ABCD2 | GeneID:225 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 225 Official Symbol ABCD2
Locus N/A Gene Type protein-coding
Synonyms ABC39; ALDL1; ALDR; ALDRP; hALDR
Full Name ATP-binding cassette, sub-family D (ALD), member 2
Description ATP-binding cassette, sub-family D (ALD), member 2
Chromosome 12q11-q12
Also Known As ATP-binding cassette, sub-family D, member 2; adrenoleukodystrophy-like 1
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. The function of this peroxisomal membrane protein is unknown; however this protein is speculated to function as a dimerization partner of ABCD1 and/or other peroxisomal ABC transporters. Mutations in this gene have been observed in patients with adrenoleukodystrophy, a severe demyelinating disease. This gene has been identified as a candidate for a modifier gene, accounting for the extreme variation among adrenoleukodystrophy phenotypes. This gene is also a candidate for a complement group of Zellweger syndrome, a genetically heterogeneous disorder of peroxisomal biogenesis. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55873

ID Symbol Protein Species
GeneID:225 ABCD2 NP_005155.1 Homo sapiens
GeneID:26874 Abcd2 NP_036124.2 Mus musculus
GeneID:43772 CG2316 NP_726543.1 Drosophila melanogaster
GeneID:84356 Abcd2 NP_203503.1 Rattus norvegicus
GeneID:178527 pmp-4 NP_503105.1 Caenorhabditis elegans
GeneID:417694 ABCD2 XP_415938.2 Gallus gallus
GeneID:466952 ABCD2 XP_522352.2 Pan troglodytes
GeneID:477643 ABCD2 XP_534838.1 Canis lupus familiaris
GeneID:1281041 AgaP_AGAP002071 XP_320975.2 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 scbt ABCD2 ABCD2 Antibody / ABCD2 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCD2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCD2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0043190 Component ATP-binding cassette (ABC) transporter complex
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0005778 Component peroxisomal membrane
GO:0005777 Component peroxisome
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0006631 Process fatty acid metabolic process
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_005164  UCSC Browser NP_005155 Q9UBJ2   B2RAM3  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000308666 MI0000681 hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGGU
ENST00000308666 MI0000072 hsa-miR-18a UAAGGUGCAUCUAGUGCAGAUAG
ENST00000308666 MI0000294 hsa-miR-218 UUGUGCUUGAUCUAACCAUGU
ENST00000308666 MI0000295 hsa-miR-218 UUGUGCUUGAUCUAACCAUGU
ENST00000308666 MI0000816 hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU
ENST00000308666 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENST00000308666 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENST00000308666 MI0003593 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENST00000308666 MI0003598 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENST00000308666 MI0003612 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENST00000308666 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENST00000308666 MI0005474 mmu-miR-881 AACUGUGUCUUUUCUGAAUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
pirinixic acid
  • pirinixic acid results in increased expression of ABCD2 mRNA
18301758, 15375163

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ABCD1 ABCD1 / ABCD2 Two-hybrid Liu LX (1999)
PEX19 PEX19 / ABCD2 Reconstituted Complex Gloeckner CJ (2000)
PEX19 PEX19 / ABCD2 Reconstituted Complex Mayerhofer PU (2002)
PEX19 PEX19 / ABCD2 Two-hybrid Gloeckner CJ (2000)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Maier EM, et al. (2008) "X-linked adrenoleukodystrophy phenotype is independent of ABCD2 genotype." Biochem Biophys Res Commun. 377(1):176-180. PMID:18834860
  3. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  4. [ + ] Petroni A, et al. (2007) "Effect of testosterone metabolites on ABC half-transporter relative gene expression in X-linked adrenoleukodystrophy." J Inherit Metab Dis. 30(5):828. PMID:17602313
  5. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  6. [ + ] Weinhofer I, et al. (2005) "Liver X receptor alpha interferes with SREBP1c-mediated Abcd2 expression. Novel cross-talk in gene regulation." J Biol Chem. 280(50):41243-41251. PMID:16249184
  7. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  8. [ + ] Mayerhofer PU, et al. (2002) "Two splice variants of human PEX19 exhibit distinct functions in peroxisomal assembly." Biochem Biophys Res Commun. 291(5):1180-1186. PMID:11883941
  9. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  10. [ + ] Gloeckner CJ, et al. (2000) "Human adrenoleukodystrophy protein and related peroxisomal ABC transporters interact with the peroxisomal assembly protein PEX19p." Biochem Biophys Res Commun. 271(1):144-150. PMID:10777694
  11. [ + ] Sacksteder KA, et al. (2000) "PEX19 binds multiple peroxisomal membrane proteins, is predominantly cytoplasmic, and is required for peroxisome membrane synthesis." J Cell Biol. 148(5):931-944. PMID:10704444
  12. [ + ] Netik A, et al. (1999) "Adrenoleukodystrophy-related protein can compensate functionally for adrenoleukodystrophy protein deficiency (X-ALD): implications for therapy." Hum Mol Genet. 8(5):907-913. PMID:10196381
  13. [ + ] Liu LX, et al. (1999) "Homo- and heterodimerization of peroxisomal ATP-binding cassette half-transporters." J Biol Chem. 274(46):32738-32743. PMID:10551832
  14. [ + ] Holzinger A, et al. (1999) "Full length cDNA cloning, promoter sequence, and genomic organization of the human adrenoleukodystrophy related (ALDR) gene functionally redundant to the gene responsible for X-linked adrenoleukodystrophy." Biochem Biophys Res Commun. 258(2):436-442. PMID:10329405
  15. [ + ] Savary S, et al. (1997) "Chromosomal localization of the adrenoleukodystrophy-related gene in man and mice." Eur J Hum Genet. 5(2):99-101. PMID:9195160
  16. [ + ] Holzinger A, et al. (1997) "cDNA cloning and mRNA expression of the human adrenoleukodystrophy related protein (ALDRP), a peroxisomal ABC transporter." Biochem Biophys Res Commun. 239(1):261-264. PMID:9345306
  17. [ + ] Lombard-Platet G, et al. (1996) "A close relative of the adrenoleukodystrophy (ALD) gene codes for a peroxisomal protein with a specific expression pattern." Proc Natl Acad Sci U S A. 93(3):1265-1269. PMID:8577752