FGFR1 | GeneID:2260 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2260 Official Symbol FGFR1
Locus N/A Gene Type protein-coding
Synonyms BFGFR; CD331; CEK; FGFBR; FLG; FLJ99988; FLT2; HBGFR; KAL2; N-SAM; OGD
Full Name fibroblast growth factor receptor 1
Description fibroblast growth factor receptor 1
Chromosome 8p11.2-p11.1
Also Known As FMS-like tyrosine kinase 2; OTTHUMP00000190874; OTTHUMP00000190878; OTTHUMP00000190879; OTTHUMP00000190881; basic fibroblast growth factor receptor 1; fms-related tyrosine kinase 2; heparin-binding growth factor receptor; hydroxyaryl-protein kinase; soluble FGFR1 variant 1; soluble FGFR1 variant 2
Summary The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. Mutations in this gene have been associated with Pfeiffer syndrome, Jackson-Weiss syndrome, Antley-Bixler syndrome, osteoglophonic dysplasia, and autosomal dominant Kallmann syndrome 2. Chromosomal aberrations involving this gene are associated with stem cell myeloproliferative disorder and stem cell leukemia lymphoma syndrome. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 69065

ID Symbol Protein Species
GeneID:2260 FGFR1 NP_056934.2 Homo sapiens
GeneID:14182 Fgfr1 NP_034336.2 Mus musculus
GeneID:30705 fgfr1 NP_694494.1 Danio rerio
GeneID:79114 Fgfr1 NP_077060.1 Rattus norvegicus
GeneID:281768 FGFR1 XP_871038.2 Bos taurus
GeneID:396516 FGFR1 NP_990841.1 Gallus gallus
GeneID:464122 FGFR1 XP_001171088.1 Pan troglodytes
GeneID:475582 FGFR1 XP_856878.1 Canis lupus familiaris

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab52163 FGFR1 antibody (ab52163); Rabbit polyclonal to FGFR1
2 abcam ab52165 FGFR1 (phospho Y154) antibody (ab52165); Rabbit polyclonal to FGFR1 (phospho Y154)
3 abcam ab31324 FGFR1 antibody (ab31324); Goat polyclonal to FGFR1
4 abcam ab18374 FGFR1 antibody (ab18374); Rabbit polyclonal to FGFR1
5 abcam ab831 FGFR1 antibody [M17A3] (ab831); Mouse monoclonal [M17A3] to FGFR1
6 abcam ab827 FGFR1 antibody [M17D10] (ab827); Mouse monoclonal [M17D10] to FGFR1
7 abcam ab823 FGFR1 antibody [M19B2] (ab823); Mouse monoclonal [M19B2] to FGFR1
8 abcam ab824 FGFR1 antibody [M5G10] (ab824); Mouse monoclonal [M5G10] to FGFR1
9 abcam ab27483 FGFR1 antibody, prediluted (ab27483); Rabbit polyclonal to FGFR1, prediluted
10 abcam ab830 FGFR1 alpha antibody [M1C4] (ab830); Mouse monoclonal [M1C4] to FGFR1 alpha
11 abcam ab829 FGFR1 alpha antibody [M2F12] (ab829); Mouse monoclonal [M2F12] to FGFR1 alpha
12 abcam ab10646 FGFR1 antibody (ab10646); Rabbit polyclonal to FGFR1
13 abcam ab70959 FGFR1 (phospho Y654) antibody (ab70959); Rabbit polyclonal to FGFR1 (phospho Y654)
14 abcam ab68419 FGFR1 antibody [5E9] (ab68419); Mouse monoclonal [5E9] to FGFR1
15 abcam ab65116 FGFR1 (phospho Y766) antibody (ab65116); Rabbit polyclonal to FGFR1 (phospho Y766)
16 abcam ab65114 FGFR1 (phospho Y463) antibody (ab65114); Rabbit polyclonal to FGFR1 (phospho Y463)
17 abcam ab65115 FGFR1 (phospho Y653) antibody (ab65115); Rabbit polyclonal to FGFR1 (phospho Y653)
18 abcam ab63601 FGFR1 antibody (ab63601); Rabbit polyclonal to FGFR1
19 abcam ab59180 FGFR1 (phospho Y766) antibody (ab59180); Rabbit polyclonal to FGFR1 (phospho Y766)
20 abcam ab59194 FGFR1 (phospho Y654) antibody (ab59194); Rabbit polyclonal to FGFR1 (phospho Y654)
21 abcam ab58516 FGFR1 antibody (ab58516); Rabbit polyclonal to FGFR1
22 abgent AP7636h FGFR1 Antibody (Y154); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
23 abgent AP7636a FGFR1 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
24 abgent AP7636b FGFR1 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
25 abgent AP3420a Phospho-FGFR1-pY154 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
26 abgent AP3311a Phospho-FGFR1-Y307 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
27 abgent AP3312a Phospho-FGFR1-Y463 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
28 abgent AP3104a Phospho-FGFR-pY653/654 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
29 abgent AP3105a Phospho-FGFR-Y766 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
30 abgent AP3105b Phospho-FGFR1-pY766 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
31 abgent AP7636d FGFR1 Antibody (Y463); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
32 abgent AP7636e FGFR1 Antibody (Y654); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
33 abgent AP3313a Phospho-FGFR1-Y654 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
34 abgent AP7636f FGFR1 Antibody (Y766); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
35 abgent AP7636g FGFR1 Antibody (Y653); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
36 abnova H00002260-M09 FGFR1 monoclonal antibody (M09), clone 1B12; Mouse monoclonal antibody raised against a full length recombinant FGFR1.
37 abnova H00002260-M06 FGFR1 monoclonal antibody (M06), clone 2F7; Mouse monoclonal antibody raised against a full length recombinant FGFR1.
38 abnova H00002260-M08 FGFR1 monoclonal antibody (M08), clone 1E4; Mouse monoclonal antibody raised against a full length recombinant FGFR1.
