EPHA1 | GeneID:2041 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2041 Official Symbol EPHA1
Locus N/A Gene Type protein-coding
Synonyms EPH; EPHT; EPHT1; MGC163163
Full Name EPH receptor A1
Description EPH receptor A1
Chromosome 7q34
Also Known As eph tyrosine kinase 1; ephrin receptor EphA1; ephrin type-A receptor 1; erythropoietin-producing hepatoma amplified sequence; oncogene EPH; soluble EPHA1 variant 1; soluble EPHA1 variant 2; tyrosine-protein kinase receptor EPH
Summary This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene is expressed in some human cancer cell lines and has been implicated in carcinogenesis. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3835

ID Symbol Protein Species
GeneID:2041 EPHA1 NP_005223.3 Homo sapiens
GeneID:13835 Epha1 NP_076069.2 Mus musculus
GeneID:312279 Epha1 XP_231658.3 Rattus norvegicus
GeneID:378782 EPHA1 NP_989691.1 Gallus gallus
GeneID:463808 EPHA1 XP_519451.2 Pan troglodytes
GeneID:482735 EPHA1 XP_539851.2 Canis lupus familiaris
GeneID:525946 EPHA1 XP_604305.2 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab5385 Eph receptor A1 antibody (ab5385); Rabbit polyclonal to Eph receptor A1
2 abcam ab7036 Eph receptor A1 antibody (ab7036); Goat polyclonal to Eph receptor A1
3 abcam ab65074 Eph receptor A1 antibody (ab65074); Rabbit polyclonal to Eph receptor A1
4 abcam ab37857 Eph receptor A1 antibody - Carboxyterminal end (ab37857); Rabbit polyclonal to Eph receptor A1 - Carboxyterminal end
5 abcam ab36605 Eph receptor A1 antibody [5D2A10] (ab36605); Mouse monoclonal [5D2A10] to Eph receptor A1
6 abcam ab5376 Eph receptor A1 antibody (ab5376); Rabbit polyclonal to Eph receptor A1
7 abgent AP7606a EphA1 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
8 abgent AP7606b EphA1 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
9 scbt EPHA1 EPHA1 Antibody / EPHA1 Antibodies;
10 sigma E6650 Anti-EphA1 antibody produced in goat ;

Exon, Intron and UTRs

Exon, Intron and UTRs of EPHA1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of EPHA1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0005524 Function ATP binding
GO:0005003 Function ephrin receptor activity
GO:0000166 Function nucleotide binding
GO:0004872 Function receptor activity
GO:0016740 Function transferase activity
GO:0006468 Process protein amino acid phosphorylation
GO:0007165 Process signal transduction
GO:0007169 Process transmembrane receptor protein tyrosine kinase signaling pathway

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_005232  UCSC Browser NP_005223

