ACSL3 | GeneID:2181 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2181 Official Symbol ACSL3
Locus N/A Gene Type protein-coding
Synonyms ACS3; FACL3; PRO2194
Full Name acyl-CoA synthetase long-chain family member 3
Description acyl-CoA synthetase long-chain family member 3
Chromosome 2q34-q35
Also Known As OTTHUMP00000164212; fatty-acid-Coenzyme A ligase, long-chain 3; lignoceroyl-CoA synthase
Summary The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in brain, and preferentially utilizes myristate, arachidonate, and eicosapentaenoate as substrates. The amino acid sequence of this isozyme is 92% identical to that of rat homolog. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3278

ID Symbol Protein Species
GeneID:2181 ACSL3 NP_004448.2 Homo sapiens
GeneID:46068 l(2)44DEa NP_001014508.1 Drosophila melanogaster
GeneID:74205 Acsl3 NP_001028778.1 Mus musculus
GeneID:114024 Acsl3 NP_476448.1 Rattus norvegicus
GeneID:424810 ACSL3 XP_422625.2 Gallus gallus
GeneID:459974 ACSL3 XP_001166350.1 Pan troglodytes
GeneID:478927 ACSL3 XP_851617.1 Canis lupus familiaris
GeneID:559656 LOC559656 XP_688110.2 Danio rerio
GeneID:567157 si:dkeyp-109h9.2 NP_001038593.1 Danio rerio
GeneID:814974 AT2G04350 NP_178516.1 Arabidopsis thaliana
GeneID:1274286 AgaP_AGAP003623 XP_313383.2 Anopheles gambiae
GeneID:4338395 Os05g0317200 NP_001055177.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab55940 ACSL3 antibody - Aminoterminal end (ab55940); Rabbit polyclonal to ACSL3 - Aminoterminal end
2 abgent AP2535b FACL3 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
3 abgent AP2535a FACL3 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
4 acris AP08302PU-N ACSL3 (N-term); antibody Ab
5 acris AP12261PU-N ACSL3 (Center); antibody Ab
6 acris AP12260PU-N ACSL3 (N-term); antibody Ab
7 scbt ACSL3 ACSL3 Antibody / ACSL3 Antibodies;
8 sigma HPA011315 Anti-ACSL3 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACSL3 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACSL3 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005783 Component endoplasmic reticulum
GO:0005789 Component endoplasmic reticulum membrane
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005792 Component microsome
GO:0005741 Component mitochondrial outer membrane
GO:0005739 Component mitochondrion
GO:0005778 Component peroxisomal membrane
GO:0005777 Component peroxisome
GO:0005524 Function ATP binding
GO:0004321 Function fatty-acyl-CoA synthase activity
GO:0016874 Function ligase activity
GO:0004467 Function long-chain-fatty-acid-CoA ligase activity
GO:0000287 Function magnesium ion binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0006631 Process fatty acid metabolic process
GO:0006629 Process lipid metabolic process
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_004457  UCSC Browser NP_004448
2 NM_203372  UCSC Browser NP_976251

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000357430 MI0000064 hsa-let-7c* UAGAGUUACACCCUGGGAGUUA
ENST00000357430 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENST00000357430 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENST00000357430 MI0000073 hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENST00000357430 MI0000735 hsa-miR-29c* UGACCGAUUUCUCCUGGUGUUC
ENST00000357430 MI0000807 hsa-miR-323-3p CACAUUACACGGUCGACCUCU
ENST00000357430 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENST00000357430 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU
ENST00000357430 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENST00000357430 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
1,2-diamino-4-nitrobenzene
  • 1,2-diamino-4-nitrobenzene results in decreased expression of ACSL3 mRNA
17070881
1-nitropropane
  • 1-nitropropane results in decreased expression of ACSL3 mRNA
17070881
2,4-diaminotoluene
  • 2,4-diaminotoluene results in increased expression of ACSL3 mRNA
17070881
2,6-diaminotoluene
  • 2,6-diaminotoluene results in decreased expression of ACSL3 mRNA
17070881
2-Acetylaminofluorene
  • 2-Acetylaminofluorene results in increased expression of ACSL3 mRNA
17070881
2-nitro-4-phenylenediamine
