FGFR2 | GeneID:2263 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2263 Official Symbol FGFR2
Locus N/A Gene Type protein-coding
Synonyms BEK; BFR-1; CD332; CEK3; CFD1; ECT1; FLJ98662; JWS; K-SAM; KGFR; TK14; TK25
Full Name fibroblast growth factor receptor 2
Description fibroblast growth factor receptor 2
Chromosome 10q26
Also Known As BEK fibroblast growth factor receptor; FGF receptor; OTTHUMP00000020621; OTTHUMP00000020629; bacteria-expressed kinase; hydroxyaryl-protein kinase; keratinocyte growth factor receptor; protein tyrosine kinase, receptor like 14; soluble FGFR4 variant 4
Summary The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member is a high-affinity receptor for acidic, basic and/or keratinocyte growth factor, depending on the isoform. Mutations in this gene are associated with Crouzon syndrome, Pfeiffer syndrome, Craniosynostosis, Apert syndrome, Jackson-Weiss syndrome, Beare-Stevenson cutis gyrata syndrome, Saethre-Chotzen syndrome, and syndromic craniosynostosis. Multiple alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22566

ID Symbol Protein Species
GeneID:2263 FGFR2 NP_000132.1 Homo sapiens
GeneID:14183 Fgfr2 NP_034337.2 Mus musculus
GeneID:25022 Fgfr2 XP_341941.3 Rattus norvegicus
GeneID:39564 btl NP_001014583.1 Drosophila melanogaster
GeneID:42160 htl NP_732287.1 Drosophila melanogaster
GeneID:352940 fgfr2 NP_840088.1 Danio rerio
GeneID:396259 FGFR2 NP_990650.1 Gallus gallus
GeneID:404193 FGFR2 XP_885574.2 Bos taurus
GeneID:415125 FGFR2 NP_001003336.1 Canis lupus familiaris
GeneID:466220 FGFR2 XP_001157227.1 Pan troglodytes
GeneID:1273778 AgaP_AGAP003108 XP_562866.1 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab10648 FGFR2 antibody (ab10648); Rabbit polyclonal to FGFR2
2 abcam ab10647 FGFR2 antibody (ab10647); Rabbit polyclonal to FGFR2
3 abcam ab52246 FGFR2 antibody (ab52246); Rabbit polyclonal to FGFR2
4 abcam ab58201 FGFR2 antibody (ab58201); Mouse monoclonal to FGFR2
5 abcam ab27481 FGFR2 antibody, prediluted (ab27481); Rabbit polyclonal to FGFR2, prediluted
6 abcam ab5476 FGFR2 antibody (ab5476); Rabbit polyclonal to FGFR2
7 abgent AP7637a FGFR2 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
8 abgent AP7637b FGFR2 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
9 abgent AP7637d FGFR2 Antibody (N-term R22); Purified Rabbit Polyclonal Antibody (Pab)
10 abgent AP7637e FGFR2 Antibody; Purified Rabbit Polyclonal Antibody (Pab)
11 abnova H00002263-M04 FGFR2 monoclonal antibody (M04), clone 3F4; Mouse monoclonal antibody raised against a partial recombinant FGFR2.
12 abnova H00002263-M03 FGFR2 monoclonal antibody (M03), clone 2C11; Mouse monoclonal antibody raised against a partial recombinant FGFR2.
13 abnova H00002263-M02 FGFR2 monoclonal antibody (M02), clone 2E8; Mouse monoclonal antibody raised against a partial recombinant FGFR2.
14 abnova H00002263-M01 FGFR2 monoclonal antibody (M01), clone 1G3; Mouse monoclonal antibody raised against a partial recombinant FGFR2.