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000275815 MI0000060 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000275815 MI0000061 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000275815 MI0000062 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000275815 MI0000063 hsa-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENST00000275815 MI0000064 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENST00000275815 MI0000065 hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENST00000275815 MI0000066 hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENST00000275815 MI0000067 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000275815 MI0000068 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000275815 MI0000433 hsa-let-7g UGAGGUAGUAGUUUGUACAGUU
ENST00000275815 MI0000434 hsa-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENST00000275815 MI0000108 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000275815 MI0000109 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000275815 MI0000114 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENST00000275815 MI0000473 hsa-miR-129-3p AAGCCCUUACCCCAAAAAGCAU
ENST00000275815 MI0000252 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENST00000275815 MI0000473 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENST00000275815 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000275815 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000275815 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENST00000275815 MI0000458 hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
ENST00000275815 MI0000069 hsa-miR-15a UAGCAGCACAUAAUGGUUUGUG
ENST00000275815 MI0000438 hsa-miR-15b UAGCAGCACAUCAUGGUUUACA
ENST00000275815 MI0000070 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000275815 MI0000115 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000275815 MI0000484 hsa-miR-188-5p CAUCCCUUGCAUGGUGGAGGG
ENST00000275815 MI0000489 hsa-miR-195 UAGCAGCACAGAAAUAUUGGC
ENST00000275815 MI0000242 hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENST00000275815 MI0000281 hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENST00000275815 MI0003130 hsa-miR-202* UUCCUAUGCAUAUACUUCUUUG
ENST00000275815 MI0000284 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENST00000275815 MI0005570 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU
ENST00000275815 MI0000287 hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
ENST00000275815 MI0000082 hsa-miR-25* AGGCGGAGACUUGGGCAAUUG
ENST00000275815 MI0005523 hsa-miR-298 AGCAGAAGCAGGGAGGUUCUCCCA
ENST00000275815 MI0000804 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENST00000275815 MI0003646 hsa-miR-33b* CAGUGCCUCGGCAGUGCAGCCC
ENST00000275815 MI0000805 hsa-miR-342-5p AGGGGUGCUAUCUGUGAUUGA
ENST00000275815 MI0000762 hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU
ENST00000275815 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENST00000275815 MI0001445 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENST00000275815 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENST00000275815 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENST00000275815 MI0003138 hsa-miR-497 CAGCAGCACACUGUGGUUUGU
ENST00000275815 MI0003185 hsa-miR-501-3p AAUGCACCCGGGCAAGGAUUCU
ENST00000275815 MI0003185 hsa-miR-501-5p AAUCCUUUGUCCCUGGGUGAGA
ENST00000275815 MI0003186 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA
ENST00000275815 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENST00000275815 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENST00000275815 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000275815 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000275815 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENST00000275815 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENST00000275815 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000275815 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000275815 MI0003585 hsa-miR-578 CUUCUUGUGCUCUAGGAUUGU
ENST00000275815 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENST00000275815 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENST00000275815 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENST00000275815 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000275815 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENST00000275815 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENST00000275815 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENST00000275815 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENST00000275815 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENST00000275815 MI0005416 hsa-miR-675 UGGUGCGGAGAGGGCCCACAGUG
ENST00000275815 MI0000093 hsa-miR-92a-1* AGGUUGGGAUCGGUUGCAAUGCU
ENST00000275815 MI0003560 hsa-miR-92b* AGGGACGGGACGCGGUGCAGUG
ENST00000275815 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENST00000275815 MI0005768 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG
ENST00000275815 MI0000100 hsa-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENST00000275815 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENST00000275815 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENST00000275815 MI0005494 mmu-miR-343 UCUCCCUUCAUGUGCCCAGA
ENST00000275815 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENST00000275815 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENST00000275815 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENST00000275815 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENST00000275815 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA
ENST00000275815 MI0004675 mmu-miR-695 AGAUUGGGCAUAGGUGACUGAA
ENST00000275815 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA
ENST00000275815 MI0004693 mmu-miR-709 GGAGGCAGAGGCAGGAGGA
ENST00000275815 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENST00000275815 MI0004700 mmu-miR-715 CUCCGUGCACACCCCCGCGUG
ENST00000275815 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA
ENST00000275815 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU
ENST00000275815 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.2107G>A1
Primary Site / Histology (Top 10)Mutations (sites * observations)
breast / carcinoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
2-Acetylaminofluorene
  • 2-Acetylaminofluorene results in increased expression of EPHA1 mRNA
17317680
Acetaminophen
  • Acetaminophen affects the expression of EPHA1 mRNA
17562736
daidzein
  • [Genistein co-treated with daidzein co-treated with glycitein] results in increased expression of EPHA1 mRNA
16963248
Genistein
  • [Genistein co-treated with daidzein co-treated with glycitein] results in increased expression of EPHA1 mRNA
16963248
glycitein
  • [Genistein co-treated with daidzein co-treated with glycitein] results in increased expression of EPHA1 mRNA
16963248
Methylnitronitrosoguanidine
  • Methylnitronitrosoguanidine results in increased expression of EPHA1 mRNA
12634122
sodium arsenite
  • sodium arsenite results in increased expression of EPHA1 mRNA
12760830
Tunicamycin
  • Tunicamycin results in increased expression of EPHA1 mRNA
17127020

