EPHB3 | GeneID:2049 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2049 Official Symbol EPHB3
Locus N/A Gene Type protein-coding
Synonyms ETK2; HEK2; TYRO6
Full Name EPH receptor B3
Description EPH receptor B3
Chromosome 3q21-qter
Also Known As EPH-like tyrosine kinase-2; ephrin receptor EphB3; human embryo kinase 2
Summary Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene is a receptor for ephrin-B family members. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 20938

ID Symbol Protein Species
GeneID:2049 EPHB3 NP_004434.2 Homo sapiens
GeneID:13845 Ephb3 NP_034273.1 Mus musculus
GeneID:287989 Ephb3 XP_221311.3 Rattus norvegicus
GeneID:396179 EPHB3 XP_422762.2 Gallus gallus
GeneID:460894 EPHB3 XP_516918.2 Pan troglodytes
GeneID:488108 EPHB3 XP_545232.2 Canis lupus familiaris
GeneID:540907 EPHB3 XP_613645.2 Bos taurus
GeneID:555957 LOC555957 XP_683712.3 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab66337 Eph receptor B3 antibody [4A122D1] (ab66337); Mouse monoclonal [4A122D1] to Eph receptor B3
2 abcam ab54717 Eph receptor B3 antibody (ab54717); Mouse monoclonal to Eph receptor B3
3 abcam ab10617 Eph receptor B3 antibody (ab10617); Goat polyclonal to Eph receptor B3
4 abcam ab7044 Eph receptor B3 antibody (ab7044); Goat polyclonal to Eph receptor B3
5 abgent AM7624a EPHB3 Monoclonal Antibody; Mouse Monoclonal Antibody (Mab)
6 abgent AP7624a EphB3 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
7 acris AP14299PU-N EphB3 (N-term); antibody Ab
8 acris AM11065SU-N EPHB3; antibody Ab
9 scbt EPHB3 EPHB3 Antibody / EPHB3 Antibodies;
10 sigma HPA007698 Anti-EPHB3 antibody produced in rabbit ;
11 sigma HPA008184 Anti-EPHB3 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of EPHB3 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of EPHB3 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0005524 Function ATP binding
GO:0008046 Function axon guidance receptor activity
GO:0005003 Function ephrin receptor activity
GO:0000166 Function nucleotide binding
GO:0004872 Function receptor activity
GO:0016740 Function transferase activity
GO:0021952 Process central nervous system projection neuron axonogenesis
GO:0006468 Process protein amino acid phosphorylation
GO:0031290 Process retinal ganglion cell axon guidance
GO:0007165 Process signal transduction
GO:0007169 Process transmembrane receptor protein tyrosine kinase signaling pathway

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_004443  UCSC Browser NP_004434

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000330394 MI0000064 hsa-let-7c* UAGAGUUACACCCUGGGAGUUA
ENST00000330394 MI0000433 hsa-let-7g* CUGUACAGGCCACUGCCUUGC
ENST00000330394 MI0000810 hsa-miR-135b* AUGUAGGGCUAAAAGCCAUGGG
ENST00000330394 MI0003129 hsa-miR-146b-3p UGCCCUGUGGACUCAGUUCUGG
ENST00000330394 MI0000487 hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU
ENST00000330394 MI0005569 hsa-miR-216b AAAUCUCUGCAGGCAAAUGUGA
ENST00000330394 MI0000105 hsa-miR-29b-1* GCUGGUUUCAUAUGGUGGUUUAGA
ENST00000330394 MI0000804 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENST00000330394 MI0000826 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU
ENST00000330394 MI0000762 hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU
ENST00000330394 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENST00000330394 MI0003126 hsa-miR-491-5p AGUGGGGAACCCUUCCAUGAGG
ENST00000330394 MI0003189 hsa-miR-504 AGACCCUGGUCUGCACUCUAUC
ENST00000330394 MI0003150 hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU
ENST00000330394 MI0003581 hsa-miR-574-3p CACGCUCAUGCACACACCCACA
ENST00000330394 MI0003599 hsa-miR-589* UCAGAACAAAUGCCGGUUCCCAGA
ENST00000330394 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENST00000330394 MI0003608 hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG
ENST00000330394 MI0003657 hsa-miR-642 GUCCCUCUCCAAAUGUGUCUUG
ENST00000330394 MI0003760 hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC
ENST00000330394 MI0005416 hsa-miR-675 UGGUGCGGAGAGGGCCCACAGUG
ENST00000330394 MI0000264 hsa-miR-7-2* CAACAAAUCCCAGUCUACCUAA
ENST00000330394 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENST00000330394 MI0005493 mmu-miR-327 ACUUGAGGGGCAUGAGGAU
ENST00000330394 MI0004601 mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC
ENST00000330394 MI0004658 mmu-miR-690 AAAGGCUAGGCUCACAACCAAA
ENST00000330394 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

BC052968   CB993133   NM_004443   X75208  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.2170C>T1
c.503G>T1
c.1086C>T1
c.741G>A1
Primary Site / Histology (Top 10)Mutations (sites * observations)
lung / carcinoma2
skin / malignant melanoma1
breast / carcinoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of EPHB3 mRNA
17562736
Methylnitronitrosoguanidine
  • Methylnitronitrosoguanidine results in decreased expression of EPHB3 mRNA
12634122
Tretinoin
  • Tretinoin affects the expression of EPHB3 mRNA
16251210