  • 2-nitro-4-phenylenediamine results in decreased expression of ACSL3 mRNA
17070881
2-nitropropane
  • 2-nitropropane results in increased expression of ACSL3 mRNA
17070881
4-acetylaminofluorene
  • 4-acetylaminofluorene results in increased expression of ACSL3 mRNA
17070881
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ACSL3 mRNA
17484886
Dietary Fats
  • Dietary Fats results in decreased expression of ACSL3 mRNA
18042831
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of ACSL3 mRNA
17555576
Flavonoids
  • Flavonoids results in decreased expression of ACSL3 mRNA
18035473
Forskolin
  • Forskolin results in increased expression of ACSL3 mRNA
16751804
Genistein
  • Genistein results in increased expression of ACSL3 mRNA
18847459
Isoflavones
  • Isoflavones results in increased expression of ACSL3 mRNA
16365062
Ketone Bodies
  • Ketone Bodies results in increased expression of ACSL3 mRNA
16807920
Metribolone
  • Metribolone promotes the reaction [NDRG1 protein binds to ACSL3 protein]
17220478
Metribolone
  • Metribolone results in increased expression of ACSL3 mRNA
17010675, 16751804
palm oil
  • palm oil results in decreased expression of ACSL3 mRNA
18042831
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased expression of ACSL3 mRNA
17681415
pirinixic acid
  • pirinixic acid results in increased expression of ACSL3 mRNA
18301758
rapeseed oil
  • rapeseed oil affects the expression of ACSL3 mRNA
16177195
tert-Butylhydroperoxide
  • tert-Butylhydroperoxide results in decreased expression of ACSL3 mRNA
15336504
Trapidil
  • Trapidil affects the reaction [PTH protein affects the expression of ACSL3 mRNA]
18635661

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Edema inferred via perfluorooctanoic acid 17259670, 12083418
Hepatomegaly inferred via perfluorooctanoic acid 3609246
Hyperalgesia inferred via perfluorooctanoic acid 12083418
Inflammation inferred via perfluorooctanoic acid 12083418
Leydig Cell Tumor inferred via perfluorooctanoic acid 8812269
Liver Neoplasms inferred via perfluorooctanoic acid 14757943
Niemann-Pick Disease, Type C inferred via perfluorooctanoic acid 9802331
Prenatal Exposure Delayed Effects inferred via perfluorooctanoic acid 17132714
Cardiovascular Diseases inferred via Isoflavones 17689850
Colorectal Neoplasms inferred via Isoflavones 17116718
Hot Flashes inferred via Isoflavones 17290160
Osteoporosis inferred via Isoflavones 16562857
Prostatic Neoplasms inferred via Isoflavones 16365062, 17374662, 17571952, 17219775
Breast Neoplasms inferred via Genistein 17200150, 16541309, 16873071
Carcinoma, Hepatocellular inferred via Genistein 16924424
Cardiovascular Diseases inferred via Genistein 16332659
Colonic Neoplasms inferred via Genistein 17182828
Diabetes Mellitus, Type 2 inferred via Genistein 16647724
Endometrial Hyperplasia inferred via Genistein 16402032
Glioblastoma inferred via Genistein 16598420
Liver Cirrhosis, Experimental inferred via Genistein 17823541
Mammary Neoplasms, Experimental inferred via Genistein 14578162, 12929590
Myocardial Infarction inferred via Genistein 17141266
Myocardial Reperfusion Injury inferred via Genistein 17141266
Osteoporosis, Postmenopausal inferred via Genistein 16169203
Prostatic Neoplasms inferred via Genistein 16925846, 15378649, 15256057
Inflammation inferred via Flavonoids 17296493
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 11677210, 15861022, 16919318, 17681005, 16105132, 17333356
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16124888, 16227642, 15700767, 10355542, 16011737, 16097048, 15673190, 16050911
Fatty Liver inferred via Carbon Tetrachloride 16045604, 17595544, 16239168, 15959796, 12795759, 61145, 12631006
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 11566570, 15998439, 16177239, 16227642, 15027814, 15968718
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16239168, 17334410, 16943688, 16221502
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 16116963, 16248980, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 18418968, 12666154, 16638106, 18395095, 18156304, 17976157, 17557913, 17805973, 17525996, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 15925388