15 acris AP14339PU-N CD332 / FGFR-2 (C-term); antibody Ab
16 acris AP17005PU-N CD332 / FGFR-2; antibody Ab
17 acris AP14341PU-N CD332 / FGFR-2; antibody Ab
18 acris AP14340PU-N CD332 / FGFR-2 (N-term); antibody Ab
19 acris AP15551PU-N CD332 / FGFR-2 (362-374); antibody Ab
20 acris AP14338PU-N CD332 / FGFR-2 (N-term); antibody Ab
21 acris AP15552PU-N CD332 / FGFR-2 (362-374); antibody Ab
22 acris AP15551PU-S CD332 / FGFR-2 (362-374); antibody Ab
23 acris AP08410PU-N CD332 / FGFR-2 (N-term); antibody Ab
24 acris AP15552PU-S CD332 / FGFR-2 (362-374); antibody Ab
25 acris AP08163PU-N CD332 / FGFR-2 (aa 362-374); antibody Ab
26 acris AP06119PU-N CD332 / FGFR-2; antibody Ab
27 scbt FGFR2 FGFR2 Antibody / FGFR2 Antibodies;
28 sigma F0300 Anti-Fibroblast Growth Factor Receptor-2, Cytoplasmic antibody produced in rabbit ;
29 sigma F6796 Anti-Fibroblast Growth Factor Receptor-2, Extracellular antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of FGFR2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FGFR2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0009986 Component cell surface
GO:0005576 Component extracellular region
GO:0016021 Component integral to membrane
GO:0005886 Component plasma membrane
GO:0005524 Function ATP binding
GO:0005007 Function fibroblast growth factor receptor activity
GO:0008201 Function heparin binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0004872 Function receptor activity
GO:0016740 Function transferase activity
GO:0016049 Process cell growth
GO:0008543 Process fibroblast growth factor receptor signaling pathway
GO:0006468 Process protein amino acid phosphorylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000141  UCSC Browser NP_000132
2 NM_001144913  UCSC Browser NP_001138385
3 NM_001144914  UCSC Browser NP_001138386
4 NM_001144915  UCSC Browser NP_001138387
5 NM_001144916  UCSC Browser NP_001138388
6 NM_001144917  UCSC Browser NP_001138389
7 NM_001144918  UCSC Browser NP_001138390
8 NM_001144919  UCSC Browser NP_001138391
9 NM_022970  UCSC Browser NP_075259

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000351936 MI0000114 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENST00000351936 MI0003130 hsa-miR-202* UUCCUAUGCAUAUACUUCUUUG
ENST00000351936 MI0005525 hsa-miR-300 UAUACAAGGGCAGACUCUCUCU
ENST00000351936 MI0000806 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC
ENST00000351936 MI0005566 hsa-miR-374b* CUUAGCAGGUUGUAUUAUCAUU
ENST00000351936 MI0000789 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
ENST00000351936 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENST00000351936 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENST00000351936 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENST00000351936 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENST00000351936 MI0003562 hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU
ENST00000351936 MI0003574 hsa-miR-568 AUGUAUAAAUGUAUACACAC
ENST00000351936 MI0003592 hsa-miR-585 UGGGCGUAUCUGUAUGCUA
ENST00000351936 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENST00000351936 MI0005118 hsa-miR-770-5p UCCAGUACCACGUGUCAGGGCCA
ENST00000351936 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENST00000351936 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENST00000351936 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENST00000357555 MI0003130 hsa-miR-202* UUCCUAUGCAUAUACUUCUUUG
ENST00000357555 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENST00000357555 MI0003574 hsa-miR-568 AUGUAUAAAUGUAUACACAC
ENST00000357555 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENST00000357555 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.815G>T1
c.799T>C1
c.607C>T1
c.847G>A1
c.1487G>C1
c.1325-2A>G1
c.870G>C1
Primary Site / Histology (Top 10)Mutations (sites * observations)
lung / carcinoma3
stomach / carcinoma2
breast / carcinoma1
ovary / carcinoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine
  • 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine inhibits the reaction [Dinoprost affects the localization of FGFR2 protein]
15654655
3-((5-(6-((3-chlorophenyl)amino)pyrazinyl)-3-pyridinyl)amino)-1-propanol
  • 3-((5-(6-((3-chlorophenyl)amino)pyrazinyl)-3-pyridinyl)amino)-1-propanol does not affect the activity of FGFR2 protein
15771433
Acetone
  • Acetone results in increased expression of FGFR2 mRNA
12720008
alpha-naphthyl thiourea
  • alpha-naphthyl thiourea results in increased expression of FGFR2 mRNA
10755703
arsenic trioxide
  • arsenic trioxide results in decreased expression of FGFR2 mRNA
15761015
Azithromycin
  • Azithromycin does not affect the expression of FGFR2 mRNA
  • Azithromycin does not affect the expression of FGFR2 protein
14687228
Benzene
