EPS8 | GeneID:2059 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2059 Official Symbol EPS8
Locus N/A Gene Type protein-coding
Synonyms
Full Name epidermal growth factor receptor pathway substrate 8
Description epidermal growth factor receptor pathway substrate 8
Chromosome 12q13
Also Known As
Summary This gene encodes a member of the EPS8 family. This protein contains one PH domain and one SH3 domain. It functions as part of the EGFR pathway, though its exact role has not been determined. Highly similar proteins in other organisms are involved in the transduction of signals from Ras to Rac and growth factor-mediated actin remodeling. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3272

ID Symbol Protein Species
GeneID:2059 EPS8 NP_004438.3 Homo sapiens
GeneID:13860 Eps8 NP_031971.2 Mus musculus
GeneID:312812 Eps8 XP_232499.4 Rattus norvegicus
GeneID:393212 zgc:56041 NP_956536.1 Danio rerio
GeneID:418174 EPS8 XP_416405.2 Gallus gallus
GeneID:473379 EPS8 XP_528750.2 Pan troglodytes
GeneID:477686 EPS8 XP_534881.2 Canis lupus familiaris
GeneID:538419 EPS8 NP_001069570.1 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab38329 EPS8 antibody (ab38329); Goat polyclonal to EPS8
2 abgent AP8148b EPS8 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
3 abgent AP8148a EPS8 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
4 acris AP15143PU-N EPS8 (C-term); antibody Ab
5 acris AP15142PU-N EPS8 (N-term); antibody Ab
6 scbt EPS8 EPS8 Antibody / EPS8 Antibodies;
7 sigma HPA003897 Anti-EPS8 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of EPS8 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of EPS8 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005794 Component Golgi apparatus
GO:0017146 Component N-methyl-D-aspartate selective glutamate receptor complex
GO:0014069 Component postsynaptic density
GO:0019717 Component synaptosome
GO:0005515 Function protein binding
GO:0005070 Function SH3/SH2 adaptor activity
GO:0031532 Process actin cytoskeleton reorganization
GO:0008344 Process adult locomotory behavior
GO:0048149 Process behavioral response to ethanol
GO:0008283 Process cell proliferation
GO:0007173 Process epidermal growth factor receptor signaling pathway
GO:0007165 Process signal transduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_004447  UCSC Browser NP_004438 B4E3T6   Q12929  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000281172 MI0000063 hsa-let-7b* CUAUACAACCUACUGCCUUCCC
ENST00000281172 MI0000067 hsa-let-7f-1* CUAUACAAUCUAUUGCCUUCCC
ENST00000281172 MI0000460 hsa-miR-144 UACAGUAUAGAUGAUGUACU
ENST00000281172 MI0000681 hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGGU
ENST00000281172 MI0002464 hsa-miR-412 ACUUCACCUGGUCCACUAGCCGU
ENST00000281172 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENST00000281172 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENST00000281172 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENST00000281172 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENST00000281172 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENST00000281172 MI0003205 hsa-miR-532-5p CAUGCCUUGAGUGUAGGACCGU
ENST00000281172 MI0003576 hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU
ENST00000281172 MI0003589 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU
ENST00000281172 MI0003619 hsa-miR-606 AAACUACUGAAAAUCAAAGAU
ENST00000281172 MI0002398 mmu-miR-463 UGAUAGACACCAUAUAAGGUAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
4-hydroxy-2-nonenal
  • 4-hydroxy-2-nonenal results in decreased expression of EPS8 mRNA
12419474
Acetaminophen
  • Acetaminophen affects the expression of EPS8 mRNA
17562736
Arbutin
  • Arbutin results in increased expression of EPS8 mRNA
17103032
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of EPS8 mRNA
17484886
Dietary Fats
  • Dietary Fats results in decreased expression of EPS8 mRNA
18042831
Forskolin
  • Forskolin results in decreased expression of EPS8 mRNA
15967414, 15313392
palm oil
  • palm oil results in decreased expression of EPS8 mRNA
18042831
pirinixic acid
  • pirinixic acid results in increased expression of EPS8 mRNA
18301758

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16050911, 16097048, 15673190, 16011737, 16124888, 16227642, 15700767, 10355542
