Sphk1 | GeneID:20698 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 20698 Official Symbol Sphk1
Locus RP23-193A16.4 Gene Type protein-coding
Synonyms 1110006G24Rik; SK1
Full Name sphingosine kinase 1
Description sphingosine kinase 1
Chromosome 11 E2
Also Known As OTTMUSP00000004201; OTTMUSP00000004202; OTTMUSP00000004203; OTTMUSP00000004204; OTTMUSP00000004205
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 39748

ID Symbol Protein Species
GeneID:8877 SPHK1 NP_892010.1 Homo sapiens
GeneID:20698 Sphk1 NP_079643.2 Mus musculus
GeneID:32089 Sk1 NP_572717.1 Drosophila melanogaster
GeneID:170897 Sphk1 NP_596877.2 Rattus norvegicus
GeneID:427803 SPHK1 XP_425374.2 Gallus gallus
GeneID:483329 SPHK1 XP_540448.2 Canis lupus familiaris
GeneID:618605 SPHK1 XP_876032.2 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab16491 SPHK1 antibody (ab16491); Rabbit polyclonal to SPHK1
2 abcam ab46719 SPHK1 antibody (ab46719); Rabbit polyclonal to SPHK1
3 acris AP05256PU-N Sphingosine kinase 1 (SPHK1); antibody
4 acris AP05255PU-N Sphingosine kinase 1 (SPHK1) (pSer225); antibody

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005624 Component membrane fraction
GO:0005625 Component soluble fraction
GO:0005524 Function ATP binding
GO:0005516 Function calmodulin binding
GO:0004143 Function diacylglycerol kinase activity
GO:0003677 Function DNA binding
GO:0016301 Function kinase activity
GO:0000166 Function nucleotide binding
GO:0008481 Function sphinganine kinase activity
GO:0016740 Function transferase activity
GO:0007205 Process activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway
GO:0001568 Process blood vessel development
GO:0007420 Process brain development
GO:0006954 Process inflammatory response
GO:0043066 Process negative regulation of apoptosis
GO:0008284 Process positive regulation of cell proliferation
GO:0048146 Process positive regulation of fibroblast proliferation
GO:0032651 Process regulation of interleukin-1 beta production

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_011451  UCSC Browser NP_035581
2 NM_025367  UCSC Browser NP_079643

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000063396 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSMUST00000063396 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSMUST00000063396 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENSMUST00000063396 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENSMUST00000063396 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENSMUST00000063396 MI0000221 mmu-miR-10b UACCCUGUAGAACCGAAUUUGUG
ENSMUST00000063396 MI0000725 mmu-miR-125b-3p ACGGGUUAGGCUCUUGGGAGCU
ENSMUST00000063396 MI0000408 mmu-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSMUST00000063396 MI0000161 mmu-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSMUST00000063396 MI0000715 mmu-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSMUST00000063396 MI0000646 mmu-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENSMUST00000063396 MI0000164 mmu-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENSMUST00000063396 MI0000722 mmu-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENSMUST00000063396 MI0000702 mmu-miR-219 UGAUUGUCCAAACGCAAUUCU
ENSMUST00000063396 MI0000741 mmu-miR-219 UGAUUGUCCAAACGCAAUUCU
ENSMUST00000063396 MI0000709 mmu-miR-221 AGCUACAUUGUCUGCUGGGUUUC
ENSMUST00000063396 MI0000710 mmu-miR-222 AGCUACAUCUGGCUACUGGGU
ENSMUST00000063396 MI0000231 mmu-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSMUST00000063396 MI0000572 mmu-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSMUST00000063396 MI0000619 mmu-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG
ENSMUST00000063396 MI0000796 mmu-miR-379 UGGUAGACUAUGGAACGUAGG
ENSMUST00000063396 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSMUST00000063396 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENSMUST00000063396 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENSMUST00000063396 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENSMUST00000063396 MI0005004 mmu-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC
ENSMUST00000063396 MI0004123 mmu-miR-675-5p UGGUGCGGAAAGGGCCCACAGU
ENSMUST00000063396 MI0004662 mmu-miR-693-5p CAGCCACAUCCGAAAGUUUUC
ENSMUST00000063396 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENSMUST00000063396 MI0005479 mmu-miR-874 CUGCCCUGGCCCGAGGGACCGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Jo SK, et al. (2009) "Divergent roles of sphingosine kinases in kidney ischemia-reperfusion injury." Kidney Int. 75(2):167-175. PMID:18971925