39 abnova H00002260-M09J FGFR1 monoclonal antibody (M09J), clone 1B12; Mouse monoclonal antibody raised against a full length recombinant FGFR1.
40 abnova H00002260-M13 FGFR1 monoclonal antibody (M13), clone 3B2; Mouse monoclonal antibody raised against a full length recombinant FGFR1.
41 abnova H00002260-M15 FGFR1 monoclonal antibody (M15), clone 3C9; Mouse monoclonal antibody raised against a full length recombinant FGFR1.
42 abnova H00002260-M16 FGFR1 monoclonal antibody (M16), clone 2E12; Mouse monoclonal antibody raised against a full length recombinant FGFR1.
43 abnova H00002260-M17 FGFR1 monoclonal antibody (M17), clone 2C1; Mouse monoclonal antibody raised against a full length recombinant FGFR1.
44 abnova H00002260-M03 FGFR1 monoclonal antibody (M03), clone 5E9; Mouse monoclonal antibody raised against a partial recombinant FGFR1.
45 abnova H00002260-M04 FGFR1 monoclonal antibody (M04), clone 3C8; Mouse monoclonal antibody raised against a partial recombinant FGFR1.
46 acris AP14331PU-N CD331 / FGFR1 (N-term); antibody Ab
47 acris AP01827PU-N CD331 / FGFR1 pTyr654; antibody Ab
48 acris AP12763PU-N CD331 / FGFR1 pTyr307; antibody Ab
49 acris AP12611PU-N CD331 / FGFR1 pTyr766; antibody Ab
50 acris AP01828PU-N CD331 / FGFR1 pTyr766; antibody Ab
51 acris AP14334PU-N CD331 / FGFR1 Y654; antibody Ab
52 acris BM2636 CD331 / FGFR1; antibody Ab
53 acris AP08061PU-N CD331 / FGFR1; antibody Ab
54 acris AP12612PU-N CD331 / FGFR1 pTyr766; antibody Ab
55 acris BM2640 CD331 / FGFR1 (beta isoform); antibody Ab
56 acris AP14335PU-N CD331 / FGFR1 Y766; antibody Ab
57 acris BM2637 CD331 / FGFR1; antibody Ab
58 acris BM2638 CD331 / FGFR1 (alpha isoform); antibody Ab
59 acris AP15550PU-N CD331 / FGFR1 (360-373); antibody Ab
60 acris AP16326PU-N CD331 / FGFR1 (C-term); antibody Ab
61 acris BM2639 CD331 / FGFR1 (alpha isoform); antibody Ab
62 acris AP14336PU-N CD331 / FGFR1 Y653; antibody Ab
63 acris BM2635 CD331 / FGFR1; antibody Ab
64 acris AP15550PU-S CD331 / FGFR1 (360-373); antibody Ab
65 acris AP08061PU-S CD331 / FGFR1; antibody Ab
66 acris AP14333PU-N CD331 / FGFR1 Y463; antibody Ab
67 acris AP08409PU-N CD331 / FGFR1 (N-term); antibody Ab
68 acris AP12610PU-N CD331 / FGFR1 pTyr653/654; antibody Ab
69 acris AP12842PU-N CD331 / FGFR1 pTyr154; antibody Ab
70 acris AP14337PU-N CD331 / FGFR1 Y154; antibody Ab
71 acris AP12764PU-N CD331 / FGFR1 pTyr463; antibody Ab
72 acris AP15549PU-S CD331 / FGFR1 (360-373); antibody Ab
73 acris AP12765PU-N CD331 / FGFR1 pTyr654; antibody Ab
74 acris AP14332PU-N CD331 / FGFR1 (C-term); antibody Ab
75 acris AP15549PU-N CD331 / FGFR1 (360-373); antibody Ab
76 scbt FGFR1 FGFR1 Antibody / FGFR1 Antibodies;
77 sigma F5421 Anti-Fibroblast Growth Factor Receptor-1 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of FGFR1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FGFR1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005887 Component integral to plasma membrane
GO:0005624 Component membrane fraction
GO:0005886 Component plasma membrane
GO:0005524 Function ATP binding
GO:0005007 Function fibroblast growth factor receptor activity
GO:0008201 Function heparin binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0004872 Function receptor activity
GO:0016740 Function transferase activity
GO:0016049 Process cell growth
GO:0008543 Process fibroblast growth factor receptor signaling pathway
GO:0000165 Process MAPKKK cascade
GO:0006468 Process protein amino acid phosphorylation
GO:0001501 Process skeletal system development

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_015850  UCSC Browser NP_056934
2 NM_023105  UCSC Browser NP_075593
3 NM_023106  UCSC Browser NP_075594
4 NM_023107  UCSC Browser NP_075595
5 NM_023108  UCSC Browser NP_075596
6 NM_023110  UCSC Browser NP_075598
7 NM_023111  UCSC Browser NP_075599

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000310729 MI0000066 hsa-let-7e* CUAUACGGCCUCCUAGCUUUCC
ENST00000310729 MI0000070 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000310729 MI0000115 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000310729 MI0000481 hsa-miR-184 UGGACGGAGAACUGAUAAGGGU
ENST00000310729 MI0000274 hsa-miR-187* GGCUACAACACAGGACCCGGGC
ENST00000310729 MI0000238 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENST00000310729 MI0000279 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENST00000310729 MI0001150 hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENST00000310729 MI0000737 hsa-miR-200a* CAUCUUACCGGACAGUGCUGGA
ENST00000310729 MI0005569 hsa-miR-216b AAAUCUCUGCAGGCAAAUGUGA
ENST00000310729 MI0000747 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENST00000310729 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENST00000310729 MI0000815 hsa-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG
ENST00000310729 MI0000268 hsa-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENST00000310729 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENST00000310729 MI0001648 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENST00000310729 MI0003673 hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
ENST00000310729 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENST00000310729 MI0003186 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA
ENST00000310729 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENST00000310729 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENST00000310729 MI0003169 hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG
