ABCD1 | GeneID:215 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 215 Official Symbol ABCD1
Locus N/A Gene Type protein-coding
Synonyms ABC42; ALD; ALDP; AMN
Full Name ATP-binding cassette, sub-family D (ALD), member 1
Description ATP-binding cassette, sub-family D (ALD), member 1
Chromosome Xq28
Also Known As OTTHUMP00000025960; adrenoleukodystrophy protein
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein is likely involved in the peroxisomal transport or catabolism of very long chain fatty acids. Defects in this gene have been identified as the underlying cause of adrenoleukodystrophy, an X-chromosome recessively inherited demyelinating disorder of the nervous system. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55426

ID Symbol Protein Species
GeneID:215 ABCD1 NP_000024.2 Homo sapiens
GeneID:11666 Abcd1 NP_031461.1 Mus musculus
GeneID:363516 Abcd1 XP_343841.1 Rattus norvegicus
GeneID:515178 ABCD1 NP_001039655.1 Bos taurus
GeneID:566367 zgc:172102 NP_001104656.1 Danio rerio
GeneID:612520 ABCD1 XP_855341.1 Canis lupus familiaris
GeneID:2684880 MGG_06707 XP_370210.2 Magnaporthe grisea
GeneID:2709950 NCU01751.1 XP_328190.1 Neurospora crassa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abnova H00000215-M01 ABCD1 monoclonal antibody (M01), clone 4B5; Mouse monoclonal antibody raised against a partial recombinant ABCD1.
2 scbt ABCD1 ABCD1 Antibody / ABCD1 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCD1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCD1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0005779 Component integral to peroxisomal membrane
GO:0016020 Component membrane
GO:0005778 Component peroxisomal membrane
GO:0005777 Component peroxisome
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0042802 Function identical protein binding
GO:0000166 Function nucleotide binding
GO:0005215 Function transporter activity
GO:0015919 Process peroxisomal membrane transport
GO:0007031 Process peroxisome organization
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000033  UCSC Browser NP_000024

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000218104 MI0000443 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000218104 MI0000444 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000218104 MI0000445 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000218104 MI0000469 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENST00000218104 MI0000474 hsa-miR-134 UGUGACUGGUUGACCAGAGGGG
ENST00000218104 MI0000478 hsa-miR-149 UCUGGCUCCGUGUCUUCACUCCC
ENST00000218104 MI0000487 hsa-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA
ENST00000218104 MI0000285 hsa-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENST00000218104 MI0000813 hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENST00000218104 MI0000743 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC
ENST00000218104 MI0001648 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENST00000218104 MI0003673 hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
ENST00000218104 MI0003159 hsa-miR-518c* UCUCUGGAGGGAAGCACUUUCUG
ENST00000218104 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENST00000218104 MI0005559 hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENST00000218104 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENST00000218104 MI0005532 hsa-miR-874 CUGCCCUGGCCCGAGGGACCGA
ENST00000218104 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENST00000218104 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENST00000218104 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENST00000218104 MI0004682 mmu-miR-698 CAUUCUCGUUUCCUUCCCU
ENST00000218104 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENST00000218104 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAH15541   AAH25358   AAR07956   AAR07957   AAR07958   ABC41634   ABM81926   ABM85103   CAA79922   CAA83230   EAW72817   NP_000024   P33897   Q2PRN6   Q6TGM0   Q6TGM1   Q6TGM2  

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Clofibric Acid
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ABCD1 mRNA
17602206
Diethylnitrosamine
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ABCD1 mRNA
17602206
Progesterone
  • Progesterone affects the expression of ABCD1 mRNA
17251523
tert-Butylhydroperoxide
  • tert-Butylhydroperoxide results in increased expression of ABCD1 mRNA
15003993

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Adrenoleukodystrophy marker 17602313
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15845082, 15380490
Breast Neoplasms inferred via Progesterone 17614352, 16175315, 15562024
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Adenoma inferred via Diethylnitrosamine 10737359
Carcinoma, Hepatocellular inferred via Diethylnitrosamine 16878318, 17428255, 10672840, 10737359, 11831363
Liver Neoplasms inferred via Diethylnitrosamine 2422723, 10737359, 18648771, 15885732, 16942905, 12112319
Liver Neoplasms, Experimental inferred via Diethylnitrosamine 16267830, 3124819, 16842330
Liver Neoplasms inferred via Clofibric Acid 17602206