  • Benzene results in increased expression of FGFR2 mRNA
15122651, 15120971
BXL628
  • BXL628 inhibits the reaction [FGF7 protein results in increased phosphorylation of FGFR2 protein]
16289173
Calcitriol
  • Calcitriol results in increased expression of FGFR2 protein
12761878
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of FGFR2 mRNA
17484886
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of FGFR2 mRNA
17692400, 16644059
Clarithromycin
  • Clarithromycin does not affect the expression of FGFR2 mRNA
14687228
Cloprostenol
  • Cloprostenol results in increased expression of FGFR2 mRNA
14991729
cumene hydroperoxide
  • cumene hydroperoxide results in increased phosphorylation of and results in increased activity of FGFR2 protein
12717419
Curcumin
  • Curcumin results in decreased expression of FGFR2 mRNA
15713895
Dinoprost
  • 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine inhibits the reaction [Dinoprost affects the localization of FGFR2 protein]
  • Dinoprost affects the localization of FGFR2 protein
  • Dinoprost results in decreased expression of FGFR2 mRNA
  • SU 5402 does not affect the reaction [Dinoprost affects the localization of FGFR2 protein]
  • Tetradecanoylphorbol Acetate inhibits the reaction [Dinoprost affects the localization of FGFR2 protein]
15654655
Dinoprost
  • Dinoprost affects the localization of [FGF2 protein binds to FGFR2 protein]
  • Dinoprost promotes the reaction [FGF2 protein binds to FGFR2 protein]
16365892
Estradiol
  • ESR2 protein affects the reaction [Estradiol results in decreased expression of FGFR2 mRNA]
  • Estradiol affects the expression of FGFR2 mRNA
14699072
Estradiol
  • Estradiol results in increased expression of FGFR2 mRNA alternative form
14602803
Estradiol
  • Estradiol results in decreased expression of FGFR2 mRNA alternative form
  • Estradiol results in decreased expression of FGFR2 protein alternative form
15680359
estradiol-17 beta-benzoate
  • estradiol-17 beta-benzoate affects the expression of FGFR2 mRNA
15059950
estradiol 3-benzoate
  • [Progesterone co-treated with estradiol 3-benzoate] results in decreased expression of FGFR2 mRNA alternative form
  • estradiol 3-benzoate results in decreased expression of FGFR2 mRNA alternative form
15976484
estrone benzoate
  • estrone benzoate results in decreased expression of FGFR2 mRNA alternative form
15120423
Ethanol
  • Ethanol results in increased expression of FGFR2 mRNA
12720008
Flavonoids
  • Flavonoids results in increased expression of FGFR2 mRNA
18035473
fluprostenol
  • fluprostenol results in decreased expression of FGFR2 mRNA
15654655
Forskolin
  • Forskolin results in increased expression of FGFR2 mRNA
10320526
Heparin
  • Heparin affects the activity of FGFR2 protein
  • Heparin promotes the reaction [FGFR2 protein binds to FGF2 protein]
1373495
Heparin
  • Heparin promotes the reaction [FGF10 protein binds to FGFR2 protein]
15632068
Heparin
  • FGF1 protein binds to FGFR2 protein binds to Heparin
16223363, 15165853
Heparin
  • [Heparin analog binds to FGFR2 protein alternative form] which binds to and results in increased activity of FGF1 protein
16219767
Heparin
  • [Heparin binds to FGFR2 protein alternative form] which binds to FGF1 protein
  • [Heparin binds to FGFR2 protein alternative form] which binds to FGF2 protein
  • [Heparin binds to FGFR2 protein alternative form] which binds to FGF7 protein
10860838
Heparitin Sulfate
  • Heparitin Sulfate analog results in decreased activity of FGFR2 protein mutant form
16373332
Heparitin Sulfate
  • FGF7 protein binds to Heparitin Sulfate binds to FGFR2 protein alternative form
16315317
Heparitin Sulfate
  • Heparitin Sulfate analog does not affect the reaction [FGF7 protein results in increased activity of FGFR2 protein alternative form]
  • Heparitin Sulfate analog promotes the reaction [FGF1 protein results in increased activity of FGFR2 protein alternative form]
11714710
Hydrochloric Acid
  • Hydrochloric Acid results in increased expression of FGFR2 mRNA
15883737
Indomethacin
  • Indomethacin does not affect the expression of FGFR2 mRNA
17440234
Methylnitrosourea
  • Methylnitrosourea results in increased expression of and affects the localization of FGFR2 protein
15581186
Nanotubes, Carbon
  • Nanotubes, Carbon results in increased expression of FGFR2 mRNA
15585362
nickel sulfate
  • nickel sulfate results in increased expression of FGFR2 protein
12930308
Nicotine
  • Nicotine does not affect the expression of FGFR2 mRNA
15465631
Nitroglycerin
  • Nitroglycerin results in increased expression of FGFR2 mRNA
12102619
norgestomet
  • norgestomet results in decreased expression of FGFR2 mRNA alternative form
10954858
octa-2,4,6-trienoic acid
  • octa-2,4,6-trienoic acid results in increased expression of FGFR2 mRNA