ENST00000310729 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENST00000310729 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENST00000310729 MI0003205 hsa-miR-532-3p CCUCCCACACCCAAGGCUUGCA
ENST00000310729 MI0005539 hsa-miR-541 UGGUGGGCACAGAAUCUGGACU
ENST00000310729 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000310729 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000310729 MI0003622 hsa-miR-609 AGGGUGUUUCUCUCAUCUCU
ENST00000310729 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENST00000310729 MI0003658 hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG
ENST00000310729 MI0003676 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC
ENST00000310729 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENST00000310729 MI0003560 hsa-miR-92b* AGGGACGGGACGCGGUGCAGUG
ENST00000310729 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENST00000310729 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENST00000310729 MI0004640 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENST00000310729 MI0004641 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENST00000310729 MI0004642 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENST00000310729 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENST00000310729 MI0004688 mmu-miR-704 AGACAUGUGCUCUGCUCCUAG
ENST00000310729 MI0005470 mmu-miR-743b-3p GAAAGACAUCAUGCUGAAUAGA
ENST00000310729 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENST00000341462 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENST00000341462 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENST00000341462 MI0000488 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENST00000341462 MI0000732 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENST00000341462 MI0000735 hsa-miR-29c* UGACCGAUUUCUCCUGGUGUUC
ENST00000341462 MI0003646 hsa-miR-33b* CAGUGCCUCGGCAGUGCAGCCC
ENST00000341462 MI0005566 hsa-miR-374b* CUUAGCAGGUUGUAUUAUCAUU
ENST00000341462 MI0000784 hsa-miR-376a* GUAGAUUCUCCUUCUAUGAGUA
ENST00000341462 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENST00000341462 MI0001733 hsa-miR-452 AACUGUUUGCAGAGGAAACUGA
ENST00000341462 MI0003183 hsa-miR-499-3p AACAUCACAGCAAGUCUGUGCU
ENST00000341462 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000341462 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000341462 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENST00000341462 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENST00000341462 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AB208919   AF173898   AK001052   AK024388   AK094303   AK130555   AK222718   AK223126   AK291754   AK292470   AK309947   AW206093   BC015035   BC018128   BC091494   BQ774633   BX649167   CX756209   CX757985   DB300904   DQ894999   EU826596   EU826597   FJ809916   FJ809917   M34185   M34186   M34187   M34188   M34641   M37722   M60485   M63887   M63888   M63889   NM_015850   NM_023105   NM_023106   NM_023107   NM_023108   NM_023110   NM_023111   X51803   X52833   X57118   X57119   X57120   X57121   X57122   X66945   Y00665  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.1638C>A1
c.1726C>T1
c.1990G>T1
c.374C>T1
c.754C>A1
Primary Site / Histology (Top 10)Mutations (sites * observations)
lung / carcinoma2
central nervous system / glioma2
breast / carcinoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
3-(4-dimethylamino-benzylidenyl)-2-indolinone
  • 3-(4-dimethylamino-benzylidenyl)-2-indolinone results in decreased activity of FGFR1 protein
15728459
4-hydroxy-2-nonenal
  • 4-hydroxy-2-nonenal results in decreased expression of FGFR1 mRNA
12419474
Acetylglucosamine
  • Acetylglucosamine analog promotes the reaction [FGF2 protein binds to FGFR1 protein]
12440867
Acrylamide
  • Acrylamide analog promotes the reaction [FGFR1 protein binds to FGFR1 protein]
14733594
Acrylamide
  • Acrylamide analog promotes the reaction [FGF2 protein binds to FGFR1 protein]
12440867
AP20187
  • AP20187 results in increased activity of FGFR1 protein mutant form
12654294
arsenic trioxide
  • arsenic trioxide results in decreased expression of FGFR1 mRNA
15761015
arsenic trioxide
  • arsenic trioxide results in decreased phosphorylation of FGFR1 protein mutant form
17027752
Blood Glucose
  • FGFR1 protein affects the abundance of Blood Glucose
11130726
Cadmium Chloride
  • Cadmium Chloride results in decreased expression of FGFR1 mRNA
12760830
Calcitriol
  • [Calcium co-treated with Calcitriol] affects the expression of FGFR1 mRNA
15913539
Calcium
  • [Calcium co-treated with Calcitriol] affects the expression of FGFR1 mRNA
15913539
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of FGFR1 mRNA
17484886
Cycloheximide
  • Cycloheximide inhibits the reaction [Triiodothyronine results in increased expression of FGFR1 mRNA]
12805413
Dactinomycin
  • Dactinomycin inhibits the reaction [Triiodothyronine results in increased expression of FGFR1 mRNA]
12805413
Dietary Fats
  • Dietary Fats results in decreased expression of FGFR1 mRNA
18042831
Dihydrotestosterone
  • Dihydrotestosterone results in decreased expression of FGFR1 mRNA
17023530
dimethylarsinous acid
  • dimethylarsinous acid results in decreased expression of FGFR1 mRNA
16507463
Ellagic Acid
  • Ellagic Acid results in decreased expression of FGFR1 mRNA
12002526
estrone benzoate
  • estrone benzoate inhibits the reaction [Progesterone results in decreased expression of FGFR1 mRNA alternative form]
15120423
Forskolin