Fatty Liver inferred via Carbon Tetrachloride 16045604, 16239168, 12795759, 61145, 12631006, 17595544, 15959796
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15998439, 15027814, 15968718, 16227642, 16177239, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 16239168, 17334410
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 17525996, 17557913, 18156304, 16638106, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 18395095, 17976157, 17805973, 16248980, 16116963, 15925388
Liver Diseases inferred via Carbon Tetrachloride 16246199, 16964402, 17285989, 15830285, 15720792
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17522070, 17562736, 14986274, 16177239, 15968718, 16227642, 16081117
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Amyotrophic Lateral Sclerosis inferred via 4-hydroxy-2-nonenal 10965797
Photosensitivity Disorders inferred via 4-hydroxy-2-nonenal 11550810

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ABI1 ABI1 / EPS8 Affinity Capture-Western Biesova Z (1997)
ABI1 EPS8 / ABI1 Affinity Capture-Western Biesova Z (1997)
ABI1 EPS8 / ABI1 Affinity Capture-Western Lanzetti L (2000)
ABI1 EPS8 / ABI1 Affinity Capture-Western Offenhauser N (2004)
ABI1 ABI1 / EPS8 Reconstituted Complex Biesova Z (1997)
BAIAP2 BAIAP2 / EPS8 Affinity Capture-Western Funato Y (2004)
BAIAP2 BAIAP2 / EPS8 Reconstituted Complex Funato Y (2004)
BAIAP2 EPS8 / BAIAP2 Two-hybrid Rual JF (2005)
CXorf2 CXorf2 / EPS8 Two-hybrid Rual JF (2005)
DIPA EPS8 / DIPA Two-hybrid Rual JF (2005)
DNALI1 EPS8 / DNALI1 Two-hybrid Stelzl U (2005)
DVL1 DVL1 / EPS8 Affinity Capture-Western Inobe M (1999)
DVL1 DVL1 / EPS8 Reconstituted Complex Inobe M (1999)
DVL1 EPS8 / DVL1 Two-hybrid Inobe M (1999)
EPS8 EPS8 / EPS8 Affinity Capture-Western Kishan KV (1997)
EPS8 EPS8 / EPS8 Co-crystal Structure Kishan KV (1997)
EPS8 EPS8 / EPS8 Two-hybrid Rual JF (2005)
HOOK2 EPS8 / HOOK2 Two-hybrid Rual JF (2005)
JTV1 EPS8 / JTV1 Two-hybrid Rual JF (2005)
MRPL20 EPS8 / MRPL20 Two-hybrid Stelzl U (2005)
MYO15A EPS8 / MYO15A Two-hybrid Stelzl U (2005)
PCM1 EPS8 / PCM1 Two-hybrid Rual JF (2005)
PLDN EPS8 / PLDN Two-hybrid Rual JF (2005)
SHB SHB / EPS8 Affinity Capture-Western Karlsson T (1995)
SHB SHB / EPS8 Reconstituted Complex Karlsson T (1995)
SHC1 EPS8 / SHC1 Affinity Capture-Western Matoskova B (1995)
SHC1 EPS8 / SHC1 Reconstituted Complex Matoskova B (1995)
SOS1 EPS8 / SOS1 Affinity Capture-Western Offenhauser N (2004)
SOS1 SOS1 / EPS8 Affinity Capture-Western Scita G (1999)
SRC SRC / EPS8 Biochemical Activity Maa MC (1999)
SRC SRC / EPS8 Reconstituted Complex Maa MC (1999)
USP6NL EPS8 / USP6NL Invitro Matoskova B (1996)
USP6NL EPS8 / USP6NL Invivo Matoskova B (1996)
USP6NL EPS8 / USP6NL Invivo Matoskova B (1996)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Wang H, et al. (2009) "Role for EPS8 in squamous carcinogenesis." Carcinogenesis. 30(1):165-174. PMID:19008210
  2. [ + ] Zhang W, et al. (2009) "Structure of human lanthionine synthetase C-like protein 1 and its interaction with Eps8 and glutathione." Genes Dev. 23(12):1387-1392. PMID:19528316
  3. [ + ] Xu M, et al. (2009) "Epidermal growth factor receptor pathway substrate 8 is overexpressed in human pituitary tumors: role in proliferation and survival." Endocrinology. 150(5):2064-2071. PMID:19116338
  4. [ + ] Chen YJ, et al. (2008) "Eps8 decreases chemosensitivity and affects survival of cervical cancer patients." Mol Cancer Ther. 7(6):1376-1385. PMID:18566210
  5. [ + ] Melzer D, et al. (2008) "A genome-wide association study identifies protein quantitative trait loci (pQTLs)." PLoS Genet. 4(5):e1000072. PMID:18464913
  6. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  7. [ + ] Welsch T, et al. (2007) "Eps8 is increased in pancreatic cancer and required for dynamic actin-based cell protrusions and intercellular cytoskeletal organization." Cancer Lett. 255(2):205-218. PMID:17537571
  8. [ + ] Olsen JV, et al. (2006) "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell. 127(3):635-648. PMID:17081983
  9. [ + ] Disanza A, et al. (2006) "Regulation of cell shape by Cdc42 is mediated by the synergic actin-bundling activity of the Eps8-IRSp53 complex." Nat Cell Biol. 8(12):1337-1347. PMID:17115031
  10. [ + ] Yao J, et al. (2006) "Combined cDNA array comparative genomic hybridization and serial analysis of gene expression analysis of breast tumor progression." Cancer Res. 66(8):4065-4078. PMID:16618726