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16166294, 16443354
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 17361223, 17368321, 17301526, 17339181, 17506722, 17217047, 16766008, 17107899, 16788101, 16140955, 16331271, 17294898, 12679006, 15748426, 16823087, 16935935
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Microsatellite Instability inferred via Methylnitronitrosoguanidine 17671175
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 17562736, 17522070, 14986274, 15968718, 16227642, 16177239
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
CRK CRK / EPHB3 Reconstituted Complex Hock B (1998)
EFNB3 EPHB3 / EFNB3 Reconstituted Complex Bergemann AD (1998)
FYN FYN / EPHB3 Reconstituted Complex Hock B (1998)
MLLT4 MLLT4 / EPHB3 Affinity Capture-Western Hock B (1998)
MLLT4 MLLT4 / EPHB3 Reconstituted Complex Hock B (1998)
MLLT4 MLLT4 / EPHB3 Two-hybrid Hock B (1998)
RASA1 EPHB3 / RASA1 Affinity Capture-Western Hock B (1998)
RASA1 RASA1 / EPHB3 Affinity Capture-Western Hock B (1998)
RASA1 RASA1 / EPHB3 Reconstituted Complex Hock B (1998)
RYK RYK / EPHB3 Affinity Capture-Western Trivier E (2002)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Vieira AR, et al. (2008) "Candidate gene/loci studies in cleft lip/palate and dental anomalies finds novel susceptibility genes for clefts." Genet Med. 10(9):668-674. PMID:18978678
  2. [ + ] Miao H, et al. (2005) "Inhibition of integrin-mediated cell adhesion but not directional cell migration requires catalytic activity of EphB3 receptor tyrosine kinase. Role of Rho family small GTPases." J Biol Chem. 280(2):923-932. PMID:15536074
  3. [ + ] Zhang Y, et al. (2005) "Time-resolved mass spectrometry of tyrosine phosphorylation sites in the epidermal growth factor receptor signaling network reveals dynamic modules." Mol Cell Proteomics. 4(9):1240-1250. PMID:15951569
  4. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Trivier E, et al. (2002) "RYK, a catalytically inactive receptor tyrosine kinase, associates with EphB2 and EphB3 but does not interact with AF-6." J Biol Chem. 277(25):23037-23043. PMID:11956217
  7. [ + ] Wilkinson DG, et al. (2001) "Multiple roles of EPH receptors and ephrins in neural development." Nat Rev Neurosci. 2(3):155-164. PMID:11256076
  8. [ + ] Wilkinson DG, et al. (2000) "Eph receptors and ephrins: regulators of guidance and assembly." Int Rev Cytol. 196():177-244. PMID:10730216
  9. [ + ] Xu Q, et al. (2000) "Roles of Eph receptors and ephrins in segmental patterning." Philos Trans R Soc Lond B Biol Sci. 355(1399):993-1002. PMID:11128993
  10. [ + ] Holder N, et al. (1999) "Eph receptors and ephrins: effectors of morphogenesis." Development. 126(10):2033-2044. PMID:10207129
  11. [ + ] Adams RH, et al. (1999) "Roles of ephrinB ligands and EphB receptors in cardiovascular development: demarcation of arterial/venous domains, vascular morphogenesis, and sprouting angiogenesis." Genes Dev. 13(3):295-306. PMID:9990854
  12. [ + ] Hock B, et al. (1998) "Tyrosine-614, the major autophosphorylation site of the receptor tyrosine kinase HEK2, functions as multi-docking site for SH2-domain mediated interactions." Oncogene. 17(2):255-260. PMID:9674711
  13. [ + ] Ciossek T, et al. (1998) "Eph receptor-ligand interactions are necessary for guidance of retinal ganglion cell axons in vitro." Eur J Neurosci. 10(5):1574-1580. PMID:9751130
  14. [ + ] Hock B, et al. (1998) "PDZ-domain-mediated interaction of the Eph-related receptor tyrosine kinase EphB3 and the ras-binding protein AF6 depends on the kinase activity of the receptor." Proc Natl Acad Sci U S A. 95(17):9779-9784. PMID:9707552
  15. [ + ] Bergemann AD, et al. (1998) "Ephrin-B3, a ligand for the receptor EphB3, expressed at the midline of the developing neural tube." Oncogene. 16(4):471-480. PMID:9484836
  16. [ + ] Zhou R, et al. (1998) "The Eph family receptors and ligands." Pharmacol Ther. 77(3):151-181. PMID:9576626
  17. [ + ] Flanagan JG, et al. (1998) "The ephrins and Eph receptors in neural development." Annu Rev Neurosci. 21():309-345. PMID:9530499
  18. [ + ] Bohme B, et al. (1996) "Cell-cell adhesion mediated by binding of membrane-anchored ligand LERK-2 to the EPH-related receptor human embryonal kinase 2 promotes tyrosine kinase activity." J Biol Chem. 271(40):24747-24752. PMID:8798744
  19. [ + ] Bohme B, et al. (1993) "PCR mediated detection of a new human receptor-tyrosine-kinase, HEK 2." Oncogene. 8(10):2857-2862. PMID:8397371