  • Forskolin results in increased expression of FGFR1 mRNA
10320526
Heparan Sulfate Proteoglycans
  • Heparan Sulfate Proteoglycans promotes the reaction [FGF1 protein binds to and results in increased activity of FGFR1 protein]
15767480
Heparan Sulfate Proteoglycans
  • Heparan Sulfate Proteoglycans affects the reaction [FGF1 protein binds to FGFR1 protein]
  • Heparan Sulfate Proteoglycans affects the reaction [FGF2 protein binds to FGFR1 protein]
10336501
Heparan Sulfate Proteoglycans
  • Heparan Sulfate Proteoglycans affects the activity of FGFR1 protein
15923150
Heparan Sulfate Proteoglycans
  • [Heparan Sulfate Proteoglycans binds to FGF2 protein binds to FGFR1 protein] which binds to KAL1 protein
15548653
Heparin
  • Heparin promotes the reaction [FGF2 protein results in increased activity of FGFR1 protein]
12799194
Heparin
  • Heparin binds to FGFR1 protein binds to FGF2 protein
15096041
Heparin
  • Heparin promotes the reaction [FGFR1 protein binds to FGF1 protein]
  • Heparin promotes the reaction [FGFR1 protein binds to FGF2 protein]
1379594
Heparin
  • Heparin promotes the reaction [FGF2 protein binds to FGFR1 protein]
12440867
Heparitin Sulfate
  • Heparitin Sulfate analog results in increased activity of FGFR1 protein alternative form
12460940
Heparitin Sulfate
  • SULF1 protein inhibits the reaction [Heparitin Sulfate results in increased activity of FGFR1 protein]
15051888
Heparitin Sulfate
  • FGF1 protein binds to Heparitin Sulfate binds to FGFR1 protein
12604602
Heparitin Sulfate
  • Heparitin Sulfate analog does not affect the reaction [FGF1 protein results in increased activity of FGFR1 protein]
11714710
Hydrogen Peroxide
  • Hydrogen Peroxide results in decreased expression of FGFR1 mRNA
12419474
Indomethacin
  • Indomethacin does not affect the expression of FGFR1 mRNA
17440234
Kainic Acid
  • Kainic Acid results in increased expression of FGFR1 mRNA
7649223
Methylnitrosourea
  • Methylnitrosourea results in increased expression of and affects the localization of FGFR1 protein
15581186
Morphine
  • Morphine results in increased expression of FGFR1 mRNA
15183518
Naphthyridines
  • Naphthyridines analog results in decreased activity of FGFR1 protein
16000000
Nicotine
  • Nicotine does not affect the expression of FGFR1 mRNA
15465631
Oligosaccharides
  • Oligosaccharides promotes the reaction [FGF1 protein binds to FGFR1 protein alternative form]
9174673
Oligosaccharides
  • Oligosaccharides promotes the reaction [FGF1 protein binds to and results in increased activity of FGFR1 protein]
11714710
palm oil
  • palm oil results in decreased expression of FGFR1 mRNA
18042831
PD 161570
  • PD 161570 inhibits the reaction [FGFR1 protein results in increased phosphorylation of FGFR1 protein]
12805413
PD 166866
  • PD 166866 inhibits the reaction [FGFR1 protein results in increased phosphorylation of FGFR1 protein]
12805413
PD 166866
  • PD 166866 results in decreased activity of FGFR1 protein
15773903, 15121739
PD 166866
  • PD 166866 inhibits the reaction [FGF1 protein results in increased expression of FGFR1 protein]
15773903
PD 166866
  • PD 166866 results in decreased activity of FGFR1 protein
15522930
Peroxynitrous Acid
  • FGFR1 protein alternative form affects the chemical susceptibility to Peroxynitrous Acid
12573278
pirinixic acid
  • pirinixic acid results in increased expression of FGFR1 mRNA
12832660
Progesterone
  • Progesterone results in decreased expression of FGFR1 mRNA alternative form
  • estrone benzoate inhibits the reaction [Progesterone results in decreased expression of FGFR1 mRNA alternative form]
15120423
resveratrol
  • resveratrol results in increased expression of FGFR1 mRNA
12002526
sodium arsenite
  • sodium arsenite results in decreased expression of FGFR1 mRNA
16876216
sodium bichromate
  • sodium bichromate results in decreased expression of FGFR1 mRNA
12760830
SU 5402
  • SU 5402 results in decreased activity of FGFR1 protein
16326079, 16103074, 15936332, 15298682, 12704805, 15255957, 15631803
SU 5402
  • SU 5402 results in decreased activity of FGFR1 protein
  • SU 5402 results in increased expression of FGFR1 mRNA alternative form
12421715
SU 5402
  • SU 5402 results in decreased activity of FGFR1 protein
16188231, 16091734, 16154193
SU 5402
  • SU 5402 results in decreased activity of FGFR1 protein mutant form
16103074
SU 6668
  • SU 6668 results in decreased activity of FGFR1 protein
16132614, 14760097, 15788688, 15551349
SU 6668
  • SU 6668 results in decreased phosphorylation of and results in decreased activity of FGFR1 protein
16144927
Taurine
  • Taurine results in decreased expression of FGFR1 mRNA
16579726
Testosterone
  • Testosterone results in increased expression of FGFR1 mRNA
7536664
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin inhibits the reaction [EGF protein results in increased expression of FGFR1 mRNA]
15667827
Tocopherols
  • Tocopherols results in decreased expression of FGFR1 mRNA
15144885
Tretinoin
  • Tretinoin does not affect the expression of FGFR1 mRNA
7680553
Tretinoin
  • Tretinoin results in increased expression of FGFR1 protein
15389522
Tretinoin
  • Tretinoin results in increased expression of FGFR1 mRNA
16604517
Triiodothyronine
  • Triiodothyronine results in increased expression of FGFR1 mRNA
16150908
Triiodothyronine
  • Cycloheximide inhibits the reaction [Triiodothyronine results in increased expression of FGFR1 mRNA]
  • Dactinomycin inhibits the reaction [Triiodothyronine results in increased expression of FGFR1 mRNA]
