EPHB2 | GeneID:2048 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2048 Official Symbol EPHB2
Locus N/A Gene Type protein-coding
Synonyms CAPB; DRT; EPHT3; ERK; Hek5; MGC87492; PCBC; Tyro5
Full Name EPH receptor B2
Description EPH receptor B2
Chromosome 1p36.1-p35
Also Known As OTTHUMP00000002914; OTTHUMP00000002916; developmentally-regulated eph-related tyrosine kinase; elk-related tyrosine kinase; eph tyrosine kinase 3; ephrin receptor EphB2
Summary Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene is a receptor for ephrin-B family members. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37925

ID Symbol Protein Species
GeneID:2048 EPHB2 NP_004433.2 Homo sapiens
GeneID:13844 Ephb2 NP_034272.1 Mus musculus
GeneID:313633 Ephb2 XP_233574.4 Rattus norvegicus
GeneID:396513 EPHB2 NP_996834.1 Gallus gallus
GeneID:456613 EPHB2 XP_513189.2 Pan troglodytes
GeneID:487380 EPHB2 XP_544506.2 Canis lupus familiaris
GeneID:562176 LOC562176 XP_001920022.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab5425 Eph receptor B2 antibody (ab5425); Rabbit polyclonal to Eph receptor B2
2 abcam ab61765 Eph receptor B1 + Eph receptor B2 antibody (ab61765); Rabbit polyclonal to Eph receptor B1 + Eph receptor B2
3 abcam ab58592 Eph receptor B2 antibody (ab58592); Goat polyclonal to Eph receptor B2
4 abcam ab54650 Eph receptor B2 antibody (ab54650); Mouse monoclonal to Eph receptor B2
5 abcam ab37854 Eph receptor B2 antibody - Carboxyterminal end (ab37854); Rabbit polyclonal to Eph receptor B2 - Carboxyterminal end
6 abcam ab5418 Eph receptor B2 antibody (ab5418); Rabbit polyclonal to Eph receptor B2
7 abcam ab70014 Eph receptor B2 antibody (ab70014); Rabbit polyclonal to Eph receptor B2
8 abcam ab66341 Eph receptor B2 antibody [2D12C6] (ab66341); Mouse monoclonal [2D12C6] to Eph receptor B2
9 abcam ab61791 Eph receptor B1 + Eph receptor B2 (phospho Y594) antibody (ab61791); Rabbit polyclonal to Eph receptor B1 + Eph receptor B2 (phospho Y594)
10 abgent AM7623a EPHB2 Monoclonal Antibody (Ascites); Mouse Monoclonal Antibody (Mab)
11 abgent AM7623b EPHB2 Monoclonal Antibody; Purified Mouse Monoclonal Antibody (Mab)
12 abgent AP7623a EphB2 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
13 abgent AP7623d EphB2 Antibody; Purified Rabbit Polyclonal Antibody (Pab)
14 abgent AP7623b EphB2 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
15 acris AP01166PU-N EphB2; antibody Ab
16 acris AP17001PU-N EPHB2 / DRT / Nuk; antibody Ab
17 acris AP14298PU-N EphB2; antibody Ab
18 acris AP14297PU-N EphB2 (C-term); antibody Ab
19 acris AM11064PU-N EPHB2; antibody Ab
20 acris AP14296PU-N EphB2 (N-term); antibody Ab
21 acris AM11063SU-N EPHB2 Ascites; antibody Ab
22 scbt EPHB2 EPHB2 Antibody / EPHB2 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of EPHB2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of EPHB2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0043025 Component cell soma
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005524 Function ATP binding
GO:0008046 Function axon guidance receptor activity
GO:0000166 Function nucleotide binding
GO:0004872 Function receptor activity
GO:0005102 Function receptor binding
GO:0016740 Function transferase activity
GO:0005005 Function transmembrane-ephrin receptor activity
GO:0048593 Process camera-type eye morphogenesis
GO:0021952 Process central nervous system projection neuron axonogenesis
GO:0007612 Process learning
GO:0050771 Process negative regulation of axonogenesis
GO:0045786 Process negative regulation of cell cycle
GO:0007399 Process nervous system development
GO:0021631 Process optic nerve morphogenesis
GO:0009887 Process organ morphogenesis
GO:0048170 Process positive regulation of long-term neuronal synaptic plasticity
GO:0006468 Process protein amino acid phosphorylation
GO:0048168 Process regulation of neuronal synaptic plasticity
GO:0031290 Process retinal ganglion cell axon guidance
GO:0007169 Process transmembrane receptor protein tyrosine kinase signaling pathway

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_004442  UCSC Browser NP_004433