16951191
Ofloxacin
  • Ofloxacin does not affect the expression of FGFR2 mRNA
14687228
Oligosaccharides
  • Oligosaccharides promotes the reaction [FGF1 protein results in increased activity of FGFR2 protein alternative form]
  • Oligosaccharides promotes the reaction [FGF7 protein binds to and results in increased activity of FGFR2 protein alternative form]
11714710
Phenytoin
  • Phenytoin results in increased expression of FGFR2 mRNA
  • Phenytoin results in increased expression of FGFR2 protein
11352631
pirinixic acid
  • pirinixic acid results in increased expression of FGFR2 mRNA
18301758
Progesterone
  • [Progesterone co-treated with estradiol 3-benzoate] results in decreased expression of FGFR2 mRNA alternative form
15976484
Progesterone
  • Progesterone results in decreased expression of FGFR2 mRNA alternative form
15120423
Progesterone
  • Progesterone affects the expression of FGFR2 mRNA
17251523
Reactive Oxygen Species
  • Reactive Oxygen Species results in increased phosphorylation of and results in increased activity of FGFR2 protein
12717419
rebamipide
  • rebamipide results in increased expression of FGFR2 mRNA
  • rebamipide results in increased expression of FGFR2 mRNA alternative form
15104358
Roxithromycin
  • Roxithromycin does not affect the expression of FGFR2 mRNA
14687228
sodium chlorate
  • sodium chlorate does not affect the expression of FGFR2 mRNA alternative form
12922982
SU 5402
  • SU 5402 does not affect the reaction [Dinoprost affects the localization of FGFR2 protein]
15654655
SU 5402
  • SU 5402 does not affect the expression of FGFR2 mRNA alternative form
12421715
sucrose octasulfate
  • sucrose octasulfate binds to FGFR2 protein
15047176
Suramin
  • Suramin does not affect the expression of FGFR2 protein
  • Suramin inhibits the reaction [FGF7 protein binds to FGFR2 protein]
15733146
Testosterone
  • Testosterone results in decreased expression of FGFR2 mRNA
7536664
Tetradecanoylphorbol Acetate
  • Tetradecanoylphorbol Acetate inhibits the reaction [Dinoprost affects the localization of FGFR2 protein]
15654655
tipifarnib
  • tipifarnib results in increased expression of FGFR2 mRNA
16403772
Tocopherols
  • Tocopherols does not affect the expression of FGFR2 mRNA
15144885
Tretinoin
  • Tretinoin results in decreased expression of FGFR2 mRNA
7680553
Tretinoin
  • Tretinoin results in decreased expression of FGFR2 protein
15389522
Triiodothyronine
  • Triiodothyronine results in increased expression of FGFR2 mRNA
16150908

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Acrocephalosyndactylia marker 17694057
ANTLEY-BIXLER SYNDROME marker
Breast Neoplasms marker 17529973, 17529967, 18438407
Craniofacial Dysostosis marker
CUTIS GYRATA SYNDROME OF BEARE AND STEVENSON marker
JACKSON-WEISS SYNDROME marker
LACRIMOAURICULODENTODIGITAL SYNDROME marker
Liver Cirrhosis marker 17692400
Stomach Neoplasms marker
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16443354, 16166294
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 16823087, 15748426, 16788101, 16766008, 17506722, 16140955, 16331271, 17294898, 17361223, 17368321, 17301526, 17339181, 17217047, 17107899, 16935935, 12679006
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Mammary Neoplasms, Experimental inferred via Tocopherols 17927505
Mesothelioma inferred via Tocopherols 15878867
Lung Neoplasms inferred via tipifarnib 16885199
Mammary Neoplasms, Experimental inferred via tipifarnib 16648579
Lung Neoplasms inferred via Tetradecanoylphorbol Acetate 11807781
Mammary Neoplasms, Experimental inferred via Tetradecanoylphorbol Acetate 8985016
Pancreatic Neoplasms inferred via Tetradecanoylphorbol Acetate 15976015
Skin Neoplasms inferred via Tetradecanoylphorbol Acetate 8985016, 11807781
Antisocial Personality Disorder inferred via Testosterone 7506515
Breast Neoplasms inferred via Testosterone 17261762
Firesetting Behavior inferred via Testosterone 7506515
Glioblastoma inferred via Testosterone 17162496
Hirsutism inferred via Testosterone 17019078
Hyperandrogenism inferred via Testosterone 17019078
Hypopituitarism inferred via Testosterone 17426086
Impulse Control Disorders inferred via Testosterone 7506515
Sexual Dysfunction, Physiological inferred via Testosterone 16631401
Stomach Neoplasms inferred via rebamipide 15993841
Melanoma inferred via Reactive Oxygen Species 17992120
Pancreatic Neoplasms inferred via Reactive Oxygen Species 15580305
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15380490, 15845082
Breast Neoplasms inferred via Progesterone 17614352, 16175315, 15562024
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Abnormalities, Drug-Induced inferred via Phenytoin 3425630, 10563481
Atherosclerosis inferred via Phenytoin 15136057
