increased phosphorylation of MAPK1 protein]
11336793

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Prostatic Neoplasms marker 15448004
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16443354, 16166294
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 15748426, 16788101, 16766008, 16140955, 16331271, 17294898, 17361223, 17368321, 17301526, 17339181, 17506722, 17217047, 17107899, 16935935, 12679006, 16823087
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Liver Cirrhosis, Experimental inferred via Thioacetamide 16248980, 18395095, 18295389, 16097051
Adrenal Gland Neoplasms inferred via sodium arsenite 15276417
Adrenocortical Adenoma inferred via sodium arsenite 16712894
Carcinoma, Hepatocellular inferred via sodium arsenite 15276417, 16507464
Carcinoma, Squamous Cell inferred via sodium arsenite 18572023
Genital Neoplasms, Female inferred via sodium arsenite 16452187
Hodgkin Disease inferred via sodium arsenite 12676792
Liver Neoplasms inferred via sodium arsenite 15276417, 16712894
Lung Neoplasms inferred via sodium arsenite 15276417, 17077188, 16712894
Melanoma inferred via sodium arsenite 16487513
Neoplasms inferred via sodium arsenite 11559025
Neural Tube Defects inferred via sodium arsenite 12854658
Ovarian Neoplasms inferred via sodium arsenite 15276417
Prostatic Neoplasms inferred via sodium arsenite 16039940
Skin Neoplasms inferred via sodium arsenite 18572023
Spinal Dysraphism inferred via sodium arsenite 12854658
Urinary Bladder Neoplasms inferred via sodium arsenite 11723127, 16452187, 16712894
Uterine Cervical Neoplasms inferred via sodium arsenite 11813266
Vascular Diseases inferred via sodium arsenite 17056641
Neural Tube Defects inferred via sodium arsenate 11749123
Glioblastoma inferred via Okadaic Acid 17312396
Adenocarcinoma inferred via Methylnitrosourea 15688392, 15113128
Breast Neoplasms inferred via Methylnitrosourea 16253758
Cataract inferred via Methylnitrosourea 12484553
Fibrosarcoma inferred via Methylnitrosourea 11555667
Glioma inferred via Methylnitrosourea 9825942
Limb Deformities, Congenital inferred via Methylnitrosourea 15526292
Lower Extremity Deformities, Congenital inferred via Methylnitrosourea 16080182
Lung Neoplasms inferred via Methylnitrosourea 18062963
Lymphoma inferred via Methylnitrosourea 11418001, 16257854
Lymphoma, B-Cell inferred via Methylnitrosourea 14633661
Mammary Neoplasms, Experimental inferred via Methylnitrosourea 16619500, 17131329, 11807958, 14999141, 16827153, 11751437, 16051031, 10767621, 10838139, 16944150, 15113128, 15688392, 12931682, 15313902, 17020996
Neoplasms inferred via Methylnitrosourea 15533788
Neoplasms, Experimental inferred via Methylnitrosourea 12696579
Neurilemmoma inferred via Methylnitrosourea 11555667
Pancreatic Neoplasms inferred via Methylnitrosourea 16965848
Prostatic Neoplasms inferred via Methylnitrosourea 15682402, 12376480
Retinal Degeneration inferred via Methylnitrosourea 18155124, 18172121
Retinoblastoma inferred via Methylnitrosourea 11555667
Stomach Neoplasms inferred via Methylnitrosourea 18593901, 16257854, 15930296
Thymus Neoplasms inferred via Methylnitrosourea 11418001
Liver Cirrhosis, Experimental inferred via Heparin 16904936
Dyspnea inferred via Furosemide 16935035
Edema inferred via Furosemide 11834646
Heart Failure inferred via Furosemide 16011733, 12660669, 16845234
Hypercalcemia inferred via Furosemide 17652376
Hypercalciuria inferred via Furosemide 17652376
Hyperparathyroidism, Secondary inferred via Furosemide 15086907