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ABCD2 ABCD1 / ABCD2 Two-hybrid Liu LX (1999)
ABCD3 ABCD3 / ABCD1 Two-hybrid Liu LX (1999)
PEX19 PEX19 / ABCD1 Reconstituted Complex Gloeckner CJ (2000)
PEX19 PEX19 / ABCD1 Reconstituted Complex Mayerhofer PU (2002)
PEX19 PEX19 / ABCD1 Two-hybrid Gloeckner CJ (2000)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Wang Z, et al. (2008) "Identification of two de novo mutations in Chinese patients with X-linked adrenoleukodystrophy." Clin Chem Lab Med. 46(12):1702-1706. PMID:18973459
  3. [ + ] Fogel BL, et al. (2008) "A family with combined mutations of the hemophilia A and X-linked adrenoleukodystrophy genes." Neurogenetics. 9(3):215-218. PMID:18481121
  4. [ + ] Sutovsky S, et al. (2007) "Adult onset cerebral form of X-linked adrenoleukodystrophy with dementia of frontal lobe type with new L160P mutation in ABCD1 gene." J Neurol Sci. 263(1-2):149-153. PMID:17662307
  5. [ + ] Takahashi N, et al. (2007) "Adrenoleukodystrophy: subcellular localization and degradation of adrenoleukodystrophy protein (ALDP/ABCD1) with naturally occurring missense mutations." J Neurochem. 101(6):1632-1643. PMID:17542813
  6. [ + ] Bao XH, et al. (2007) "[Prenatal diagnosis of X-linked adrenoleukodystrophy]" Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 24(1):1-5. PMID:17285533
  7. [ + ] Ping LL, et al. (2007) "[Clinical features and genotype-phenotype studies of 89 Chinese patients with X-linked adrenoleukodystrophy]" Zhonghua Er Ke Za Zhi. 45(3):203-207. PMID:17504626
  8. [ + ] Vachalova I, et al. (2007) "Adrenoleukodystrophy--a new mutation identified." Bratisl Lek Listy. 108(10-11):462-466. PMID:18306728
  9. [ + ] Dumser M, et al. (2007) "Lack of adrenoleukodystrophy protein enhances oligodendrocyte disturbance and microglia activation in mice with combined Abcd1/Mag deficiency." Acta Neuropathol. 114(6):573-586. PMID:17828604
  10. [ + ] Hoftberger R, et al. (2007) "Distribution and cellular localization of adrenoleukodystrophy protein in human tissues: implications for X-linked adrenoleukodystrophy." Neurobiol Dis. 28(2):165-174. PMID:17761426
  11. [ + ] Halbach A, et al. (2005) "Function of the PEX19-binding site of human adrenoleukodystrophy protein as targeting motif in man and yeast. PMP targeting is evolutionarily conserved." J Biol Chem. 280(22):21176-21182. PMID:15781447
  12. [ + ] Huang LH, et al. (2005) "Prenatal molecular diagnosis of adrenoleukodystrophy." Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 22(6):612-615. PMID:16331554
  13. [ + ] Pan H, et al. (2005) "ABCD1 gene mutations in Chinese patients with X-linked adrenoleukodystrophy." Pediatr Neurol. 33(2):114-120. PMID:16087056
  14. [ + ] Dionne A, et al. (2005) "Adrenomyeloneuropathy: report of a new mutation in a French Canadian female." Can J Neurol Sci. 32(2):261-263. PMID:16018167
  15. [ + ] Ross MT, et al. (2005) "The DNA sequence of the human X chromosome." Nature. 434(7031):325-337. PMID:15772651
  16. [ + ] Oezen I, et al. (2005) "Accumulation of very long-chain fatty acids does not affect mitochondrial function in adrenoleukodystrophy protein deficiency." Hum Mol Genet. 14(9):1127-1137. PMID:15772093
  17. [ + ] Montagna G, et al. (2005) "Identification of seven novel mutations in ABCD1 by a DHPLC-based assay in Italian patients with X-linked adrenoleukodystrophy." Hum Mutat. 25(2):222. PMID:15643618
  18. [ + ] Pan H, et al. (2004) "[X-linked adrenoleukodystrophy ABCD1 gene mutation analysis in China]" Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 21(1):1-4. PMID:14767898
  19. [ + ] Walter M, et al. (2004) "The establishment of telomerase-immortalized Tangier disease cell lines indicates the existence of an apolipoprotein A-I-inducible but ABCA1-independent cholesterol efflux pathway." J Biol Chem. 279(20):20866-20873. PMID:15001567
  20. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  21. [ + ] Shi XR, et al. (2003) "[Analysis on mutation of adrenoleukodystrophy gene in exon 1 and exon 5]" Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 20(1):43-45. PMID:12579499
  22. [ + ] Xiong H, et al. (2003) "[Preliminary analysis of mutations in X-linked adrenoleukodystrophy gene(ABCD1) in Chinese patients]" Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 20(5):400-403. PMID:14556192
  23. [ + ] McGuinness MC, et al. (2003) "Role of ALDP (ABCD1) and mitochondria in X-linked adrenoleukodystrophy." Mol Cell Biol. 23(2):744-753. PMID:12509471
  24. [ + ] Matsumoto T, et al. (2003) "Mutation analysis of the ALD gene in seven Japanese families with X-linked adrenoleukodystrophy." J Hum Genet. 48(3):125-129. PMID:12624723