  • Triiodothyronine promotes the reaction [FGF2 protein promotes the reaction [FGFR1 protein results in increased phosphorylation of FGFR1 protein]]
  • Triiodothyronine results in increased expression of FGFR1 mRNA
  • Triiodothyronine results in increased expression of FGFR1 protein
12805413
Urea
  • Urea analog results in decreased activity of FGFR1 protein
16000000

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Acrocephalosyndactylia marker
JACKSON-WEISS SYNDROME marker
Kallmann Syndrome marker
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16166294, 16443354
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 12679006, 16823087, 15748426, 16788101, 16766008, 17506722, 16140955, 16331271, 17294898, 17361223, 17368321, 17301526, 17339181, 17217047, 17107899, 16935935
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Mammary Neoplasms, Experimental inferred via Tocopherols 17927505
Mesothelioma inferred via Tocopherols 15878867
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Antisocial Personality Disorder inferred via Testosterone 7506515
Breast Neoplasms inferred via Testosterone 17261762
Firesetting Behavior inferred via Testosterone 7506515
Glioblastoma inferred via Testosterone 17162496
Hirsutism inferred via Testosterone 17019078
Hyperandrogenism inferred via Testosterone 17019078
Hypopituitarism inferred via Testosterone 17426086
Impulse Control Disorders inferred via Testosterone 7506515
Sexual Dysfunction, Physiological inferred via Testosterone 16631401
Liver Cirrhosis, Experimental inferred via Taurine 15893842, 15931870
Brain Neoplasms inferred via SU 6668 15739567
Glioma inferred via SU 6668 15739567
Adrenal Gland Neoplasms inferred via sodium arsenite 15276417
Adrenocortical Adenoma inferred via sodium arsenite 16712894
Carcinoma, Hepatocellular inferred via sodium arsenite 15276417, 16507464
Carcinoma, Squamous Cell inferred via sodium arsenite 18572023
Genital Neoplasms, Female inferred via sodium arsenite 16452187
Hodgkin Disease inferred via sodium arsenite 12676792
Liver Neoplasms inferred via sodium arsenite 15276417, 16712894
Lung Neoplasms inferred via sodium arsenite 15276417, 16712894, 17077188
Melanoma inferred via sodium arsenite 16487513
Neoplasms inferred via sodium arsenite 11559025
Neural Tube Defects inferred via sodium arsenite 12854658
Ovarian Neoplasms inferred via sodium arsenite 15276417
Prostatic Neoplasms inferred via sodium arsenite 16039940
Skin Neoplasms inferred via sodium arsenite 18572023
Spinal Dysraphism inferred via sodium arsenite 12854658
Urinary Bladder Neoplasms inferred via sodium arsenite 11723127, 16452187, 16712894
Uterine Cervical Neoplasms inferred via sodium arsenite 11813266
Vascular Diseases inferred via sodium arsenite 17056641
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 17534123, 16393696
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 17164350, 16490592, 16267019, 17049120, 17935668
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 17015251, 17125593, 16525036, 16456233, 16317513
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 17636462, 17718901, 17804756, 15767336, 16731767
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 16314181, 15827377, 16317513, 17520802
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15380490, 15845082
Breast Neoplasms inferred via Progesterone 17614352, 15562024, 16175315
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Alzheimer Disease inferred via Nicotine 16627626
Neoplasms inferred via Nicotine 16365874
Neovascularization, Pathologic inferred via Nicotine 16365874
Adenocarcinoma inferred via Methylnitrosourea 15688392, 15113128
Breast Neoplasms inferred via Methylnitrosourea 16253758
Cataract inferred via Methylnitrosourea 12484553
Fibrosarcoma inferred via Methylnitrosourea 11555667
Glioma inferred via Methylnitrosourea 9825942
Limb Deformities, Congenital inferred via Methylnitrosourea 15526292
Lower Extremity Deformities, Congenital inferred via Methylnitrosourea 16080182
Lung Neoplasms inferred via Methylnitrosourea 18062963
Lymphoma inferred via Methylnitrosourea 11418001, 16257854
Lymphoma, B-Cell inferred via Methylnitrosourea 14633661
Mammary Neoplasms, Experimental inferred via Methylnitrosourea 16619500, 17020996, 15313902, 12931682, 15688392, 15113128, 16944150, 10767621, 10838139, 16051031, 11751437, 16827153, 14999141, 11807958, 17131329
Neoplasms inferred via Methylnitrosourea 15533788
Neoplasms, Experimental inferred via Methylnitrosourea 12696579
Neurilemmoma inferred via Methylnitrosourea 11555667
Pancreatic Neoplasms inferred via Methylnitrosourea 16965848
Prostatic Neoplasms inferred via Methylnitrosourea 15682402, 12376480
Retinal Degeneration inferred via Methylnitrosourea 18155124, 18172121
Retinoblastoma inferred via Methylnitrosourea 11555667
Stomach Neoplasms inferred via Methylnitrosourea 18593901, 15930296, 16257854
Thymus Neoplasms inferred via Methylnitrosourea 11418001
Seizures inferred via Kainic Acid 16336964, 10686065
Adenoma inferred via Indomethacin 11497255
Alzheimer Disease inferred via Indomethacin 15579461
Breast Neoplasms inferred via Indomethacin 17401462
Carcinoma, Hepatocellular inferred via Indomethacin 16391822
Colonic Neoplasms inferred via Indomethacin 11260862, 15963497, 15786552
Colorectal Neoplasms inferred via Indomethacin 18059344, 12606626, 17054584
Duodenal Ulcer inferred via Indomethacin 17045617, 17202747, 16699067