  11. [ + ] Rual JF, et al. (2005) "Towards a proteome-scale map of the human protein-protein interaction network." Nature. 437(7062):1173-1178. PMID:16189514
  12. [ + ] Stelzl U, et al. (2005) "A human protein-protein interaction network: a resource for annotating the proteome." Cell. 122(6):957-968. PMID:16169070
  13. [ + ] Wunsch A, et al. (2004) "Epidermal growth factor receptor pathway substrate 8 (Eps8) expression in maturing testis." Asian J Androl. 6(3):195-203. PMID:15273867
  14. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  15. [ + ] Funato Y, et al. (2004) "IRSp53/Eps8 complex is important for positive regulation of Rac and cancer cell motility/invasiveness." Cancer Res. 64(15):5237-5244. PMID:15289329
  16. [ + ] Offenhauser N, et al. (2004) "The eps8 family of proteins links growth factor stimulation to actin reorganization generating functional redundancy in the Ras/Rac pathway." Mol Biol Cell. 15(1):91-98. PMID:14565974
  17. [ + ] Di Fiore PP, et al. (2002) "Eps8 in the midst of GTPases." Int J Biochem Cell Biol. 34(10):1178-1183. PMID:12127568
  18. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  19. [ + ] Scita G, et al. (2001) "An effector region in Eps8 is responsible for the activation of the Rac-specific GEF activity of Sos-1 and for the proper localization of the Rac-based actin-polymerizing machine." J Cell Biol. 154(5):1031-1044. PMID:11524436
  20. [ + ] Ion A, et al. (2000) "Detailed mapping, mutation analysis, and intragenic polymorphism identification in candidate Noonan syndrome genes MYL2, DCN, EPS8, and RPL6." J Med Genet. 37(11):884-886. PMID:11185075
  21. [ + ] Lanzetti L, et al. (2000) "The Eps8 protein coordinates EGF receptor signalling through Rac and trafficking through Rab5." Nature. 408(6810):374-377. PMID:11099046
  22. [ + ] Maa MC, et al. (1999) "Enhancement of tyrosyl phosphorylation and protein expression of eps8 by v-Src." Biochim Biophys Acta. 1450(3):341-351. PMID:10395945
  23. [ + ] Inobe M, et al. (1999) "Identification of EPS8 as a Dvl1-associated molecule." Biochem Biophys Res Commun. 266(1):216-221. PMID:10581192
  24. [ + ] Scita G, et al. (1999) "EPS8 and E3B1 transduce signals from Ras to Rac." Nature. 401(6750):290-293. PMID:10499589
  25. [ + ] Kishan KV, et al. (1997) "The SH3 domain of Eps8 exists as a novel intertwined dimer." Nat Struct Biol. 4(9):739-743. PMID:9303002
  26. [ + ] Biesova Z, et al. (1997) "Isolation and characterization of e3B1, an eps8 binding protein that regulates cell growth." Oncogene. 14(2):233-241. PMID:9010225
  27. [ + ] Matoskova B, et al. (1996) "RN-tre specifically binds to the SH3 domain of eps8 with high affinity and confers growth advantage to NIH3T3 upon carboxy-terminal truncation." Oncogene. 12(12):2679-2688. PMID:8700527
  28. [ + ] Matoskova B, et al. (1996) "RN-tre identifies a family of tre-related proteins displaying a novel potential protein binding domain." Oncogene. 12(12):2563-2571. PMID:8700515
  29. [ + ] Castagnino P, et al. (1995) "Direct binding of eps8 to the juxtamembrane domain of EGFR is phosphotyrosine- and SH2-independent." Oncogene. 10(4):723-729. PMID:7532293
  30. [ + ] Matoskova B, et al. (1995) "Constitutive phosphorylation of eps8 in tumor cell lines: relevance to malignant transformation." Mol Cell Biol. 15(7):3805-3812. PMID:7791787
  31. [ + ] Avantaggiato V, et al. (1995) "Expression of the receptor tyrosine kinase substrate genes eps8 and eps15 during mouse development." Oncogene. 11(6):1191-1198. PMID:7566980
  32. [ + ] Karlsson T, et al. (1995) "Molecular interactions of the Src homology 2 domain protein Shb with phosphotyrosine residues, tyrosine kinase receptors and Src homology 3 domain proteins." Oncogene. 10(8):1475-1483. PMID:7537362
  33. [ + ] Wong WT, et al. (1994) "Evolutionary conservation of the EPS8 gene and its mapping to human chromosome 12q23-q24." Oncogene. 9(10):3057-3061. PMID:8084614
  34. [ + ] Fazioli F, et al. (1993) "Eps8, a substrate for the epidermal growth factor receptor kinase, enhances EGF-dependent mitogenic signals." EMBO J. 12(10):3799-3808. PMID:8404850
  35. [ + ] Cardwell C, et al. (1976) "Student or worker? International Meeting of Student Nurses (European Group)." Nurs Mirror Midwives J. 143(19):38. PMID:1049958