ACSL4 | GeneID:2182 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2182 Official Symbol ACSL4
Locus N/A Gene Type protein-coding
Synonyms ACS4; FACL4; LACS4; MRX63; MRX68
Full Name acyl-CoA synthetase long-chain family member 4
Description acyl-CoA synthetase long-chain family member 4
Chromosome Xq22.3-q23
Also Known As OTTHUMP00000023846; acyl-CoA synthetase 4; fatty-acid-Coenzyme A ligase, long-chain 4; lignoceroyl-CoA synthase; long-chain fatty-acid-Coenzyme A ligase 4
Summary The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme preferentially utilizes arachidonate as substrate. The absence of this enzyme may contribute to the mental retardation or Alport syndrome. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56282

ID Symbol Protein Species
GeneID:2182 ACSL4 NP_075266.1 Homo sapiens
GeneID:50790 Acsl4 NP_997508.1 Mus musculus
GeneID:113976 Acsl4 NP_446075.1 Rattus norvegicus
GeneID:176005 F37C12.7 NP_498568.1 Caenorhabditis elegans
GeneID:180859 acs-17 NP_508993.2 Caenorhabditis elegans
GeneID:393622 acsl4 NP_956943.1 Danio rerio
GeneID:422345 ACSL4 XP_420317.2 Gallus gallus
GeneID:481018 ACSL4 XP_538140.2 Canis lupus familiaris
GeneID:536628 ACSL4 XP_871017.2 Bos taurus
GeneID:844094 LACS9 NP_177882.1 Arabidopsis thaliana
GeneID:4351610 Os12g0168700 NP_001066256.1 Oryza sativa
GeneID:100150268 LOC100150268 XP_001919128.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab70937 FACL4 antibody - Aminoterminal end (ab70937); Rabbit polyclonal to FACL4 - Aminoterminal end
2 abcam ab38420 FACL4 antibody (ab38420); Rabbit polyclonal to FACL4
3 abgent AP2536b FACL4 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
4 acris AP12263PU-N ACSL4 (Center); antibody Ab
5 scbt ACSL4 ACSL4 Antibody / ACSL4 Antibodies;
6 sigma HPA005552 Anti-ACSL4 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACSL4 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACSL4 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005783 Component endoplasmic reticulum
GO:0005789 Component endoplasmic reticulum membrane
GO:0016021 Component integral to membrane
GO:0005792 Component microsome
GO:0005741 Component mitochondrial outer membrane
GO:0005739 Component mitochondrion
GO:0005778 Component peroxisomal membrane
GO:0005777 Component peroxisome
GO:0005886 Component plasma membrane
GO:0005524 Function ATP binding
GO:0016874 Function ligase activity
GO:0004467 Function long-chain-fatty-acid-CoA ligase activity
GO:0000287 Function magnesium ion binding
GO:0000166 Function nucleotide binding
GO:0006631 Process fatty acid metabolic process
GO:0007611 Process learning or memory
GO:0006629 Process lipid metabolic process
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_004458  UCSC Browser NP_004449 Q5JWV8   O60488  
2 NM_022977  UCSC Browser NP_075266

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000340800 MI0000268 hsa-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENST00000340800 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ACSL4 mRNA
17562736
Carbon Tetrachloride
  • Carbon Tetrachloride affects the expression of ACSL4 mRNA
16239168
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ACSL4 mRNA
17484886
Cholecalciferol
  • Cholecalciferol results in increased expression of ACSL4 mRNA
16508948
Ethinyl Estradiol
  • Ethinyl Estradiol results in increased expression of ACSL4 mRNA
17108234
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased expression of ACSL4 mRNA
17681415
Phthalic Acids
  • Phthalic Acids results in decreased expression of ACSL4 mRNA
15728792
pirinixic acid
  • pirinixic acid results in increased expression of ACSL4 mRNA
18301758
topiramate
  • topiramate results in decreased expression of ACSL4 mRNA
16979414