Hypertension, Pregnancy-Induced inferred via Furosemide 16612254
Hypoproteinemia inferred via Furosemide 16096441
Nephrocalcinosis inferred via Furosemide 15086907
Nocturnal Enuresis inferred via Furosemide 17945291
Polyuria inferred via Furosemide 17945291
Reperfusion Injury inferred via Furosemide 16526316
Respiratory Distress Syndrome, Adult inferred via Furosemide 12394941, 15912074, 16096441
Stomach Neoplasms inferred via Furosemide 17052386
Hyperandrogenism inferred via Flutamide 15356085
Polycystic Ovary Syndrome inferred via Flutamide 15356085
Adenocarcinoma inferred via Dimethylnitrosamine 16033868
Carcinoma, Squamous Cell inferred via Dimethylnitrosamine 16033868
Esophageal Neoplasms inferred via Dimethylnitrosamine 17016578
Liver Cirrhosis, Experimental inferred via Dimethylnitrosamine 17203207, 18210741, 17534399, 17465448, 16570917, 14659978, 17196135, 16042886, 15793283, 18371158, 12925901, 15366600, 17348192, 17201889, 18237412, 17719030, 15081153, 16169303, 14643895, 18567088, 15798949, 15571005, 15161499, 12918455, 15298665, 18239293, 16270385, 17881167, 15492853, 18629640, 15864749, 15763062, 16544323, 15842777, 17640959, 18364076, 15369754, 15099470, 14709902, 15577212, 15504291, 17666798, 15138612, 15339415, 17432682, 17198567, 15086199, 15733078, 16009107, 18637143, 18672772, 15067225, 16603200, 17724770, 15723089, 14726149, 16627068, 15942678, 15744066, 15591649, 15479170, 15383259, 14568256, 18095165, 17036385
Liver Failure, Acute inferred via Dimethylnitrosamine 17457977
Liver Neoplasms inferred via Dimethylnitrosamine 3113478, 15890375
Liver Neoplasms, Experimental inferred via Dimethylnitrosamine 15603536
Lung Neoplasms inferred via Dimethylnitrosamine 16061637
Stomach Neoplasms inferred via Dimethylnitrosamine 16033868
Agricultural Workers' Diseases inferred via Dichlorodiphenyl Dichloroethylene 16487989
Breast Neoplasms inferred via Dichlorodiphenyl Dichloroethylene 15061365
Dyspnea inferred via Dichlorodiphenyl Dichloroethylene 16487989
Hepatitis inferred via Dichlorodiphenyl Dichloroethylene 16487989
Infertility, Male inferred via Dichlorodiphenyl Dichloroethylene 12948891, 17192596
Limb Deformities, Congenital inferred via Dichlorodiphenyl Dichloroethylene 12745335
Urologic Diseases inferred via Dichlorodiphenyl Dichloroethylene 16487989
Colitis inferred via Dextran Sulfate 16375993
Gingival Hyperplasia inferred via Cyclosporine 8708960
Metal Metabolism, Inborn Errors inferred via Cyclosporine 16801185
Nephrosis, Lipoid inferred via Cyclosporine 17954296
Nephrotic Syndrome inferred via Cyclosporine 18481113
Psoriasis inferred via Cyclosporine 16882103
Atherosclerosis inferred via Cholesterol 16632123
Hypercholesterolemia inferred via Cholesterol 16933029
Learning Disorders inferred via Cholesterol 17134702
Niemann-Pick Disease, Type C inferred via Cholesterol 9802331
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16050911, 16011737, 16097048, 15673190, 10355542, 16227642, 16124888, 15700767
Fatty Liver inferred via Carbon Tetrachloride 16045604, 16239168, 15959796, 12795759, 61145, 12631006, 17595544
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15998439, 16227642, 15027814, 15968718, 16177239, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 17334410, 16239168
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 16116963, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 18395095, 18156304, 17976157, 17557913, 17805973, 17525996, 16248980, 15925388, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 16638106
