ABCB7 | GeneID:22 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 22 Official Symbol ABCB7
Locus N/A Gene Type protein-coding
Synonyms ABC7; ASAT; Atm1p; EST140535
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 7
Description ATP-binding cassette, sub-family B (MDR/TAP), member 7
Chromosome Xq12-q13
Also Known As ATP-binding cassette 7; ATP-binding cassette, sub-family B, member 7; OTTHUMP00000023578
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a half-transporter involved in the transport of heme from the mitochondria to the cytosol. With iron/sulfur cluster precursors as its substrates, this protein may play a role in metal homeostasis. Mutations in this gene have been implicated in X-linked sideroblastic anemia with ataxia. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3175

ID Symbol Protein Species
GeneID:22 ABCB7 NP_004290.2 Homo sapiens
GeneID:38193 CG7955 NP_728642.2 Drosophila melanogaster
GeneID:171807 abtm-1 NP_001021830.1 Caenorhabditis elegans
GeneID:302395 Abcb7 NP_997683.1 Rattus norvegicus
GeneID:422326 ABCB7 XP_420301.1 Gallus gallus
GeneID:491967 ABCB7 XP_549087.1 Canis lupus familiaris
GeneID:533669 ABCB7 XP_613148.2 Bos taurus
GeneID:566515 wu:fc20c02 XP_694879.2 Danio rerio
GeneID:828980 ATM2 NP_194591.1 Arabidopsis thaliana
GeneID:828981 ATM1 NP_567813.1 Arabidopsis thaliana
GeneID:835939 STA1 NP_200635.1 Arabidopsis thaliana
GeneID:855347 ATM1 NP_014030.1 Saccharomyces cerevisiae
GeneID:1276974 AgaP_AGAP006364 XP_316391.2 Anopheles gambiae
GeneID:2542779 atm1 NP_594288.2 Schizosaccharomyces pombe
GeneID:2676565 MGG_03406 XP_360863.1 Magnaporthe grisea
GeneID:2706358 NCU05029.1 XP_324386.1 Neurospora crassa
GeneID:2896392 KLLA0A10131g XP_451443.1 Kluyveromyces lactis
GeneID:4622625 AGOS_AGL335W NP_986332.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab65149 ABCB7 antibody (ab65149); Rabbit polyclonal to ABCB7
2 abgent AP6114a ABCB7 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
3 acris AP13077PU-N ABCB7 (C-term); antibody Ab
4 acris AP07896PU-N ABCB7; antibody Ab
5 scbt ABCB7 ABCB7 Antibody / ABCB7 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCB7 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCB7 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005743 Component mitochondrial inner membrane
GO:0005739 Component mitochondrion
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0015232 Function heme transporter activity
GO:0000166 Function nucleotide binding
GO:0006879 Process cellular iron ion homeostasis
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_004299  UCSC Browser NP_004290

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000253577 MI0000437 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000253577 MI0000651 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000253577 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENST00000253577 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENST00000253577 MI0000261 hsa-miR-139-5p UCUACAGUGCACGUGUCUCCAG
ENST00000253577 MI0000253 hsa-miR-148a UCAGUGCACUACAGAACUUUGU
ENST00000253577 MI0000811 hsa-miR-148b UCAGUGCAUCACAGAACUUUGU
ENST00000253577 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENST00000253577 MI0000483 hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCU
ENST00000253577 MI0000465 hsa-miR-191 CAACGGAAUCCCAAAAGCAGCUG
ENST00000253577 MI0000279 hsa-miR-196a* CGGCAACAAGAAACUGCCUGAG
ENST00000253577 MI0000073 hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENST00000253577 MI0000074 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000253577 MI0000075 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000253577 MI0000490 hsa-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENST00000253577 MI0000745 hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENST00000253577 MI0005568 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC
ENST00000253577 MI0000088 hsa-miR-30a* CUUUCAGUCGGAUGUUUGCAGC
ENST00000253577 MI0000255 hsa-miR-30d* CUUUCAGUCAGAUGUUUGCUGC
ENST00000253577 MI0000749 hsa-miR-30e* CUUUCAGUCGGAUGUUUACAGC
ENST00000253577 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENST00000253577 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENST00000253577 MI0003591 hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG
ENST00000253577 MI0003626 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
ENST00000253577 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENST00000253577 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
FECH ABCB7 / FECH Affinity Capture-Western Taketani S (2003)
FECH ABCB7 / FECH Reconstituted Complex Taketani S (2003)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Boultwood J, et al. (2008) "The role of the iron transporter ABCB7 in refractory anemia with ring sideroblasts." PLoS ONE. 3(4):e1970. PMID:18398482
  3. [ + ] Miao LY, et al. (2008) "Association study of ABCB1 and CYP3A5 gene polymorphisms with sirolimus trough concentration and dose requirements in Chinese renal transplant recipients." Biopharm Drug Dispos. 29(1):1-5. PMID:17941052
  4. [ + ] Ross MT, et al. (2005) "The DNA sequence of the human X chromosome." Nature. 434(7031):325-337. PMID:15772651
  5. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  6. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  7. [ + ] Taketani S, et al. (2003) "Involvement of ABC7 in the biosynthesis of heme in erythroid cells: interaction of ABC7 with ferrochelatase." Blood. 101(8):3274-3280. PMID:12480705
  8. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  9. [ + ] Maguire A, et al. (2001) "X-linked cerebellar ataxia and sideroblastic anaemia associated with a missense mutation in the ABC7 gene predicting V411L." Br J Haematol. 115(4):910-917. PMID:11843825
  10. [ + ] Bekri S, et al. (2000) "Human ABC7 transporter: gene structure and mutation causing X-linked sideroblastic anemia with ataxia with disruption of cytosolic iron-sulfur protein maturation." Blood. 96(9):3256-3264. PMID:11050011
  11. [ + ] Zhang QH, et al. (2000) "Cloning and functional analysis of cDNAs with open reading frames for 300 previously undefined genes expressed in CD34+ hematopoietic stem/progenitor cells." Genome Res. 10(10):1546-1560. PMID:11042152
  12. [ + ] Allikmets R, et al. (1999) "Mutation of a putative mitochondrial iron transporter gene (ABC7) in X-linked sideroblastic anemia and ataxia (XLSA/A)." Hum Mol Genet. 8(5):743-749. PMID:10196363
  13. [ + ] Shimada Y, et al. (1998) "Cloning and chromosomal mapping of a novel ABC transporter gene (hABC7), a candidate for X-linked sideroblastic anemia with spinocerebellar ataxia." J Hum Genet. 43(2):115-122. PMID:9621516
  14. [ + ] Csere P, et al. (1998) "Identification of a human mitochondrial ABC transporter, the functional orthologue of yeast Atm1p." FEBS Lett. 441(2):266-270. PMID:9883897
  15. [ + ] Mao M, et al. (1998) "Identification of genes expressed in human CD34(+) hematopoietic stem/progenitor cells by expressed sequence tags and efficient full-length cDNA cloning." Proc Natl Acad Sci U S A. 95(14):8175-8180. PMID:9653160
  16. [ + ] Savary S, et al. (1997) "Isolation and chromosomal mapping of a novel ATP-binding cassette transporter conserved in mouse and human." Genomics. 41(2):275-278. PMID:9143506
  17. [ + ] Allikmets R, et al. (1996) "Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database." Hum Mol Genet. 5(10):1649-1655. PMID:8894702