Cleft Palate inferred via Phenytoin 2227380, 3877104, 10789828, 1687470, 6856622, 6862529
Congenital Abnormalities inferred via Phenytoin 10627286
Drug Eruptions inferred via Phenytoin 15024534
Epidermolysis Bullosa inferred via Phenytoin 6251365, 1399206
Epilepsies, Partial inferred via Phenytoin 17116037
Epilepsy inferred via Phenytoin 11434505
Fetal Death inferred via Phenytoin 10627286
Gingival Hyperplasia inferred via Phenytoin 9029455
Gingival Overgrowth inferred via Phenytoin 16390469, 14659971
Hyperhomocysteinemia inferred via Phenytoin 10459572
Liver Diseases inferred via Phenytoin 14986274
Myoclonic Epilepsies, Progressive inferred via Phenytoin 17484760
Myotonia Congenita inferred via Phenytoin 1896199
Osteomalacia inferred via Phenytoin 17016548
Pseudolymphoma inferred via Phenytoin 1419762, 12752131, 8603615
Mycobacterium Infections inferred via Ofloxacin 18474467
Methemoglobinemia inferred via Nitroglycerin 3537620
Myocardial Infarction inferred via Nitroglycerin 14729435
Alzheimer Disease inferred via Nicotine 16627626
Neoplasms inferred via Nicotine 16365874
Neovascularization, Pathologic inferred via Nicotine 16365874
Dermatitis, Allergic Contact inferred via nickel sulfate 16780908
Adenocarcinoma inferred via Methylnitrosourea 15688392, 15113128
Breast Neoplasms inferred via Methylnitrosourea 16253758
Cataract inferred via Methylnitrosourea 12484553
Fibrosarcoma inferred via Methylnitrosourea 11555667
Glioma inferred via Methylnitrosourea 9825942
Limb Deformities, Congenital inferred via Methylnitrosourea 15526292
Lower Extremity Deformities, Congenital inferred via Methylnitrosourea 16080182
Lung Neoplasms inferred via Methylnitrosourea 18062963
Lymphoma inferred via Methylnitrosourea 11418001, 16257854
Lymphoma, B-Cell inferred via Methylnitrosourea 14633661
Mammary Neoplasms, Experimental inferred via Methylnitrosourea 16619500, 17020996, 17131329, 11807958, 10767621, 10838139, 16944150, 16051031, 15113128, 11751437, 15688392, 16827153, 12931682, 14999141, 15313902
Neoplasms inferred via Methylnitrosourea 15533788
Neoplasms, Experimental inferred via Methylnitrosourea 12696579
Neurilemmoma inferred via Methylnitrosourea 11555667
Pancreatic Neoplasms inferred via Methylnitrosourea 16965848
Prostatic Neoplasms inferred via Methylnitrosourea 15682402, 12376480
Retinal Degeneration inferred via Methylnitrosourea 18155124, 18172121
Retinoblastoma inferred via Methylnitrosourea 11555667
Stomach Neoplasms inferred via Methylnitrosourea 18593901, 16257854, 15930296
Thymus Neoplasms inferred via Methylnitrosourea 11418001
Adenoma inferred via Indomethacin 11497255
Alzheimer Disease inferred via Indomethacin 15579461
Breast Neoplasms inferred via Indomethacin 17401462
Carcinoma, Hepatocellular inferred via Indomethacin 16391822
Colonic Neoplasms inferred via Indomethacin 11260862, 15786552, 15963497
Colorectal Neoplasms inferred via Indomethacin 18059344, 17054584, 12606626
Duodenal Ulcer inferred via Indomethacin 17045617, 16699067, 17202747
Edema inferred via Indomethacin 8985016
Enteritis inferred via Indomethacin 16328016
Esophageal Neoplasms inferred via Indomethacin 11005569
Glioblastoma inferred via Indomethacin 12870263
Hyperlipidemias inferred via Indomethacin 17546600
Ileal Diseases inferred via Indomethacin 10574470
Intestinal Diseases inferred via Indomethacin 15610444, 15831440, 10210152, 17329856
Jejunal Diseases inferred via Indomethacin 10574470
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via Indomethacin 10785260
Leukemia, Myeloid, Acute inferred via Indomethacin 18360721
Lung Neoplasms inferred via Indomethacin 11497255
Pain inferred via Indomethacin 17440234
Stomach Diseases inferred via Indomethacin 17207306
Stomach Ulcer inferred via Indomethacin 16934674, 18299717, 15104355, 12467913, 10878458, 17654042, 12077510
Ulcer inferred via Indomethacin 10574470
Liver Cirrhosis, Experimental inferred via Heparin 16904936
Inflammation inferred via Flavonoids 17296493
Burns inferred via Ethanol 16374292
Carcinoma, Hepatocellular inferred via Ethanol 15763234, 15289165
Esophageal Neoplasms inferred via Ethanol 16704527
Fatty Liver inferred via Ethanol 16409862
Fatty Liver, Alcoholic inferred via Ethanol 17920746
Fetal Alcohol Syndrome inferred via Ethanol 16946407
Hepatitis, Toxic inferred via Ethanol 11566570
Liver Cirrhosis inferred via Ethanol 15289165
Liver Cirrhosis, Alcoholic inferred via Ethanol 18295389
Liver Cirrhosis, Experimental inferred via Ethanol 18166357
Liver Diseases, Alcoholic inferred via Ethanol 17207112, 17347304
Mammary Neoplasms, Experimental inferred via estradiol 3-benzoate 15375486
Breast Neoplasms inferred via Estradiol 17289903, 12948864, 17261762, 18497071, 17018787, 14630087