2 NM_017449  UCSC Browser NP_059145

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000374632 MI0003137 hsa-miR-193b* CGGGGUUUUGAGGGCGAGAUGA
ENST00000374632 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENST00000374632 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AB210018   AF025304   AK298898   AK299701   AL530874   BC007903   BC018763   BC041017   BC067861   BC146296   BQ641281   D14717   D31661   D37827   L36643   L41939   NM_004442   NM_017449  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.2832C>T1
Primary Site / Histology (Top 10)Mutations (sites * observations)
lung / carcinoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Lipopolysaccharides
  • Lipopolysaccharides results in increased expression of EPHB2 mRNA
12057914
tert-Butylhydroperoxide
  • tert-Butylhydroperoxide results in increased expression of EPHB2 mRNA
15336504
Tretinoin
  • Tretinoin affects the expression of EPHB2 mRNA
16251210

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
PROSTATE CANCER/BRAIN CANCER SUSCEPTIBILITY marker
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16166294, 16443354
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 16331271, 17294898, 17361223, 17368321, 17301526, 17339181, 17506722, 17217047, 16766008, 16140955, 12679006, 15748426, 16935935, 17107899, 16788101, 16823087
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Hemolytic-Uremic Syndrome inferred via Lipopolysaccharides 16366002
Inflammation inferred via Lipopolysaccharides 17255318, 17963957
Iron Metabolism Disorders inferred via Lipopolysaccharides 17255318
Respiratory Hypersensitivity inferred via Lipopolysaccharides 10835634

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ABL1 ABL1 / EPHB2 Invivo Yu HH (2001)
ABL1 ABL1 / EPHB2 Two-hybrid Yu HH (2001)
ACP1 EPHB2 / ACP1 Affinity Capture-Western Stein E (1998)
BCL2 EPHB2 / BCL2 Biochemical Activity Tamura Y (2004)
CRK CRK / EPHB2 Reconstituted Complex Zisch AH (2000)
EFNB2 EPHB2 / EFNB2 Reconstituted Complex Himanen JP ()
EPHB2 EPHB2 / EPHB2 Co-crystal Structure Thanos CD (1999)
ITSN1 ITSN1 / EPHB2 Affinity Capture-Western Irie F (2002)
MASK EPHB2 / MASK Phenotypic Enhancement Lin JL (2001)
MLLT4 MLLT4 / EPHB2 Two-hybrid Hock B (1998)
RASA1 EPHB2 / RASA1 Affinity Capture-Western Holland SJ (1997)
RASA1 RASA1 / EPHB2 Reconstituted Complex Holland SJ (1997)
RASA1 RASA1 / EPHB2 Reconstituted Complex Zisch AH (2000)
RYK RYK / EPHB2 Affinity Capture-Western Trivier E (2002)
SRC SRC / EPHB2 Reconstituted Complex Zisch AH (2000)
SRC SRC / EPHB2 Two-hybrid Zisch AH (1998)
SRC EPHB2 / SRC Two-hybrid Zisch AH (2000)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Zogopoulos G, et al. (2008) "Germline EPHB2 receptor variants in familial colorectal cancer." PLoS ONE. 3(8):e2885. PMID:18682749
  2. [ + ] Li Y, et al. (2008) "Neither replication nor simulation supports a role for the axon guidance pathway in the genetics of Parkinson's disease." PLoS ONE. 3(7):e2707. PMID:18628988
  3. [ + ] Pfaff D, et al. (2008) "Involvement of endothelial ephrin-B2 in adhesion and transmigration of EphB-receptor-expressing monocytes." J Cell Sci. 121(Pt 22):3842-3850. PMID:18957513
  4. [ + ] Lin KT, et al. (2008) "Ephrin-B2-induced cleavage of EphB2 receptor is mediated by matrix metalloproteinases to trigger cell repulsion." J Biol Chem. 283(43):28969-28979. PMID:18713744
  5. [ + ] Oshima T, et al. (2008) "Overexpression of EphA4 gene and reduced expression of EphB2 gene correlates with liver metastasis in colorectal cancer." Int J Oncol. 33(3):573-577. PMID:18695888
  6. [ + ] Buffin-Meyer B, et al. (2007) "EGF receptor transactivation and PI3-kinase mediate stimulation of ERK by alpha(2A)-adrenoreceptor in intestinal epithelial cells: a role in wound healing." Eur J Pharmacol. 574(2-3):85-93. PMID:17655843
  7. [ + ] Limbourg A, et al. (2007) "Notch ligand Delta-like 1 is essential for postnatal arteriogenesis." Circ Res. 100(3):363-371. PMID:17234965