  2. [ + ] Kawamori T, et al. (2009) "Role for sphingosine kinase 1 in colon carcinogenesis." FASEB J. 23(2):405-414. PMID:18824518
  3. [ + ] Snider AJ, et al. (2009) "A role for sphingosine kinase 1 in dextran sulfate sodium-induced colitis." FASEB J. 23(1):143-152. PMID:18815359
  4. [ + ] Yeh CC, et al. (2009) "Sphingolipid signaling and treatment during remodeling of the uninfarcted ventricular wall after myocardial infarction." Am J Physiol Heart Circ Physiol. 296(4):H1193-H1199. PMID:19234089
  5. [ + ] Wadgaonkar R, et al. (2009) "Differential regulation of sphingosine kinases 1 and 2 in lung injury." Am J Physiol Lung Cell Mol Physiol. 296(4):L603-L613. PMID:19168577
  6. [ + ] Billich A, et al. (2009) "Sphingosine kinase 1 is essential for proteinase-activated receptor-1 signalling in epithelial and endothelial cells." Int J Biochem Cell Biol. 41(7):1547-1555. PMID:19162217
  7. [ + ] Niessen F, et al. (2009) "Endogenous EPCR/aPC-PAR1 signaling prevents inflammation-induced vascular leakage and lethality." Blood. 113(12):2859-2866. PMID:19141861
  8. [ + ] Bonder CS, et al. (2009) "Sphingosine kinase regulates the rate of endothelial progenitor cell differentiation." Blood. 113(9):2108-2117. PMID:19109558
  9. [ + ] Kirby RJ, et al. (2009) "Dynamic regulation of sphingosine-1-phosphate homeostasis during development of mouse metanephric kidney." Am J Physiol Renal Physiol. 296(3):F634-F641. PMID:19073640
  10. [ + ] Donati C, et al. (2009) "TGFbeta protects mesoangioblasts from apoptosis via sphingosine kinase-1 regulation." Cell Signal. 21(2):228-236. PMID:18983913
  11. [ + ] Tauseef M, et al. (2008) "Activation of sphingosine kinase-1 reverses the increase in lung vascular permeability through sphingosine-1-phosphate receptor signaling in endothelial cells." Circ Res. 103(10):1164-1172. PMID:18849324
  12. [ + ] Coste O, et al. (2008) "Sphingosine 1-phosphate modulates spinal nociceptive processing." J Biol Chem. 283(47):32442-32451. PMID:18805787
  13. [ + ] Hofmann LP, et al. (2008) "Sphingosine kinase 1 and 2 regulate the capacity of mesangial cells to resist apoptotic stimuli in an opposing manner." Biol Chem. 389(11):1399-1407. PMID:18783337
  14. [ + ] Sobue S, et al. (2008) "v-Src oncogene product increases sphingosine kinase 1 expression through mRNA stabilization: alteration of AU-rich element-binding proteins." Oncogene. 27(46):6023-6033. PMID:18574469
  15. [ + ] Wu YP, et al. (2008) "Sphingosine kinase 1/S1P receptor signaling axis controls glial proliferation in mice with Sandhoff disease." Hum Mol Genet. 17(15):2257-2264. PMID:18424450
  16. [ + ] Jin ZQ, et al. (2008) "Ischaemic postconditioning protects isolated mouse hearts against ischaemia/reperfusion injury via sphingosine kinase isoform-1 activation." Cardiovasc Res. 79(1):134-140. PMID:18334546
  17. [ + ] Lai WQ, et al. (2008) "The role of sphingosine kinase in a murine model of allergic asthma." J Immunol. 180(6):4323-4329. PMID:18322246
  18. [ + ] Niessen F, et al. (2008) "Dendritic cell PAR1-S1P3 signalling couples coagulation and inflammation." Nature. 452(7187):654-658. PMID:18305483
  19. [ + ] Li X, et al. (2008) "Basal and angiopoietin-1-mediated endothelial permeability is regulated by sphingosine kinase-1." Blood. 111(7):3489-3497. PMID:18199826
  20. [ + ] Hammad SM, et al. (2008) "Dual and distinct roles for sphingosine kinase 1 and sphingosine 1 phosphate in the response to inflammatory stimuli in RAW macrophages." Prostaglandins Other Lipid Mediat. 85(3-4):107-114. PMID:18166496
  21. [ + ] Meacci E, et al. (2008) "Sphingosine kinase activity is required for myogenic differentiation of C2C12 myoblasts." J Cell Physiol. 214(1):210-220. PMID:17654519
  22. [ + ] Lai WQ, et al. (2008) "Anti-inflammatory effects of sphingosine kinase modulation in inflammatory arthritis." J Immunol. 181(11):8010-8017. PMID:19017993
  23. [ + ] Kim M, et al. (2007) "Isoflurane mediates protection from renal ischemia-reperfusion injury via sphingosine kinase and sphingosine-1-phosphate-dependent pathways." Am J Physiol Renal Physiol. 293(6):F1827-F1835. PMID:17898040
  24. [ + ] Mizugishi K, et al. (2007) "Maternal disturbance in activated sphingolipid metabolism causes pregnancy loss in mice." J Clin Invest. 117(10):2993-3006. PMID:17885683
  25. [ + ] Olivera A, et al. (2007) "The sphingosine kinase-sphingosine-1-phosphate axis is a determinant of mast cell function and anaphylaxis." Immunity. 26(3):287-297. PMID:17346996
  26. [ + ] Soldi R, et al. (2007) "Sphingosine kinase 1 is a critical component of the copper-dependent FGF1 export pathway." Exp Cell Res. 313(15):3308-3318. PMID:17643421