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 11408345, 11807958, 16891317
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Breast Neoplasms inferred via Curcumin 16243823
Inflammation inferred via Curcumin 16956363, 17151092
Leukemia-Lymphoma, Adult T-Cell inferred via Curcumin 16106398
Leukemia, T-Cell inferred via Curcumin 16106398
Liver Cirrhosis, Experimental inferred via Curcumin 18006644
Liver Diseases inferred via Curcumin 16956363
Lung Neoplasms inferred via Curcumin 16243823
Lymphoma, T-Cell inferred via Curcumin 16173963
Memory Disorders inferred via Curcumin 17263510
Muscular Atrophy, Spinal inferred via Curcumin 17962980
Respiratory Distress Syndrome, Adult inferred via Curcumin 10666014
Mycobacterium Infections inferred via Clarithromycin 18474467
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 15673190, 16050911, 16097048, 10355542, 16227642, 16124888, 15700767, 16011737
Fatty Liver inferred via Carbon Tetrachloride 16045604, 61145, 12631006, 16239168, 17595544, 12795759, 15959796
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15027814, 15968718, 16227642, 15998439, 11566570, 16177239
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16221502, 16239168, 17334410, 16943688
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 16116963, 15925388, 17525996, 17557913, 18156304, 16638106, 18418968, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 12666154, 18395095, 17976157, 17805973, 16248980
Liver Diseases inferred via Carbon Tetrachloride 16246199, 16964402, 15720792, 17285989, 15830285
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Breast Neoplasms inferred via Calcitriol 11237771
Carcinoma, Squamous Cell inferred via Calcitriol 11237771
Encephalomyelitis, Autoimmune, Experimental inferred via Calcitriol 15138306
Prostatic Hyperplasia inferred via Calcitriol 15572423
Prostatic Neoplasms inferred via Calcitriol 12479363, 16289102, 16644109
Prostatic Hyperplasia inferred via BXL628 15572423, 16957418
Anemia, Aplastic inferred via Benzene 14761424, 11369114, 17661222
Bone Marrow Diseases inferred via Benzene 16183116
Breast Neoplasms inferred via Benzene 11921183, 17162533
Dermatitis inferred via Benzene 15902427
Hematologic Diseases inferred via Benzene 16183116
Hypertension inferred via Benzene 17940673
Leukemia inferred via Benzene 15935818, 18335105, 17119257, 14694614
Leukemia, Myeloid inferred via Benzene 17506065
Lung Diseases, Interstitial inferred via Benzene 14698565
Lymphoma inferred via Benzene 17119257, 17584886
Multiple Myeloma inferred via Benzene 17119195
Occupational Diseases inferred via Benzene 17479406, 15727169, 15935809, 15913788, 15576619, 15612468, 16737584, 17178637, 17119257
Thymus Neoplasms inferred via Benzene 10850423
Adenocarcinoma inferred via arsenic trioxide 11798837
Blood Coagulation Disorders inferred via arsenic trioxide 16206674
Burkitt Lymphoma inferred via arsenic trioxide 11589617
Carcinoma, Hepatocellular inferred via arsenic trioxide 16217749, 11135700, 15073043, 15553829, 14691202
Carcinoma, Small Cell inferred via arsenic trioxide 12490120
Coronary Restenosis inferred via arsenic trioxide 12609071
Death, Sudden, Cardiac inferred via arsenic trioxide 15213294
Esophageal Neoplasms inferred via arsenic trioxide 12903497
Fatty Liver inferred via arsenic trioxide 15073043
Gallbladder Neoplasms inferred via arsenic trioxide 16904648
Leukemia inferred via arsenic trioxide 15070760
Leukemia-Lymphoma, Adult T-Cell inferred via arsenic trioxide 12560223, 17077332
Leukemia, Monocytic, Acute inferred via arsenic trioxide 16972261
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via arsenic trioxide 14633726
Leukemia, Myeloid, Acute inferred via arsenic trioxide 16467208, 16968895, 17050201
Leukemia, Promyelocytic, Acute inferred via arsenic trioxide 16891316, 16823087, 15622746, 17107899, 15748426, 15336539, 15213294, 12679006, 11468182, 11161223, 12712474, 16966277, 16331271, 17217047, 16330433
Leukemia, T-Cell inferred via arsenic trioxide 16882451
Liver Neoplasms inferred via arsenic trioxide 14682389
Long QT Syndrome inferred via arsenic trioxide 15213294
Lung Neoplasms inferred via arsenic trioxide 11798837
Multiple Myeloma inferred via arsenic trioxide 15949261, 14977855, 11468182
Myelodysplastic Syndromes inferred via arsenic trioxide 16105982, 16882451
Neoplasm Invasiveness inferred via arsenic trioxide 16624393
Ovarian Neoplasms inferred via arsenic trioxide 16624393, 12452020
Pancreatic Neoplasms inferred via arsenic trioxide 15580305
Sarcoma, Ewing's inferred via arsenic trioxide 16646077
Stomach Neoplasms inferred via arsenic trioxide 17007042
Torsades de Pointes inferred via arsenic trioxide 15213294
Urinary Bladder Neoplasms inferred via arsenic trioxide 12973940, 11780464, 12845720