  8. [ + ] Davalos V, et al. (2007) "High EPHB2 mutation rate in gastric but not endometrial tumors with microsatellite instability." Oncogene. 26(2):308-311. PMID:16819508
  9. [ + ] Wissing J, et al. (2007) "Proteomics analysis of protein kinases by target class-selective prefractionation and tandem mass spectrometry." Mol Cell Proteomics. 6(3):537-547. PMID:17192257
  10. [ + ] Song JH, et al. (2007) "Genetic and epigenetic analysis of the EPHB2 gene in gastric cancers." APMIS. 115(2):164-168. PMID:17295683
  11. [ + ] Eymin B, et al. (2006) "p14ARF triggers G2 arrest through ERK-mediated Cdc25C phosphorylation, ubiquitination and proteasomal degradation." Cell Cycle. 5(7):759-765. PMID:16582626
  12. [ + ] Moeller ML, et al. (2006) "EphB receptors regulate dendritic spine morphogenesis through the recruitment/phosphorylation of focal adhesion kinase and RhoA activation." J Biol Chem. 281(3):1587-1598. PMID:16298995
  13. [ + ] Guo DL, et al. (2006) "Reduced expression of EphB2 that parallels invasion and metastasis in colorectal tumours." Carcinogenesis. 27(3):454-464. PMID:16272170
  14. [ + ] Kittles RA, et al. (2006) "A common nonsense mutation in EphB2 is associated with prostate cancer risk in African American men with a positive family history." J Med Genet. 43(6):507-511. PMID:16155194
  15. [ + ] Salvucci O, et al. (2006) "EphB2 and EphB4 receptors forward signaling promotes SDF-1-induced endothelial cell chemotaxis and branching remodeling." Blood. 108(9):2914-2922. PMID:16840724
  16. [ + ] Kokko A, et al. (2006) "EPHB2 germline variants in patients with colorectal cancer or hyperplastic polyposis." BMC Cancer. 6():145. PMID:16740153
  17. [ + ] Gregory SG, et al. (2006) "The DNA sequence and biological annotation of human chromosome 1." Nature. 441(7091):315-321. PMID:16710414
  18. [ + ] Koolpe M, et al. (2005) "EphB receptor-binding peptides identified by phage display enable design of an antagonist with ephrin-like affinity." J Biol Chem. 280(17):17301-17311. PMID:15722342
  19. [ + ] Lugli A, et al. (2005) "EphB2 expression across 138 human tumor types in a tissue microarray: high levels of expression in gastrointestinal cancers." Clin Cancer Res. 11(18):6450-6458. PMID:16166419
  20. [ + ] Batlle E, et al. (2005) "EphB receptor activity suppresses colorectal cancer progression." Nature. 435(7045):1126-1130. PMID:15973414
  21. [ + ] Zhang Y, et al. (2005) "Time-resolved mass spectrometry of tyrosine phosphorylation sites in the epidermal growth factor receptor signaling network reveals dynamic modules." Mol Cell Proteomics. 4(9):1240-1250. PMID:15951569
  22. [ + ] Cowan CW, et al. (2005) "Vav family GEFs link activated Ephs to endocytosis and axon guidance." Neuron. 46(2):205-217. PMID:15848800
  23. [ + ] Irie F, et al. (2005) "EphrinB-EphB signalling regulates clathrin-mediated endocytosis through tyrosine phosphorylation of synaptojanin 1." Nat Cell Biol. 7(5):501-509. PMID:15821731
  24. [ + ] Diehl S, et al. (2005) "Altered expression patterns of EphrinB2 and EphB2 in human umbilical vessels and congenital venous malformations." Pediatr Res. 57(4):537-544. PMID:15718372
  25. [ + ] Nakada M, et al. (2004) "The phosphorylation of EphB2 receptor regulates migration and invasion of human glioma cells." Cancer Res. 64(9):3179-3185. PMID:15126357
  26. [ + ] Huusko P, et al. (2004) "Nonsense-mediated decay microarray analysis identifies mutations of EPHB2 in human prostate cancer." Nat Genet. 36(9):979-983. PMID:15300251
  27. [ + ] Tamura Y, et al. (2004) "The phosphorylation status and anti-apoptotic activity of Bcl-2 are regulated by ERK and protein phosphatase 2A on the mitochondria." FEBS Lett. 569(1-3):249-255. PMID:15225643
  28. [ + ] Himanen JP, et al. (2004) "Repelling class discrimination: ephrin-A5 binds to and activates EphB2 receptor signaling." Nat Neurosci. 7(5):501-509. PMID:15107857
  29. [ + ] Monje P, et al. (2003) "Phosphorylation of the carboxyl-terminal transactivation domain of c-Fos by extracellular signal-regulated kinase mediates the transcriptional activation of AP-1 and cellular transformation induced by platelet-derived growth factor." Mol Cell Biol. 23(19):7030-7043. PMID:12972619