  27. [ + ] Kono Y, et al. (2007) "Sphingosine kinase 1 regulates differentiation of human and mouse lung fibroblasts mediated by TGF-beta1." Am J Respir Cell Mol Biol. 37(4):395-404. PMID:17641298
  28. [ + ] Kusner DJ, et al. (2007) "The localization and activity of sphingosine kinase 1 are coordinately regulated with actin cytoskeletal dynamics in macrophages." J Biol Chem. 282(32):23147-23162. PMID:17519232
  29. [ + ] Kacimi R, et al. (2007) "Adult cardiac fibroblasts null for sphingosine kinase-1 exhibit growth dysregulation and an enhanced proinflammatory response." J Mol Cell Cardiol. 43(1):85-91. PMID:17512943
  30. [ + ] Jin ZQ, et al. (2007) "A sphingosine kinase 1 mutation sensitizes the myocardium to ischemia/reperfusion injury." Cardiovasc Res. 76(1):41-50. PMID:17610857
  31. [ + ] Pappu R, et al. (2007) "Promotion of lymphocyte egress into blood and lymph by distinct sources of sphingosine-1-phosphate." Science. 316(5822):295-298. PMID:17363629
  32. [ + ] Granata R, et al. (2007) "Insulin-like growth factor binding protein-3 induces angiogenesis through IGF-I- and SphK1-dependent mechanisms." J Thromb Haemost. 5(4):835-845. PMID:17388800
  33. [ + ] Klawitter S, et al. (2007) "Extracellular nucleotides induce migration of renal mesangial cells by upregulating sphingosine kinase-1 expression and activity." Br J Pharmacol. 150(3):271-280. PMID:17200676
  34. [ + ] Ma MM, et al. (2007) "Sphingosine kinase 1 participates in insulin signalling and regulates glucose metabolism and homeostasis in KK/Ay diabetic mice." Diabetologia. 50(4):891-900. PMID:17265031
  35. [ + ] Zemann B, et al. (2007) "Normal neutrophil functions in sphingosine kinase type 1 and 2 knockout mice." Immunol Lett. 109(1):56-63. PMID:17292973
  36. [ + ] Pilorget A, et al. (2007) "Modulation of P-glycoprotein function by sphingosine kinase-1 in brain endothelial cells." J Neurochem. 100(5):1203-1210. PMID:17316399
  37. [ + ] Tao R, et al. (2007) "Deletion of the sphingosine kinase-1 gene influences cell fate during hypoxia and glucose deprivation in adult mouse cardiomyocytes." Cardiovasc Res. 74(1):56-63. PMID:17320845
  38. [ + ] Roviezzo F, et al. (2007) "Sphingosine-1-phosphate/sphingosine kinase pathway is involved in mouse airway hyperresponsiveness." Am J Respir Cell Mol Biol. 36(6):757-762. PMID:17322125
  39. [ + ] Kohno M, et al. (2006) "Intracellular role for sphingosine kinase 1 in intestinal adenoma cell proliferation." Mol Cell Biol. 26(19):7211-7223. PMID:16980623
  40. [ + ] Zemann B, et al. (2006) "Sphingosine kinase type 2 is essential for lymphopenia induced by the immunomodulatory drug FTY720." Blood. 107(4):1454-1458. PMID:16223773
  41. [ + ] Olivera A, et al. (2006) "IgE-dependent activation of sphingosine kinases 1 and 2 and secretion of sphingosine 1-phosphate requires Fyn kinase and contributes to mast cell responses." J Biol Chem. 281(5):2515-2525. PMID:16316995
  42. [ + ] Kihara A, et al. (2006) "Mouse sphingosine kinase isoforms SPHK1a and SPHK1b differ in enzymatic traits including stability, localization, modification, and oligomerization." J Biol Chem. 281(7):4532-4539. PMID:16368679
  43. [ + ] Wendler CC, et al. (2006) "Sphingosine-1-phosphate inhibits cell migration and endothelial to mesenchymal cell transformation during cardiac development." Dev Biol. 291(2):264-277. PMID:16434032
  44. [ + ] Yadav M, et al. (2006) "Macrophage's proinflammatory response to a mycobacterial infection is dependent on sphingosine kinase-mediated activation of phosphatidylinositol phospholipase C, protein kinase C, ERK1/2, and phosphatidylinositol 3-kinase." J Immunol. 176(9):5494-5503. PMID:16622018
  45. [ + ] Venkataraman K, et al. (2006) "Extracellular export of sphingosine kinase-1a contributes to the vascular S1P gradient." Biochem J. 397(3):461-471. PMID:16623665
  46. [ + ] Michaud J, et al. (2006) "Normal acute and chronic inflammatory responses in sphingosine kinase 1 knockout mice." FEBS Lett. 580(19):4607-4612. PMID:16876794
  47. [ + ] Sun J, et al. (2006) "FHL2/SLIM3 decreases cardiomyocyte survival by inhibitory interaction with sphingosine kinase-1." Circ Res. 99(5):468-476. PMID:16888242
  48. [ + ] He Q, et al. (2006) "Ceramide synthase inhibition by fumonisin B1 treatment activates sphingolipid-metabolizing systems in mouse liver." Toxicol Sci. 94(2):388-397. PMID:16960033
  49. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  50. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072