Edema inferred via Indomethacin 8985016
Enteritis inferred via Indomethacin 16328016
Esophageal Neoplasms inferred via Indomethacin 11005569
Glioblastoma inferred via Indomethacin 12870263
Hyperlipidemias inferred via Indomethacin 17546600
Ileal Diseases inferred via Indomethacin 10574470
Intestinal Diseases inferred via Indomethacin 15610444, 17329856, 15831440, 10210152
Jejunal Diseases inferred via Indomethacin 10574470
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via Indomethacin 10785260
Leukemia, Myeloid, Acute inferred via Indomethacin 18360721
Lung Neoplasms inferred via Indomethacin 11497255
Pain inferred via Indomethacin 17440234
Stomach Diseases inferred via Indomethacin 17207306
Stomach Ulcer inferred via Indomethacin 16934674, 10878458, 17654042, 15104355, 12467913, 18299717, 12077510
Ulcer inferred via Indomethacin 10574470
Cardiovascular Diseases inferred via Hydrogen Peroxide 16936243
Kidney Failure, Chronic inferred via Hydrogen Peroxide 16518626
Liver Cirrhosis, Experimental inferred via Heparin 16904936
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Bone Marrow Neoplasms inferred via Dactinomycin 14601052
Sarcoma, Ewing's inferred via Dactinomycin 14601052
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16050911, 16097048, 15700767, 10355542, 16011737, 15673190, 16227642, 16124888
Fatty Liver inferred via Carbon Tetrachloride 16045604, 15959796, 17595544, 61145, 12631006, 12795759, 16239168
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15968718, 15027814, 16227642, 11566570, 15998439, 16177239
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 17334410, 16239168
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 18156304, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 16638106, 18395095, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 17976157, 15925388, 17525996, 17805973, 17557913, 16248980, 16116963
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15720792, 16964402, 15830285, 17285989
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Osteoporosis inferred via Calcium 17882678
Breast Neoplasms inferred via Calcitriol 11237771
Carcinoma, Squamous Cell inferred via Calcitriol 11237771
Encephalomyelitis, Autoimmune, Experimental inferred via Calcitriol 15138306
Prostatic Hyperplasia inferred via Calcitriol 15572423
Prostatic Neoplasms inferred via Calcitriol 12479363, 16644109, 16289102
Kidney Diseases inferred via Cadmium Chloride 16962696
Adenocarcinoma inferred via arsenic trioxide 11798837
Blood Coagulation Disorders inferred via arsenic trioxide 16206674
Burkitt Lymphoma inferred via arsenic trioxide 11589617
Carcinoma, Hepatocellular inferred via arsenic trioxide 16217749, 11135700, 14691202, 15553829, 15073043
Carcinoma, Small Cell inferred via arsenic trioxide 12490120
Coronary Restenosis inferred via arsenic trioxide 12609071
Death, Sudden, Cardiac inferred via arsenic trioxide 15213294
Esophageal Neoplasms inferred via arsenic trioxide 12903497
Fatty Liver inferred via arsenic trioxide 15073043
Gallbladder Neoplasms inferred via arsenic trioxide 16904648
Leukemia inferred via arsenic trioxide 15070760
Leukemia-Lymphoma, Adult T-Cell inferred via arsenic trioxide 12560223, 17077332
Leukemia, Monocytic, Acute inferred via arsenic trioxide 16972261
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via arsenic trioxide 14633726
Leukemia, Myeloid, Acute inferred via arsenic trioxide 16467208, 17050201, 16968895
Leukemia, Promyelocytic, Acute inferred via arsenic trioxide 16891316, 16966277, 11161223, 12679006, 16331271, 17217047, 17107899, 15748426, 15336539, 15213294, 11468182, 12712474, 15622746, 16823087, 16330433
Leukemia, T-Cell inferred via arsenic trioxide 16882451
Liver Neoplasms inferred via arsenic trioxide 14682389
Long QT Syndrome inferred via arsenic trioxide 15213294
Lung Neoplasms inferred via arsenic trioxide 11798837
Multiple Myeloma inferred via arsenic trioxide 15949261, 14977855, 11468182
Myelodysplastic Syndromes inferred via arsenic trioxide 16105982, 16882451
Neoplasm Invasiveness inferred via arsenic trioxide 16624393
Ovarian Neoplasms inferred via arsenic trioxide 16624393, 12452020
Pancreatic Neoplasms inferred via arsenic trioxide 15580305
Sarcoma, Ewing's inferred via arsenic trioxide 16646077
Stomach Neoplasms inferred via arsenic trioxide 17007042
Torsades de Pointes inferred via arsenic trioxide 15213294
Urinary Bladder Neoplasms inferred via arsenic trioxide 12973940, 11780464, 12845720
Breast Neoplasms inferred via Acrylamide 16253758, 18183576
Cattle Diseases inferred via Acrylamide 12510666
Infertility, Female inferred via Acrylamide 11020651
Infertility, Male inferred via Acrylamide 15749267, 15355880, 12507653, 11020651
Nerve Degeneration inferred via Acrylamide 11264303, 12387367, 12387366
Nervous System Diseases inferred via Acrylamide 12164553, 12507653
Peripheral Nervous System Diseases inferred via Acrylamide 11510240
Testicular Diseases inferred via Acrylamide 15864552
Amyotrophic Lateral Sclerosis inferred via 4-hydroxy-2-nonenal 10965797
Photosensitivity Disorders inferred via 4-hydroxy-2-nonenal 11550810

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
BNIP2 BNIP2 / FGFR1 Invitro Low BC (1999)
BNIP2 BNIP2 / FGFR1 Invivo Low BC (1999)
FDPS FGFR1 / FDPS Reconstituted Complex Reilly JF (2002)
FDPS FGFR1 / FDPS Two-hybrid Reilly JF (2002)
FGF1 FGF1 / FGFR1 Co-crystal Structure Schlessinger J (2000)