  30. [ + ] Penzes P, et al. (2003) "Rapid induction of dendritic spine morphogenesis by trans-synaptic ephrinB-EphB receptor activation of the Rho-GEF kalirin." Neuron. 37(2):263-274. PMID:12546821
  31. [ + ] Takasu MA, et al. (2002) "Modulation of NMDA receptor-dependent calcium influx and gene expression through EphB receptors." Science. 295(5554):491-495. PMID:11799243
  32. [ + ] Kim I, et al. (2002) "EphB ligand, ephrinB2, suppresses the VEGF- and angiopoietin 1-induced Ras/mitogen-activated protein kinase pathway in venous endothelial cells." FASEB J. 16(9):1126-1128. PMID:12039842
  33. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  34. [ + ] Irie F, et al. (2002) "EphB receptors regulate dendritic spine development via intersectin, Cdc42 and N-WASP." Nat Neurosci. 5(11):1117-1118. PMID:12389031
  35. [ + ] Petersen HV, et al. (2002) "Glucose induced MAPK signalling influences NeuroD1-mediated activation and nuclear localization." FEBS Lett. 528(1-3):241-245. PMID:12297313
  36. [ + ] Kataoka H, et al. (2002) "Expression profile of EFNB1, EFNB2, two ligands of EPHB2 in human gastric cancer." J Cancer Res Clin Oncol. 128(7):343-348. PMID:12136247
  37. [ + ] Okuma E, et al. (2002) "Potential roles of extracellular signal-regulated kinase but not p38 during myeloid differentiation of U937 cells stimulated by cytokines: augmentation of differentiation via prolonged activation of extracellular signal-regulated kinase." Exp Hematol. 30(6):571-581. PMID:12063024
  38. [ + ] Diaz-Rodriguez E, et al. (2002) "Extracellular signal-regulated kinase phosphorylates tumor necrosis factor alpha-converting enzyme at threonine 735: a potential role in regulated shedding." Mol Biol Cell. 13(6):2031-2044. PMID:12058067
  39. [ + ] Trivier E, et al. (2002) "RYK, a catalytically inactive receptor tyrosine kinase, associates with EphB2 and EphB3 but does not interact with AF-6." J Biol Chem. 277(25):23037-23043. PMID:11956217
  40. [ + ] Grunwald IC, et al. (2001) "Kinase-independent requirement of EphB2 receptors in hippocampal synaptic plasticity." Neuron. 32(6):1027-1040. PMID:11754835
  41. [ + ] Wilkinson DG, et al. (2001) "Multiple roles of EPH receptors and ephrins in neural development." Nat Rev Neurosci. 2(3):155-164. PMID:11256076
  42. [ + ] Yu HH, et al. (2001) "Multiple signaling interactions of Abl and Arg kinases with the EphB2 receptor." Oncogene. 20(30):3995-4006. PMID:11494128
  43. [ + ] Ethell IM, et al. (2001) "EphB/syndecan-2 signaling in dendritic spine morphogenesis." Neuron. 31(6):1001-1013. PMID:11580899
  44. [ + ] Elowe S, et al. (2001) "Downregulation of the Ras-mitogen-activated protein kinase pathway by the EphB2 receptor tyrosine kinase is required for ephrin-induced neurite retraction." Mol Cell Biol. 21(21):7429-7441. PMID:11585923
  45. [ + ] Lin JL, et al. (2001) "MST4, a new Ste20-related kinase that mediates cell growth and transformation via modulating ERK pathway." Oncogene. 20(45):6559-6569. PMID:11641781
  46. [ + ] Himanen JP, et al. (2001) "Crystal structure of an Eph receptor-ephrin complex." Nature. 414(6866):933-938. PMID:11780069
  47. [ + ] Kim DW, et al. (2000) "Extracellular signal-regulated kinase binds to TFII-I and regulates its activation of the c-fos promoter." Mol Cell Biol. 20(4):1140-1148. PMID:10648599
  48. [ + ] Zisch AH, et al. (2000) "Replacing two conserved tyrosines of the EphB2 receptor with glutamic acid prevents binding of SH2 domains without abrogating kinase activity and biological responses." Oncogene. 19(2):177-187. PMID:10644995
  49. [ + ] Xu Q, et al. (2000) "Roles of Eph receptors and ephrins in segmental patterning." Philos Trans R Soc Lond B Biol Sci. 355(1399):993-1002. PMID:11128993
  50. [ + ] Ducret C, et al. (2000) "The ternary complex factor Net contains two distinct elements that mediate different responses to MAP kinase signalling cascades." Oncogene. 19(44):5063-5072. PMID:11042694