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Mental Retardation, X-Linked marker
Prostatic Neoplasms marker 17013881
Diabetes Mellitus, Type 2 inferred via topiramate 16979414
Migraine Disorders inferred via topiramate 18765137, 18803445, 18759728
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Edema inferred via perfluorooctanoic acid 17259670, 12083418
Hepatomegaly inferred via perfluorooctanoic acid 3609246
Hyperalgesia inferred via perfluorooctanoic acid 12083418
Inflammation inferred via perfluorooctanoic acid 12083418
Leydig Cell Tumor inferred via perfluorooctanoic acid 8812269
Liver Neoplasms inferred via perfluorooctanoic acid 14757943
Niemann-Pick Disease, Type C inferred via perfluorooctanoic acid 9802331
Prenatal Exposure Delayed Effects inferred via perfluorooctanoic acid 17132714
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 11677210, 15861022, 16919318, 17681005, 16105132, 17333356
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Autoimmune Diseases inferred via Cholecalciferol 16142846
Prostatic Neoplasms inferred via Cholecalciferol 17024972
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16050911, 15673190, 16011737, 15700767, 16124888, 16227642, 10355542, 16097048
Fatty Liver inferred via Carbon Tetrachloride 16045604, 12795759, 61145, 12631006, 17595544, 15959796, 16239168
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15027814, 15968718, 16227642, 11566570, 15998439, 16177239
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16239168, 17334410, 16943688, 16221502
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 16116963, 16248980, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 18418968, 12666154, 16638106, 18395095, 18156304, 17976157, 17557913, 17805973, 17525996, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 15925388
Liver Diseases inferred via Carbon Tetrachloride 16246199, 16964402, 15830285, 17285989, 15720792
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Hepatitis, Toxic inferred via Acetaminophen 2444490, 15968718, 16227642, 16177239, 14986274, 17562736, 16081117, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Zeman M, et al. (2009) "Fatty acid CoA ligase-4 gene polymorphism influences fatty acid metabolism in metabolic syndrome, but not in depression." Tohoku J Exp Med. 217(4):287-293. PMID:19346733
  2. [ + ] An C, et al. (2008) "No association between polymorphisms in the FACL4 (fatty acid-CoA ligase 4) gene and nonspecific mental retardation in Qin-Ba mountain region of China." Neurosci Lett. 441(2):197-200. PMID:18614287
  3. [ + ] Hu C, et al. (2008) "The effect of fatty acid-CoA ligase 4 on the growth of hepatic cancer cells." Cancer Biol Ther. 7(1):131-134. PMID:18059177
  4. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  5. [ + ] Sung YK, et al. (2007) "Regulation of cell growth by fatty acid-CoA ligase 4 in human hepatocellular carcinoma cells." Exp Mol Med. 39(4):477-482. PMID:17934335
  6. [ + ] Bhat SS, et al. (2006) "Disruption of DMD and deletion of ACSL4 causing developmental delay, hypotonia, and multiple congenital anomalies." Cytogenet Genome Res. 112(1-2):170-175. PMID:16276108
  7. [ + ] Liang YC, et al. (2005) "Involvement of fatty acid-CoA ligase 4 in hepatocellular carcinoma growth: roles of cyclic AMP and p38 mitogen-activated protein kinase." World J Gastroenterol. 11(17):2557-2563. PMID:15849811
  8. [ + ] Covault J, et al. (2004) "Association of a long-chain fatty acid-CoA ligase 4 gene polymorphism with depression and with enhanced niacin-induced dermal erythema." Am J Med Genet B Neuropsychiatr Genet. 127B(1):42-47. PMID:15108178
  9. [ + ] Brandenberger R, et al. (2004) "Transcriptome characterization elucidates signaling networks that control human ES cell growth and differentiation." Nat Biotechnol. 22(6):707-716. PMID:15146197
  10. [ + ] Mashek DG, et al. (2004) "Revised nomenclature for the mammalian long-chain acyl-CoA synthetase gene family." J Lipid Res. 45(10):1958-1961. PMID:15292367
  11. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  12. [ + ] Longo I, et al. (2003) "A third MRX family (MRX68) is the result of mutation in the long chain fatty acid-CoA ligase 4 (FACL4) gene: proposal of a rapid enzymatic assay for screening mentally retarded patients." J Med Genet. 40(1):11-17. PMID:12525535
  13. [ + ] Verot L, et al. (2003) "Localization of a non-syndromic X-linked mental retardation gene (MRX80) to Xq22-q24." Am J Med Genet A. 122A(1):37-41. PMID:12949969
  14. [ + ] Sung YK, et al. (2003) "Fatty acid-CoA ligase 4 is overexpressed in human hepatocellular carcinoma." Cancer Sci. 94(5):421-424. PMID:12824887
  15. [ + ] Meloni I, et al. (2002) "FACL4, encoding fatty acid-CoA ligase 4, is mutated in nonspecific X-linked mental retardation." Nat Genet. 30(4):436-440. PMID:11889465
  16. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  17. [ + ] Cao Y, et al. (2001) "Fatty acid CoA ligase 4 is up-regulated in colon adenocarcinoma." Cancer Res. 61(23):8429-8434. PMID:11731423
  18. [ + ] Knights KM, et al. (2000) "In vitro metabolism of acitretin by human liver microsomes: evidence of an acitretinoyl-coenzyme A thioester conjugate in the transesterification to etretinate." Biochem Pharmacol. 60(4):507-516. PMID:10874125
  19. [ + ] Piccini M, et al. (1998) "FACL4, a new gene encoding long-chain acyl-CoA synthetase 4, is deleted in a family with Alport syndrome, elliptocytosis, and mental retardation." Genomics. 47(3):350-358. PMID:9480748
  20. [ + ] Cao Y, et al. (1998) "Cloning, expression, and chromosomal localization of human long-chain fatty acid-CoA ligase 4 (FACL4)." Genomics. 49(2):327-330. PMID:9598324
  21. [ + ] Jonsson JJ, et al. (1998) "Alport syndrome, mental retardation, midface hypoplasia, and elliptocytosis: a new X linked contiguous gene deletion syndrome?" J Med Genet. 35(4):273-278. PMID:9598718
  22. [ + ] Knights KM, et al. (1992) "Inhibition kinetics of hepatic microsomal long chain fatty acid-CoA ligase by 2-arylpropionic acid non-steroidal anti-inflammatory drugs." Biochem Pharmacol. 43(7):1465-1471. PMID:1567471