FGF1 FGFR1 / FGF1 Reconstituted Complex Santos-Ocampo S (1996)
FGF2 FGFR1 / FGF2 Reconstituted Complex Sher I (2000)
FGF5 FGFR1 / FGF5 Invivo Clements DA (1993)
FGFR1 FGFR1 / FGFR1 Reconstituted Complex Schlessinger J (2000)
FRS2 FGFR1 / FRS2 Affinity Capture-Western Ong SH (2000)
FRS2 FGFR1 / FRS2 Co-crystal Structure Dhalluin C (2000)
FRS2 FGFR1 / FRS2 Reconstituted Complex Xu H (1998)
FRS2 FGFR1 / FRS2 Reconstituted Complex Yan KS (2002)
FRS2 FGFR1 / FRS2 Two-hybrid Dhalluin C (2000)
FRS2 FGFR1 / FRS2 Two-hybrid Xu H (1998)
FRS3 FGFR1 / FRS3 Two-hybrid Xu H (1998)
GRB14 GRB14 / FGFR1 Affinity Capture-Western Reilly JF (2000)
GRB14 GRB14 / FGFR1 Reconstituted Complex Reilly JF (2000)
GRB14 GRB14 / FGFR1 Two-hybrid Reilly JF (2000)
KPNB1 KPNB1 / FGFR1 Invivo Reilly JF (2001)
NCAM1 NCAM1 / FGFR1 Affinity Capture-Western Kos FJ (2002)
PLCG1 FGFR1 / PLCG1 Two-hybrid Xu H (1998)
SHB SHB / FGFR1 Affinity Capture-Western Karlsson T (1995)
SHB SHB / FGFR1 Reconstituted Complex Karlsson T (1995)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Xian W, et al. (2009) "Fibroblast growth factor receptor 1-transformed mammary epithelial cells are dependent on RSK activity for growth and survival." Cancer Res. 69(6):2244-2251. PMID:19258500
  2. [ + ] Kwek SS, et al. (2009) "Co-amplified genes at 8p12 and 11q13 in breast tumors cooperate with two major pathways in oncogenesis." Oncogene. 28(17):1892-1903. PMID:19330026
  3. [ + ] Sato T, et al. (2009) "Overexpression of the fibroblast growth factor receptor-1 gene correlates with liver metastasis in colorectal cancer." Oncol Rep. 21(1):211-216. PMID:19082464
  4. [ + ] Canto P, et al. (2009) "Genetic analysis in patients with Kallmann syndrome: coexistence of mutations in prokineticin receptor 2 and KAL1." J Androl. 30(1):41-45. PMID:18723471
  5. [ + ] Lew ED, et al. (2009) "The precise sequence of FGF receptor autophosphorylation is kinetically driven and is disrupted by oncogenic mutations." Sci Signal. 2(58):ra6. PMID:19224897
  6. [ + ] Zhang C, et al. (2009) "Related transcriptional enhancer factor-1 induces fibroblast growth factor receptor-1 expression in endothelial cells." Biochem Biophys Res Commun. 380(3):689-694. PMID:19285023
  7. [ + ] Widberg CH, et al. (2009) "Fibroblast growth factor receptor 1 is a key regulator of early adipogenic events in human preadipocytes." Am J Physiol Endocrinol Metab. 296(1):E121-E131. PMID:18940940
  8. [ + ] Furusho M, et al. (2009) "Disruption of fibroblast growth factor receptor signaling in nonmyelinating Schwann cells causes sensory axonal neuropathy and impairment of thermal pain sensitivity." J Neurosci. 29(6):1608-1614. PMID:19211868
  9. [ + ] Chen G, et al. (2008) "Exon III splicing of fibroblast growth factor receptor 1 is modulated by growth factors and cyclin D1." Pancreas. 37(2):159-164. PMID:18665077
  10. [ + ] Haugsten EM, et al. (2008) "Ubiquitination of fibroblast growth factor receptor 1 is required for its intracellular sorting but not for its endocytosis." Mol Biol Cell. 19(8):3390-3403. PMID:18480409
  11. [ + ] Abreu AP, et al. (2008) "Loss-of-function mutations in the genes encoding prokineticin-2 or prokineticin receptor-2 cause autosomal recessive Kallmann syndrome." J Clin Endocrinol Metab. 93(10):4113-4118. PMID:18682503
  12. [ + ] Zhang W, et al. (2008) "Effect of FGF-binding protein 3 on vascular permeability." J Biol Chem. 283(42):28329-28337. PMID:18669637
  13. [ + ] Miles RJ, et al. (2008) "Temporal-mediated FGFR1 independence: implications for targeting candidate molecules in prostate cancer." Cancer Biol Ther. 7(8):1180-1181. PMID:18719360
  14. [ + ] Pedersen-White JR, et al. (2008) "The prevalence of intragenic deletions in patients with idiopathic hypogonadotropic hypogonadism and Kallmann syndrome." Mol Hum Reprod. 14(6):367-370. PMID:18463157
  15. [ + ] Behrens C, et al. (2008) "Immunohistochemical expression of basic fibroblast growth factor and fibroblast growth factor receptors 1 and 2 in the pathogenesis of lung cancer." Clin Cancer Res. 14(19):6014-6022. PMID:18829480
  16. [ + ] Persson F, et al. (2008) "High-resolution array CGH analysis of salivary gland tumors reveals fusion and amplification of the FGFR1 and PLAG1 genes in ring chromosomes." Oncogene. 27(21):3072-3080. PMID:18059337
  17. [ + ] Yang H, et al. (2008) "Basic fibroblast growth factor-induced neuronal differentiation of mouse bone marrow stromal cells requires FGFR-1, MAPK/ERK, and transcription factor AP-1." J Biol Chem. 283(9):5287-5295. PMID:18171671
  18. [ + ] Vieira AR, et al. (2008) "Candidate gene/loci studies in cleft lip/palate and dental anomalies finds novel susceptibility genes for clefts." Genet Med. 10(9):668-674. PMID:18978678
  19. [ + ] Dhamcharee V, et al. (2008) "FGFR mutations and plagiocephaly." J Craniofac Surg. 19(1):290-291. PMID:18216705
  20. [ + ] Finetti F, et al. (2008) "Prostaglandin E2 regulates angiogenesis via activation of fibroblast growth factor receptor-1." J Biol Chem. 283(4):2139-2146. PMID:18042549
  21. [ + ] Kim SH, et al. (2008) "Diversity in fibroblast growth factor receptor 1 regulation: learning from the investigation of Kallmann syndrome." J Neuroendocrinol. 20(2):141-163. PMID:18034870
  22. [ + ] Yu L, et al. (2008) "Differential expression of receptor tyrosine kinases (RTKs) and IGF-I pathway activation in human uterine leiomyomas." Mol Med. 14(5-6):264-275. PMID:18231572