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
FGF1 FGF1 / FGFR2 Co-crystal Structure Pellegrini L (2000)
FGF1 FGF1 / FGFR2 Co-crystal Structure Stauber DJ (2000)
FGF1 FGFR2 / FGF1 Reconstituted Complex Santos-Ocampo S (1996)
FGF10 FGFR2 / FGF10 Reconstituted Complex Igarashi M (1998)
FGF7 FGFR2 / FGF7 Reconstituted Complex Igarashi M (1998)
FGFR2 FGFR2 / FGFR2 Co-crystal Structure Pellegrini L (2000)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Bochukova EG, et al. (2009) "Rare mutations of FGFR2 causing apert syndrome: identification of the first partial gene deletion, and an Alu element insertion from a new subfamily." Hum Mutat. 30(2):204-211. PMID:18726952
  2. [ + ] O'Donovan MC, et al. (2009) "Analysis of 10 independent samples provides evidence for association between schizophrenia and a SNP flanking fibroblast growth factor receptor 2." Mol Psychiatry. 14(1):30-36. PMID:18813210
  3. [ + ] Rebbeck TR, et al. (2009) "Hormone-dependent effects of FGFR2 and MAP3K1 in breast cancer susceptibility in a population-based sample of post-menopausal African-American and European-American women." Carcinogenesis. 30(2):269-274. PMID:19028704
  4. [ + ] Cottoni F, et al. (2009) "Overexpression of the fibroblast growth factor receptor 2-IIIc in Kaposi's sarcoma." J Dermatol Sci. 53(1):65-68. PMID:18804962
  5. [ + ] Katoh Y, et al. (2009) "FGFR2-related pathogenesis and FGFR2-targeted therapeutics (Review)." Int J Mol Med. 23(3):307-311. PMID:19212647
  6. [ + ] Cha JY, et al. (2009) "Aberrant receptor internalization and enhanced FRS2-dependent signaling contribute to the transforming activity of the fibroblast growth factor receptor 2 IIIb C3 isoform." J Biol Chem. 284(10):6227-6240. PMID:19103595
  7. [ + ] Gates MA, et al. (2009) "Breast cancer susceptibility alleles and ovarian cancer risk in 2 study populations." Int J Cancer. 124(3):729-733. PMID:18973230
  8. [ + ] Warzecha CC, et al. (2009) "ESRP1 and ESRP2 are epithelial cell-type-specific regulators of FGFR2 splicing." Mol Cell. 33(5):591-601. PMID:19285943
  9. [ + ] Furusho M, et al. (2009) "Disruption of fibroblast growth factor receptor signaling in nonmyelinating Schwann cells causes sensory axonal neuropathy and impairment of thermal pain sensitivity." J Neurosci. 29(6):1608-1614. PMID:19211868
  10. [ + ] Byron SA, et al. (2009) "FGFR2 as a molecular target in endometrial cancer." Future Oncol. 5(1):27-32. PMID:19243295
  11. [ + ] Udler MS, et al. (2009) "FGFR2 variants and breast cancer risk: fine-scale mapping using African American studies and analysis of chromatin conformation." Hum Mol Genet. 18(9):1692-1703. PMID:19223389
  12. [ + ] Toyokawa T, et al. (2009) "Co-expression of keratinocyte growth factor and K-sam is an independent prognostic factor in gastric carcinoma." Oncol Rep. 21(4):875-880. PMID:19287982
  13. [ + ] Blackford A, et al. (2009) "Genetic mutations associated with cigarette smoking in pancreatic cancer." Cancer Res. 69(8):3681-3688. PMID:19351817
  14. [ + ] Samson M, et al. (2009) "CYP17 (T34C), CYP19 (Trp39Arg), and FGFR2 (C906T) polymorphisms and the risk of breast cancer in south Indian women." Asian Pac J Cancer Prev. 10(1):111-114. PMID:19469636
  15. [ + ] Woolcott CG, et al. (2009) "Association between breast cancer susceptibility loci and mammographic density: the Multiethnic Cohort." Breast Cancer Res. 11(1):R10. PMID:19232126
  16. [ + ] Li M, et al. (2009) "An in vitro analysis of mechanical wounding-induced ligand-independent KGFR activation." J Dermatol Sci. 53(3):182-191. PMID:19111446
  17. [ + ] Gartside MG, et al. (2009) "Loss-of-function fibroblast growth factor receptor-2 mutations in melanoma." Mol Cancer Res. 7(1):41-54. PMID:19147536
  18. [ + ] Perlis RH, et al. (2009) "Variation in catechol-O-methyltransferase is associated with duloxetine response in a clinical trial for major depressive disorder." Biol Psychiatry. 65(9):785-791. PMID:19095219
  19. [ + ] Abir R, et al. (2009) "Keratinocyte growth factor and its receptor in human ovaries from fetuses, girls and women." Mol Hum Reprod. 15(2):69-75. PMID:19106113
  20. [ + ] Park HK, et al. (2008) "Distinct association of genetic variations of vascular endothelial growth factor, transforming growth factor-beta, and fibroblast growth factor receptors with atopy and airway hyperresponsiveness." Allergy. 63(4):447-453. PMID:18315732
  21. [ + ] Taniguchi F, et al. (2008) "Aberrant expression of keratinocyte growth factor receptor in ovarian surface epithelial cells of endometrioma." Fertil Steril. 89(2):478-480. PMID:17482184
  22. [ + ] Shanske AL, et al. (2008) "Sacral appendage in a child with an FGFR2 mutation: a report and review." Am J Med Genet A. 146A(16):2172-2175. PMID:18629881