Liver Diseases inferred via Carbon Tetrachloride 16246199, 16964402, 15830285, 17285989, 15720792
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Adenoma inferred via 2-Acetylaminofluorene 10737359
Carcinoma, Hepatocellular inferred via 2-Acetylaminofluorene 10737359
Liver Neoplasms inferred via 2-Acetylaminofluorene 10737359, 11376686, 18001218, 14678523, 10672840, 16273603
Lung Neoplasms inferred via 2-Acetylaminofluorene 11376686
Urinary Bladder Neoplasms inferred via 2-Acetylaminofluorene 15867355, 15289314
Breast Neoplasms inferred via 2,4-diaminotoluene 11921183

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Perera F, et al. (2009) "Relation of DNA methylation of 5'-CpG island of ACSL3 to transplacental exposure to airborne polycyclic aromatic hydrocarbons and childhood asthma." PLoS One. 4(2):e4488. PMID:19221603
  2. [ + ] Yao H, et al. (2008) "Long chain acyl-CoA synthetase 3-mediated phosphatidylcholine synthesis is required for assembly of very low density lipoproteins in human hepatoma Huh7 cells." J Biol Chem. 283(2):849-854. PMID:18003621
  3. [ + ] Jia Z, et al. (2007) "The fatty acid transport protein (FATP) family: very long chain acyl-CoA synthetases or solute carriers?" J Mol Neurosci. 33(1):25-31. PMID:17901542
  4. [ + ] Zhou Y, et al. (2007) "Transcriptional activation of hepatic ACSL3 and ACSL5 by oncostatin m reduces hypertriglyceridemia through enhanced beta-oxidation." Arterioscler Thromb Vasc Biol. 27(10):2198-2205. PMID:17761945
  5. [ + ] Tu LC, et al. (2007) "Proteomics analysis of the interactome of N-myc downstream regulated gene 1 and its interactions with the androgen response program in prostate cancer cells." Mol Cell Proteomics. 6(4):575-588. PMID:17220478
  6. [ + ] Rohozinski J, et al. (2006) "UTP14c is a recently acquired retrogene associated with spermatogenesis and fertility in man." Biol Reprod. 74(4):644-651. PMID:16354793
  7. [ + ] Mashek DG, et al. (2004) "Revised nomenclature for the mammalian long-chain acyl-CoA synthetase gene family." J Lipid Res. 45(10):1958-1961. PMID:15292367
  8. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  9. [ + ] Beausoleil SA, et al. (2004) "Large-scale characterization of HeLa cell nuclear phosphoproteins." Proc Natl Acad Sci U S A. 101(33):12130-12135. PMID:15302935
  10. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  11. [ + ] Qiao S, et al. (2004) "Vitamin D3 inhibits fatty acid synthase expression by stimulating the expression of long-chain fatty-acid-CoA ligase 3 in prostate cancer cells." FEBS Lett. 577(3):451-454. PMID:15556626
  12. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  13. [ + ] Minekura H, et al. (2001) "Genomic organization and transcription units of the human acyl-CoA synthetase 3 gene." Gene. 278(1-2):185-192. PMID:11707336
  14. [ + ] Minekura H, et al. (1997) "Human acyl-coenzyme A synthetase 3 cDNA and localization of its gene (ACS3) to chromosome band 2q34-q35." Genomics. 42(1):180-181. PMID:9177793
  15. [ + ] Fujino T, et al. (1996) "Molecular characterization and expression of rat acyl-CoA synthetase 3." J Biol Chem. 271(28):16748-16752. PMID:8663269
  16. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548
  17. [ + ] Rose CS, et al. (1994) "Localization of the genetic locus for Saethre-Chotzen syndrome to a 6 cM region of chromosome 7 using four cases with apparently balanced translocations at 7p21.2." Hum Mol Genet. 3(8):1405-1408. PMID:7987323
  18. [ + ] Brueton LA, et al. (1992) "The mapping of a gene for craniosynostosis: evidence for linkage of the Saethre-Chotzen syndrome to distal chromosome 7p." J Med Genet. 29(10):681-685. PMID:1433226
  19. [ + ] Bakken AM, et al. (1991) "Identity between palmitoyl-CoA synthetase and arachidonoyl-CoA synthetase in human platelet?" Biochem J. 274 ( Pt 1)():145-152. PMID:1848073
  20. [ + ] Bronfman M, et al. (1984) "Acyl-CoA synthetase and the peroxisomal enzymes of beta-oxidation in human liver. Quantitative analysis of their subcellular localization." Biochem J. 224(3):709-720. PMID:6240978