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Adrenal Gland Neoplasms inferred via sodium arsenite 15276417
Adrenocortical Adenoma inferred via sodium arsenite 16712894
Carcinoma, Hepatocellular inferred via sodium arsenite 15276417, 16507464
Carcinoma, Squamous Cell inferred via sodium arsenite 18572023
Genital Neoplasms, Female inferred via sodium arsenite 16452187
Hodgkin Disease inferred via sodium arsenite 12676792
Liver Neoplasms inferred via sodium arsenite 15276417, 16712894
Lung Neoplasms inferred via sodium arsenite 15276417, 17077188, 16712894
Melanoma inferred via sodium arsenite 16487513
Neoplasms inferred via sodium arsenite 11559025
Neural Tube Defects inferred via sodium arsenite 12854658
Ovarian Neoplasms inferred via sodium arsenite 15276417
Prostatic Neoplasms inferred via sodium arsenite 16039940
Skin Neoplasms inferred via sodium arsenite 18572023
Spinal Dysraphism inferred via sodium arsenite 12854658
Urinary Bladder Neoplasms inferred via sodium arsenite 11723127, 16452187, 16712894
Uterine Cervical Neoplasms inferred via sodium arsenite 11813266
Vascular Diseases inferred via sodium arsenite 17056641
Microsatellite Instability inferred via Methylnitronitrosoguanidine 17671175
Breast Neoplasms inferred via Genistein 17200150, 16541309, 16873071
Carcinoma, Hepatocellular inferred via Genistein 16924424
Cardiovascular Diseases inferred via Genistein 16332659
Colonic Neoplasms inferred via Genistein 17182828
Diabetes Mellitus, Type 2 inferred via Genistein 16647724
Endometrial Hyperplasia inferred via Genistein 16402032
Glioblastoma inferred via Genistein 16598420
Liver Cirrhosis, Experimental inferred via Genistein 17823541
Mammary Neoplasms, Experimental inferred via Genistein 14578162, 12929590
Myocardial Infarction inferred via Genistein 17141266
Myocardial Reperfusion Injury inferred via Genistein 17141266
Osteoporosis, Postmenopausal inferred via Genistein 16169203
Prostatic Neoplasms inferred via Genistein 16925846, 15256057, 15378649
Cardiovascular Diseases inferred via daidzein 16332659
Diabetes Mellitus, Type 2 inferred via daidzein 16647724
Hypertension inferred via daidzein 17169123
Hepatitis, Toxic inferred via Acetaminophen 2444490, 15968718, 16227642, 16177239, 14986274, 16081117, 17562736, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Adenoma inferred via 2-Acetylaminofluorene 10737359
Carcinoma, Hepatocellular inferred via 2-Acetylaminofluorene 10737359
Liver Neoplasms inferred via 2-Acetylaminofluorene 10737359, 11376686, 10672840, 18001218, 16273603, 14678523
Lung Neoplasms inferred via 2-Acetylaminofluorene 11376686
Urinary Bladder Neoplasms inferred via 2-Acetylaminofluorene 15867355, 15289314