  23. [ + ] Jin P, et al. (2008) "Novel splice variants derived from the receptor tyrosine kinase superfamily are potential therapeutics for rheumatoid arthritis." Arthritis Res Ther. 10(4):R73. PMID:18593464
  24. [ + ] Lazary A, et al. (2008) "Single nucleotide polymorphisms in new candidate genes are associated with bone mineral density and fracture risk." Eur J Endocrinol. 159(2):187-196. PMID:18469019
  25. [ + ] Lubinski J, et al. (2008) "Genetic contribution to all cancers: the first demonstration using the model of breast cancers from Poland stratified by age at diagnosis and tumour pathology." Breast Cancer Res Treat. ():. PMID:18415014
  26. [ + ] Park HK, et al. (2008) "Distinct association of genetic variations of vascular endothelial growth factor, transforming growth factor-beta, and fibroblast growth factor receptors with atopy and airway hyperresponsiveness." Allergy. 63(4):447-453. PMID:18315732
  27. [ + ] Sorensen V, et al. (2008) "Phosphorylation of fibroblast growth factor (FGF) receptor 1 at Ser777 by p38 mitogen-activated protein kinase regulates translocation of exogenous FGF1 to the cytosol and nucleus." Mol Cell Biol. 28(12):4129-4141. PMID:18411303
  28. [ + ] Fukai J, et al. (2008) "EphA4 promotes cell proliferation and migration through a novel EphA4-FGFR1 signaling pathway in the human glioma U251 cell line." Mol Cancer Ther. 7(9):2768-2778. PMID:18790757
  29. [ + ] Salenave S, et al. (2008) "Kallmann's syndrome: a comparison of the reproductive phenotypes in men carrying KAL1 and FGFR1/KAL2 mutations." J Clin Endocrinol Metab. 93(3):758-763. PMID:18160472
  30. [ + ] Jungerius BJ, et al. (2008) "An association screen of myelin-related genes implicates the chromosome 22q11 PIK4CA gene in schizophrenia." Mol Psychiatry. 13(11):1060-1068. PMID:17893707
  31. [ + ] Douwes Dekker PB, et al. (2007) "Basic fibroblast growth factor and fibroblastic growth factor receptor-1 may contribute to head and neck paraganglioma development by an autocrine or paracrine mechanism." Hum Pathol. 38(1):79-85. PMID:16949906
  32. [ + ] Kondo T, et al. (2007) "Epigenetically controlled fibroblast growth factor receptor 2 signaling imposes on the RAS/BRAF/mitogen-activated protein kinase pathway to modulate thyroid cancer progression." Cancer Res. 67(11):5461-5470. PMID:17545628
  33. [ + ] Anderson PJ, et al. (2007) "Somatic FGFR and TWIST mutations are not a common cause of isolated nonsyndromic single suture craniosynostosis." J Craniofac Surg. 18(2):312-314. PMID:17414280
  34. [ + ] Riley BM, et al. (2007) "Impaired FGF signaling contributes to cleft lip and palate." Proc Natl Acad Sci U S A. 104(11):4512-4517. PMID:17360555
  35. [ + ] Seto ML, et al. (2007) "Isolated sagittal and coronal craniosynostosis associated with TWIST box mutations." Am J Med Genet A. 143(7):678-686. PMID:17343269
  36. [ + ] Riley BM, et al. (2007) "A genome-wide linkage scan for cleft lip and cleft palate identifies a novel locus on 8p11-23." Am J Med Genet A. 143A(8):846-852. PMID:17366557
  37. [ + ] Vieira AR, et al. (2007) "Interferon regulatory factor 6 (IRF6) and fibroblast growth factor receptor 1 (FGFR1) contribute to human tooth agenesis." Am J Med Genet A. 143(6):538-545. PMID:17318851
  38. [ + ] Dong S, et al. (2007) "14-3-3 Integrates prosurvival signals mediated by the AKT and MAPK pathways in ZNF198-FGFR1-transformed hematopoietic cells." Blood. 110(1):360-369. PMID:17389761
  39. [ + ] Riley BM, et al. (2007) "Sequence evaluation of FGF and FGFR gene conserved non-coding elements in non-syndromic cleft lip and palate cases." Am J Med Genet A. 143A(24):3228-3234. PMID:17963255
  40. [ + ] Dode C, et al. (2007) "Novel FGFR1 sequence variants in Kallmann syndrome, and genetic evidence that the FGFR1c isoform is required in olfactory bulb and palate morphogenesis." Hum Mutat. 28(1):97-98. PMID:17154279
  41. [ + ] Wei Q, et al. (2007) "EGFR, HER2 and HER3 expression in esophageal primary tumours and corresponding metastases." Int J Oncol. 31(3):493-499. PMID:17671674
  42. [ + ] Freier K, et al. (2007) "Recurrent FGFR1 amplification and high FGFR1 protein expression in oral squamous cell carcinoma (OSCC)." Oral Oncol. 43(1):60-66. PMID:16807070
  43. [ + ] Elbauomy Elsheikh S, et al. (2007) "FGFR1 amplification in breast carcinomas: a chromogenic in situ hybridisation analysis." Breast Cancer Res. 9(2):R23. PMID:17397528
  44. [ + ] Goldstein M, et al. (2007) "FGFR1 over-expression in primary rhabdomyosarcoma tumors is associated with hypomethylation of a 5' CpG island and abnormal expression of the AKT1, NOG, and BMP4 genes." Genes Chromosomes Cancer. 46(11):1028-1038. PMID:17696196
  45. [ + ] Lao DH, et al. (2007) "Direct binding of PP2A to Sprouty2 and phosphorylation changes are a prerequisite for ERK inhibition downstream of fibroblast growth factor receptor stimulation." J Biol Chem. 282(12):9117-9126. PMID:17255109
  46. [ + ] Trarbach EB, et al. (2006) "Novel fibroblast growth factor receptor 1 mutations in patients with congenital hypogonadotropic hypogonadism with and without anosmia." J Clin Endocrinol Metab. 91(10):4006-4012. PMID:16882753
  47. [ + ] Urakawa I, et al. (2006) "Klotho converts canonical FGF receptor into a specific receptor for FGF23." Nature. 444(7120):770-774. PMID:17086194
  48. [ + ] Tassi E, et al. (2006) "Expression of a fibroblast growth factor-binding protein during the development of adenocarcinoma of the pancreas and colon." Cancer Res. 66(2):1191-1198. PMID:16424058