Liver Diseases inferred via Carbon Tetrachloride 16246199, 17285989, 15720792, 15830285, 16964402
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Anophthalmos inferred via Benomyl 15907663
Eye Abnormalities inferred via Benomyl 1914497
Nervous System Malformations inferred via Benomyl 14502586
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17522070, 16081117, 17562736, 14986274, 16177239, 16227642, 15968718
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Leukemia inferred via 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one 12970779
Ovarian Neoplasms inferred via 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one 16211241

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
FGF1 FGF1 / FGFR4 Reconstituted Complex Kan M (1999)
FGF1 FGF1 / FGFR4 Reconstituted Complex Loo BB (2000)
FGF19 FGF19 / FGFR4 Reconstituted Complex Xie MH (1999)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Falvella FS, et al. (2009) "FGFR4 Gly388Arg polymorphism may affect the clinical stage of patients with lung cancer by modulating the transcriptional profile of normal lung." Int J Cancer. 124(12):2880-2885. PMID:19296538
  2. [ + ] Roidl A, et al. (2009) "Resistance to chemotherapy is associated with fibroblast growth factor receptor 4 up-regulation." Clin Cancer Res. 15(6):2058-2066. PMID:19240166
  3. [ + ] Shin DJ, et al. (2009) "FGF15/FGFR4 integrates growth factor signaling with hepatic bile acid metabolism and insulin action." J Biol Chem. 284(17):11110-11120. PMID:19237543
  4. [ + ] Ho HK, et al. (2009) "Fibroblast growth factor receptor 4 regulates proliferation, anti-apoptosis and alpha-fetoprotein secretion during hepatocellular carcinoma progression and represents a potential target for therapeutic intervention." J Hepatol. 50(1):118-127. PMID:19008009
  5. [ + ] Pai R, et al. (2008) "Inhibition of fibroblast growth factor 19 reduces tumor growth by modulating beta-catenin signaling." Cancer Res. 68(13):5086-5095. PMID:18593907
  6. [ + ] Jin P, et al. (2008) "Novel splice variants derived from the receptor tyrosine kinase superfamily are potential therapeutics for rheumatoid arthritis." Arthritis Res Ther. 10(4):R73. PMID:18593464
  7. [ + ] Ansell A, et al. (2008) "Polymorphism of FGFR4 in cancer development and sensitivity to cisplatin and radiation in head and neck cancer." Oral Oncol. ():. PMID:18487077
  8. [ + ] Sasaki H, et al. (2008) "Fibroblast growth factor receptor 4 mutation and polymorphism in Japanese lung cancer." Oncol Rep. 20(5):1125-1130. PMID:18949411
  9. [ + ] Fitzgerald LM, et al. (2008) "Association of FGFR4 genetic polymorphisms with prostate cancer risk and prognosis." Prostate Cancer Prostatic Dis. ():. PMID:18762813
  10. [ + ] Ma Z, et al. (2008) "Polymorphisms of fibroblast growth factor receptor 4 have association with the development of prostate cancer and benign prostatic hyperplasia and the progression of prostate cancer in a Japanese population." Int J Cancer. 123(11):2574-2579. PMID:18756523
  11. [ + ] Wang J, et al. (2008) "Altered fibroblast growth factor receptor 4 stability promotes prostate cancer progression." Neoplasia. 10(8):847-856. PMID:18670643
  12. [ + ] Hopkins J, et al. (2008) "Genetic polymorphisms and head and neck cancer outcomes: a review." Cancer Epidemiol Biomarkers Prev. 17(3):490-499. PMID:18349267