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Herath NI, et al. (2009) "Epigenetic silencing of EphA1 expression in colorectal cancer is correlated with poor survival." Br J Cancer. 100(7):1095-1102. PMID:19277044
  2. [ + ] Yamazaki T, et al. (2009) "EphA1 interacts with integrin-linked kinase and regulates cell morphology and motility." J Cell Sci. 122(Pt 2):243-255. PMID:19118217
  3. [ + ] Dong Y, et al. (2009) "Downregulation of EphA1 in colorectal carcinomas correlates with invasion and metastasis." Mod Pathol. 22(1):151-160. PMID:19011600
  4. [ + ] Jin P, et al. (2008) "Novel splice variants derived from the receptor tyrosine kinase superfamily are potential therapeutics for rheumatoid arthritis." Arthritis Res Ther. 10(4):R73. PMID:18593464
  5. [ + ] Artemenko EO, et al. (2008) "Transmembrane domain of EphA1 receptor forms dimers in membrane-like environment." Biochim Biophys Acta. 1778(10):2361-2367. PMID:18590698
  6. [ + ] Holm R, et al. (2008) "Expressions of EphA2 and EphrinA-1 in early squamous cell cervical carcinomas and their relation to prognosis." Int J Med Sci. 5(3):121-126. PMID:18566674
  7. [ + ] Sharfe N, et al. (2008) "EphA and ephrin-A proteins regulate integrin-mediated T lymphocyte interactions." Mol Immunol. 45(5):1208-1220. PMID:17980912
  8. [ + ] Masuda J, et al. (2008) "Fibronectin type I repeat is a nonactivating ligand for EphA1 and inhibits ATF3-dependent angiogenesis." J Biol Chem. 283(19):13148-13155. PMID:18308734
  9. [ + ] Gobin AM, et al. (2008) "EphrinA I-targeted nanoshells for photothermal ablation of prostate cancer cells." Int J Nanomedicine. 3(3):351-358. PMID:18990944
  10. [ + ] Bocharov EV, et al. (2008) "Spatial structure and pH-dependent conformational diversity of dimeric transmembrane domain of the receptor tyrosine kinase EphA1." J Biol Chem. 283(43):29385-29395. PMID:18728013
  11. [ + ] Herath NI, et al. (2006) "Over-expression of Eph and ephrin genes in advanced ovarian cancer: ephrin gene expression correlates with shortened survival." BMC Cancer. 6():144. PMID:16737551
  12. [ + ] Beausoleil SA, et al. (2006) "A probability-based approach for high-throughput protein phosphorylation analysis and site localization." Nat Biotechnol. 24(10):1285-1292. PMID:16964243
  13. [ + ] Hafner C, et al. (2006) "Expression profile of Eph receptors and ephrin ligands in human skin and downregulation of EphA1 in nonmelanoma skin cancer." Mod Pathol. 19(10):1369-1377. PMID:16862074
  14. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  15. [ + ] Zhang Y, et al. (2005) "Time-resolved mass spectrometry of tyrosine phosphorylation sites in the epidermal growth factor receptor signaling network reveals dynamic modules." Mol Cell Proteomics. 4(9):1240-1250. PMID:15951569
  16. [ + ] Brandenberger R, et al. (2004) "Transcriptome characterization elucidates signaling networks that control human ES cell growth and differentiation." Nat Biotechnol. 22(6):707-716. PMID:15146197
  17. [ + ] Hillier LW, et al. (2003) "The DNA sequence of human chromosome 7." Nature. 424(6945):157-164. PMID:12853948
  18. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  19. [ + ] Coulthard MG, et al. (2001) "Characterization of the Epha1 receptor tyrosine kinase: expression in epithelial tissues." Growth Factors. 18(4):303-317. PMID:11519828
  20. [ + ] Wilkinson DG, et al. (2001) "Multiple roles of EPH receptors and ephrins in neural development." Nat Rev Neurosci. 2(3):155-164. PMID:11256076
  21. [ + ] Wilkinson DG, et al. (2000) "Eph receptors and ephrins: regulators of guidance and assembly." Int Rev Cytol. 196():177-244. PMID:10730216
  22. [ + ] Xu Q, et al. (2000) "Roles of Eph receptors and ephrins in segmental patterning." Philos Trans R Soc Lond B Biol Sci. 355(1399):993-1002. PMID:11128993
  23. [ + ] Owshalimpur D, et al. (1999) "Genomic structure of the EPHA1 receptor tyrosine kinase gene." Mol Cell Probes. 13(3):169-173. PMID:10369740
  24. [ + ] Kalo MS, et al. (1999) "Signal transfer by eph receptors" Cell Tissue Res. 298(1):1-9. PMID:10502115
  25. [ + ] Holder N, et al. (1999) "Eph receptors and ephrins: effectors of morphogenesis." Development. 126(10):2033-2044. PMID:10207129
  26. [ + ] Flanagan JG, et al. (1998) "The ephrins and Eph receptors in neural development." Annu Rev Neurosci. 21():309-345. PMID:9530499
  27. [ + ] Zhou R, et al. (1998) "The Eph family receptors and ligands." Pharmacol Ther. 77(3):151-181. PMID:9576626
  28. [ + ] Gale NW, et al. (1996) "Eph receptors and ligands comprise two major specificity subclasses and are reciprocally compartmentalized during embryogenesis." Neuron. 17(1):9-19. PMID:8755474
  29. [ + ] Hirai H, et al. (1987) "A novel putative tyrosine kinase receptor encoded by the eph gene." Science. 238(4834):1717-1720. PMID:2825356