  25. [ + ] Guimaraes CP, et al. (2002) "Molecular characterization of 21 X-ALD Portuguese families: identification of eight novel mutations in the ABCD1 gene." Mol Genet Metab. 76(1):62-67. PMID:12175782
  26. [ + ] Gartner J, et al. (2002) "Functional characterization of the adrenoleukodystrophy protein (ALDP) and disease pathogenesis." Endocr Res. 28(4):741-748. PMID:12530690
  27. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  28. [ + ] Mayerhofer PU, et al. (2002) "Two splice variants of human PEX19 exhibit distinct functions in peroxisomal assembly." Biochem Biophys Res Commun. 291(5):1180-1186. PMID:11883941
  29. [ + ] Hershkovitz E, et al. (2002) "Cerebral X-linked adrenoleukodystrophy in a girl with Xq27-Ter deletion." Ann Neurol. 52(2):234-237. PMID:12210797
  30. [ + ] Corzo D, et al. (2002) "Contiguous deletion of the X-linked adrenoleukodystrophy gene (ABCD1) and DXS1357E: a novel neonatal phenotype similar to peroxisomal biogenesis disorders." Am J Hum Genet. 70(6):1520-1531. PMID:11992258
  31. [ + ] Kemp S, et al. (2001) "ABCD1 mutations and the X-linked adrenoleukodystrophy mutation database: role in diagnosis and clinical correlations." Hum Mutat. 18(6):499-515. PMID:11748843
  32. [ + ] Roerig P, et al. (2001) "Characterization and functional analysis of the nucleotide binding fold in human peroxisomal ATP binding cassette transporters." FEBS Lett. 492(1-2):66-72. PMID:11248239
  33. [ + ] Dvorakova L, et al. (2001) "Eight novel ABCD1 gene mutations and three polymorphisms in patients with X-linked adrenoleukodystrophy: The first polymorphism causing an amino acid exchange." Hum Mutat. 18(1):52-60. PMID:11438993
  34. [ + ] Lan F, et al. (2001) "Molecular diagnostics in China." Clin Chem Lab Med. 39(12):1190-1194. PMID:11798073
  35. [ + ] Guimaraes CP, et al. (2001) "Characterisation of two mutations in the ABCD1 gene leading to low levels of normal ALDP." Hum Genet. 109(6):616-622. PMID:11810273
  36. [ + ] Sacksteder KA, et al. (2000) "PEX19 binds multiple peroxisomal membrane proteins, is predominantly cytoplasmic, and is required for peroxisome membrane synthesis." J Cell Biol. 148(5):931-944. PMID:10704444
  37. [ + ] Lira MG, et al. (2000) "Detection of mutations in the ALD gene (ABCD1) in seven Italian families: description of four novel mutations." Hum Mutat. 16(3):271. PMID:10980539
  38. [ + ] Gloeckner CJ, et al. (2000) "Human adrenoleukodystrophy protein and related peroxisomal ABC transporters interact with the peroxisomal assembly protein PEX19p." Biochem Biophys Res Commun. 271(1):144-150. PMID:10777694
  39. [ + ] Lachtermacher MB, et al. (2000) "Determination of 30 X-linked adrenoleukodystrophy mutations, including 15 not previously described." Hum Mutat. 15(4):348-353. PMID:10737980
  40. [ + ] Takano H, et al. (1999) "Mutational analysis and genotype-phenotype correlation of 29 unrelated Japanese patients with X-linked adrenoleukodystrophy." Arch Neurol. 56(3):295-300. PMID:10190819
  41. [ + ] Liu LX, et al. (1999) "Homo- and heterodimerization of peroxisomal ATP-binding cassette half-transporters." J Biol Chem. 274(46):32738-32743. PMID:10551832
  42. [ + ] Wichers M, et al. (1999) "X-linked adrenomyeloneuropathy associated with 14 novel ALD-gene mutations: no correlation between type of mutation and age of onset." Hum Genet. 105(1-2):116-119. PMID:10480364
  43. [ + ] Perusi C, et al. (1999) "Two novel missense mutations causing adrenoleukodystrophy in Italian patients." Mol Cell Probes. 13(3):179-182. PMID:10369742
  44. [ + ] Kano S, et al. (1998) "A Japanese family with adrenoleukodystrophy with a codon 291 deletion: a clinical, biochemical, pathological, and genetic report." J Neurol Sci. 158(2):187-192. PMID:9702690
  45. [ + ] Eichler EE, et al. (1997) "Interchromosomal duplications of the adrenoleukodystrophy locus: a phenomenon of pericentromeric plasticity." Hum Mol Genet. 6(7):991-1002. PMID:9215666
  46. [ + ] Dodd A, et al. (1997) "Mutations in the adrenoleukodystrophy gene." Hum Mutat. 9(6):500-511. PMID:9195223
  47. [ + ] Feigenbaum V, et al. (1996) "Mutational and protein analysis of patients and heterozygous women with X-linked adrenoleukodystrophy." Am J Hum Genet. 58(6):1135-1144. PMID:8651290
  48. [ + ] Krasemann EW, et al. (1996) "Identification of mutations in the ALD-gene of 20 families with adrenoleukodystrophy/adrenomyeloneuropathy." Hum Genet. 97(2):194-197. PMID:8566952
  49. [ + ] Watkins PA, et al. (1995) "Altered expression of ALDP in X-linked adrenoleukodystrophy." Am J Hum Genet. 57(2):292-301. PMID:7668254