  23. [ + ] Mauger DM, et al. (2008) "hnRNP H and hnRNP F complex with Fox2 to silence fibroblast growth factor receptor 2 exon IIIc." Mol Cell Biol. 28(17):5403-5419. PMID:18573884
  24. [ + ] Jin P, et al. (2008) "Novel splice variants derived from the receptor tyrosine kinase superfamily are potential therapeutics for rheumatoid arthritis." Arthritis Res Ther. 10(4):R73. PMID:18593464
  25. [ + ] Dhamcharee V, et al. (2008) "FGFR mutations and plagiocephaly." J Craniofac Surg. 19(1):290-291. PMID:18216705
  26. [ + ] Cha JY, et al. (2008) "Involvement of fibroblast growth factor receptor 2 isoform switching in mammary oncogenesis." Mol Cancer Res. 6(3):435-445. PMID:18337450
  27. [ + ] Fonseca R, et al. (2008) "Second case of Beare-Stevenson syndrome with an FGFR2 Ser372Cys mutation." Am J Med Genet A. 146A(5):658-660. PMID:18247426
  28. [ + ] Zhao ZZ, et al. (2008) "Common variation in the fibroblast growth factor receptor 2 gene is not associated with endometriosis risk." Hum Reprod. 23(7):1661-1668. PMID:18285324
  29. [ + ] Rouzier C, et al. (2008) "Ovarian dysgerminoma and Apert syndrome." Pediatr Blood Cancer. 50(3):696-698. PMID:17243131
  30. [ + ] Antoniou AC, et al. (2008) "Common breast cancer-predisposition alleles are associated with breast cancer risk in BRCA1 and BRCA2 mutation carriers." Am J Hum Genet. 82(4):937-948. PMID:18355772
  31. [ + ] Katoh M, et al. (2008) "Cancer genomics and genetics of FGFR2 (Review)." Int J Oncol. 33(2):233-237. PMID:18636142
  32. [ + ] Guo L, et al. (2008) "[FGFR2 gene mutation in a family with Crouzon syndrome and a sporadic Crouzon syndrome patient]" Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 25(2):218-220. PMID:18393251
  33. [ + ] Garcia-Closas M, et al. (2008) "Heterogeneity of breast cancer associations with five susceptibility loci by clinical and pathological characteristics." PLoS Genet. 4(4):e1000054. PMID:18437204
  34. [ + ] Skroza N, et al. (2008) "Modulation of the expression of the FGFR2-IIIb and FGFR2-IIIc molecules in dermatofibroma." J Dermatol Sci. 51(1):53-57. PMID:18387281
  35. [ + ] Tapper W, et al. (2008) "The influence of genetic variation in 30 selected genes on the clinical characteristics of early onset breast cancer." Breast Cancer Res. 10(6):R108. PMID:19094228
  36. [ + ] Meyer KB, et al. (2008) "Allele-specific up-regulation of FGFR2 increases susceptibility to breast cancer." PLoS Biol. 6(5):e108. PMID:18462018
  37. [ + ] Kunii K, et al. (2008) "FGFR2-amplified gastric cancer cell lines require FGFR2 and Erbb3 signaling for growth and survival." Cancer Res. 68(7):2340-2348. PMID:18381441
  38. [ + ] Behrens C, et al. (2008) "Immunohistochemical expression of basic fibroblast growth factor and fibroblast growth factor receptors 1 and 2 in the pathogenesis of lung cancer." Clin Cancer Res. 14(19):6014-6022. PMID:18829480
  39. [ + ] Liu W, et al. (2008) "The melanoma-associated antigen A3 mediates fibronectin-controlled cancer progression and metastasis." Cancer Res. 68(19):8104-8112. PMID:18829569
  40. [ + ] Chen H, et al. (2008) "A crystallographic snapshot of tyrosine trans-phosphorylation in action." Proc Natl Acad Sci U S A. 105(50):19660-19665. PMID:19060208
  41. [ + ] McGrath M, et al. (2008) "Novel breast cancer risk alleles and endometrial cancer risk." Int J Cancer. 123(12):2961-2964. PMID:18785201
  42. [ + ] Ahmed Z, et al. (2008) "Extracellular point mutations in FGFR2 elicit unexpected changes in intracellular signalling." Biochem J. 413(1):37-49. PMID:18373495
  43. [ + ] Schuller AC, et al. (2008) "Indirect recruitment of the signalling adaptor Shc to the fibroblast growth factor receptor 2 (FGFR2)." Biochem J. 416(2):189-199. PMID:18840094
  44. [ + ] Marie PJ, et al. (2008) "Roles of FGFR2 and twist in human craniosynostosis: insights from genetic mutations in cranial osteoblasts." Front Oral Biol. 12():144-159. PMID:18391499
  45. [ + ] Baynam G, et al. (2008) "A c.1019A > G mutation in FGFR2, which predicts p.Tyr340Cys, in a lethally malformed fetus with Pfeiffer syndrome and multiple pterygia." Am J Med Genet A. 146A(17):2301-2303. PMID:18671283
  46. [ + ] Byron SA, et al. (2008) "Inhibition of activated fibroblast growth factor receptor 2 in endometrial cancer cells induces cell death despite PTEN abrogation." Cancer Res. 68(17):6902-6907. PMID:18757403
  47. [ + ] Dufour C, et al. (2008) "FGFR2-Cbl interaction in lipid rafts triggers attenuation of PI3K/Akt signaling and osteoblast survival." Bone. 42(6):1032-1039. PMID:18374639
  48. [ + ] Lai AH, et al. (2008) "A mutation in FGFR2 in a child with Pfeiffer syndrome and a sacral appendage." Clin Dysmorphol. 17(1):73-74. PMID:18049087