  13. [ + ] Park HK, et al. (2008) "Distinct association of genetic variations of vascular endothelial growth factor, transforming growth factor-beta, and fibroblast growth factor receptors with atopy and airway hyperresponsiveness." Allergy. 63(4):447-453. PMID:18315732
  14. [ + ] Meijer D, et al. (2008) "Fibroblast growth factor receptor 4 predicts failure on tamoxifen therapy in patients with recurrent breast cancer." Endocr Relat Cancer. 15(1):101-111. PMID:18310279
  15. [ + ] Desnoyers LR, et al. (2008) "Targeting FGF19 inhibits tumor growth in colon cancer xenograft and FGF19 transgenic hepatocellular carcinoma models." Oncogene. 27(1):85-97. PMID:17599042
  16. [ + ] Matakidou A, et al. (2007) "Further observations on the relationship between the FGFR4 Gly388Arg polymorphism and lung cancer prognosis." Br J Cancer. 96(12):1904-1907. PMID:17519899
  17. [ + ] da Costa Andrade VC, et al. (2007) "The fibroblast growth factor receptor 4 (FGFR4) Arg388 allele correlates with survival in head and neck squamous cell carcinoma." Exp Mol Pathol. 82(1):53-57. PMID:17084840
  18. [ + ] Marks JL, et al. (2007) "Mutational analysis of EGFR and related signaling pathway genes in lung Adenocarcinomas identifies a novel somatic kinase domain mutation in FGFR4." PLoS ONE. 2(5):e426. PMID:17487277
  19. [ + ] Huang X, et al. (2007) "FGFR4 prevents hyperlipidemia and insulin resistance but underlies high-fat diet induced fatty liver." Diabetes. 56(10):2501-2510. PMID:17664243
  20. [ + ] Streit S, et al. (2006) "FGFR4 Arg388 allele correlates with tumour thickness and FGFR4 protein expression with survival of melanoma patients." Br J Cancer. 94(12):1879-1886. PMID:16721364
  21. [ + ] Zhang X, et al. (2006) "Receptor specificity of the fibroblast growth factor family. The complete mammalian FGF family." J Biol Chem. 281(23):15694-15700. PMID:16597617
  22. [ + ] Stadler CR, et al. (2006) "FGFR4 GLY388 isotype suppresses motility of MDA-MB-231 breast cancer cells by EDG-2 gene repression." Cell Signal. 18(6):783-794. PMID:16109476
  23. [ + ] Thussbas C, et al. (2006) "FGFR4 Arg388 allele is associated with resistance to adjuvant therapy in primary breast cancer." J Clin Oncol. 24(23):3747-3755. PMID:16822847
  24. [ + ] Yu C, et al. (2005) "Independent repression of bile acid synthesis and activation of c-Jun N-terminal kinase (JNK) by activated hepatocyte fibroblast growth factor receptor 4 (FGFR4) and bile acids." J Biol Chem. 280(18):17707-17714. PMID:15750181
  25. [ + ] Ben-Haroush A, et al. (2005) "Expression of basic fibroblast growth factor and its receptors in human ovarian follicles from adults and fetuses." Fertil Steril. 84 Suppl 2():1257-1268. PMID:16210019
  26. [ + ] Haugsten EM, et al. (2005) "Different intracellular trafficking of FGF1 endocytosed by the four homologous FGF receptors." J Cell Sci. 118(Pt 17):3869-3881. PMID:16091423
  27. [ + ] Spinola M, et al. (2005) "Functional FGFR4 Gly388Arg polymorphism predicts prognosis in lung adenocarcinoma patients." J Clin Oncol. 23(29):7307-7311. PMID:16061909
  28. [ + ] Spinola M, et al. (2005) "FGFR4 Gly388Arg polymorphism and prognosis of breast and colorectal cancer." Oncol Rep. 14(2):415-419. PMID:16012724
  29. [ + ] St Bernard R, et al. (2005) "Fibroblast growth factor receptors as molecular targets in thyroid carcinoma." Endocrinology. 146(3):1145-1153. PMID:15564323
  30. [ + ] Qian ZR, et al. (2004) "Cytoplasmic expression of fibroblast growth factor receptor-4 in human pituitary adenomas: relation to tumor type, size, proliferation, and invasiveness." J Clin Endocrinol Metab. 89(4):1904-1911. PMID:15070963
  31. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  32. [ + ] Wang J, et al. (2004) "The fibroblast growth factor receptor-4 Arg388 allele is associated with prostate cancer initiation and progression." Clin Cancer Res. 10(18 Pt 1):6169-6178. PMID:15448004
  33. [ + ] Zhang Z, et al. (2004) "Signal peptide prediction based on analysis of experimentally verified cleavage sites." Protein Sci. 13(10):2819-2824. PMID:15340161
  34. [ + ] DeVries TA, et al. (2004) "Protein kinase Cdelta regulates apoptosis via activation of STAT1." J Biol Chem. 279(44):45603-45612. PMID:15322115
  35. [ + ] Ezzat S, et al. (2004) "Pituitary tumor-derived fibroblast growth factor receptor 4 isoform disrupts neural cell-adhesion molecule/N-cadherin signaling to diminish cell adhesiveness: a mechanism underlying pituitary neoplasia." Mol Endocrinol. 18(10):2543-2552. PMID:15231874
  36. [ + ] Sorensen V, et al. (2004) "Deletion mutant of FGFR4 induces onion-like membrane structures in the nucleus." J Cell Sci. 117(Pt 9):1807-1819. PMID:15075241
  37. [ + ] Jezequel P, et al. (2004) "G388R mutation of the FGFR4 gene is not relevant to breast cancer prognosis." Br J Cancer. 90(1):189-193. PMID:14710228
  38. [ + ] Garnovskaya MN, et al. (2003) "Hypertonicity activates Na+/H+ exchange through Janus kinase 2 and calmodulin." J Biol Chem. 278(19):16908-16915. PMID:12626508
  39. [ + ] Dolled-Filhart M, et al. (2003) "Tissue microarray analysis of signal transducers and activators of transcription 3 (Stat3) and phospho-Stat3 (Tyr705) in node-negative breast cancer shows nuclear localization is associated with a better prognosis." Clin Cancer Res. 9(2):594-600. PMID:12576423
  40. [ + ] Dimberg A, et al. (2003) "Ser727/Tyr701-phosphorylated Stat1 is required for the regulation of c-Myc, cyclins, and p27Kip1 associated with ATRA-induced G0/G1 arrest of U-937 cells." Blood. 102(1):254-261. PMID:12637327
  41. [ + ] Yu S, et al. (2003) "Pituitary tumor AP-2alpha recognizes a cryptic promoter in intron 4 of fibroblast growth factor receptor 4." J Biol Chem. 278(22):19597-19602. PMID:12642581
  42. [ + ] Becker N, et al. (2003) "The fibroblast growth factor receptor gene Arg388 allele is not associated with early lymph node metastasis of breast cancer." Cancer Epidemiol Biomarkers Prev. 12(6):582-583. PMID:12815007
  43. [ + ] Deb DK, et al. (2003) "Activation of protein kinase C delta by IFN-gamma." J Immunol. 171(1):267-273. PMID:12817007
  44. [ + ] Lo RK, et al. (2003) "Constitutively active Galpha16 stimulates STAT3 via a c-Src/JAK- and ERK-dependent mechanism." J Biol Chem. 278(52):52154-52165. PMID:14551213
  45. [ + ] Morimoto Y, et al. (2003) "Single nucleotide polymorphism in fibroblast growth factor receptor 4 at codon 388 is associated with prognosis in high-grade soft tissue sarcoma." Cancer. 98(10):2245-2250. PMID:14601095
  46. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  47. [ + ] Takenaka H, et al. (2002) "Immunolocalization of fibroblast growth factor receptors in normal and wounded human skin." Arch Dermatol Res. 294(7):331-338. PMID:12373339
  48. [ + ] Schreiner SJ, et al. (2002) "Activation of STAT3 by the Src family kinase Hck requires a functional SH3 domain." J Biol Chem. 277(47):45680-45687. PMID:12244095
  49. [ + ] Yu S, et al. (2002) "Fibroblast growth factor receptor 4 is a target for the zinc-finger transcription factor Ikaros in the pituitary." Mol Endocrinol. 16(5):1069-1078. PMID:11981041