ENO2 | GeneID:2026 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 2026 Official Symbol ENO2
Locus N/A Gene Type protein-coding
Synonyms NSE
Full Name enolase 2 (gamma, neuronal)
Description enolase 2 (gamma, neuronal)
Chromosome 12p13
Also Known As 2-phospho-D-glycerate hydrolyase; enolase 2; neural enolase; neuron specific gamma enolase; neurone-specific enolase
Summary This gene encodes one of the three enolase isoenzymes found in mammals. This isoenzyme, a homodimer, is found in mature neurons and cells of neuronal origin. A switch from alpha enolase to gamma enolase occurs in neural tissue during development in rats and primates. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 74414

ID Symbol Protein Species
GeneID:2026 ENO2 NP_001966.1 Homo sapiens
GeneID:13807 Eno2 NP_038537.1 Mus musculus
GeneID:24334 Eno2 NP_647541.1 Rattus norvegicus
GeneID:395689 ENO2 NP_990207.1 Gallus gallus
GeneID:402874 eno2 NP_001003848.1 Danio rerio
GeneID:477709 ENO2 XP_534902.2 Canis lupus familiaris
GeneID:526006 ENO2 XP_604365.3 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab24472 NSE antibody [1C1] (HRP) - Neuronal Marker (ab24472); Mouse monoclonal [1C1] to NSE - Neuronal Marker (HRP)
2 abcam ab16873 NSE antibody - Neuronal Marker (ab16873); Rabbit polyclonal to NSE - Neuronal Marker
3 abcam ab834 NSE antibody - Neuronal Marker (ab834); Rabbit polyclonal to NSE - Neuronal Marker
4 abcam ab15488 NSE antibody - Neuronal Marker, prediluted (ab15488); Rabbit polyclonal to NSE - Neuronal Marker, prediluted
5 abcam ab944 NSE antibody - Neuronal Marker, prediluted (ab944); Rabbit polyclonal to NSE - Neuronal Marker, prediluted
6 abcam ab24709 NSE antibody [NSE-P1] (ab24709); Mouse monoclonal [NSE-P1] to NSE
7 abcam ab24711 NSE antibody [NSE-P2] (ab24711); Mouse monoclonal [NSE-P2] to NSE
8 abcam ab21253 NSE antibody [18H2] (ab21253); Mouse monoclonal [18H2] to NSE
9 abcam ab16807 NSE antibody [37E4] (ab16807); Mouse monoclonal [37E4] to NSE
10 abcam ab10169 NSE antibody [5A4] - Neuronal Marker (ab10169); Mouse monoclonal [5A4] to NSE - Neuronal Marker
11 abcam ab10171 NSE antibody [5E2] - Neuronal Marker (ab10171); Mouse monoclonal [5E2] to NSE - Neuronal Marker
12 abcam ab8324 NSE antibody [5G10] - Neuronal Marker (ab8324); Mouse monoclonal [5G10] to NSE - Neuronal Marker
13 abcam ab16808 NSE antibody [85F11] (ab16808); Mouse monoclonal [85F11] to NSE
14 abcam ab14312 NSE antibody (ab14312); Chicken polyclonal to NSE
15 abcam ab15486 NSE antibody (ab15486); Rabbit polyclonal to NSE
16 abcam ab65803 NSE antibody - Carboxyterminal end (ab65803); Rabbit polyclonal to NSE - Carboxyterminal end
17 abcam ab54439 NSE antibody [SPM347], prediluted (ab54439); Mouse monoclonal [SPM347] to NSE, prediluted
18 abcam ab54201 NSE antibody [1C1] (ab54201); Mouse monoclonal [1C1] to NSE
19 abcam ab53485 NSE antibody (ab53485); Chicken polyclonal to NSE
20 abcam ab53025 NSE antibody (ab53025); Rabbit polyclonal to NSE
21 abcam ab39369 NSE antibody (ab39369); Chicken polyclonal to NSE
22 abcam ab64721 NSE antibody (ab64721); Rabbit polyclonal to NSE
23 abgent AP2780a NSE Antibody (Y236); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
24 abgent AP2780b NSE Antibody (Y25); Peptide Affnity Purified Rabbit Polyclonal Antibody (Pab)
25 abgent AP3589a Phospho-NSE-pY236 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
26 acris AP07155PU-N Neuron specific enolase; antibody Ab
27 acris AP12999PU-N Neuron specific enolase pTyr236; antibody Ab
28 acris AM05387PU-N Neuron specific enolase; antibody
29 acris AM00996PU-N Neuron specific enolase; antibody Ab
30 acris AP15678PU-N Neuron specific enolase; antibody Ab
31 acris AM05386PU-N Neuron specific enolase; antibody
32 acris BM151 Neuron specific enolase; antibody Ab
33 acris AP08713SU-N Neuron specific enolase; antibody Ab
34 acris AP15678PU-S Neuron specific enolase; antibody Ab
35 acris BM150 Neuron specific enolase; antibody Ab
36 acris AM00995PU-N Neuron specific enolase; antibody Ab
37 acris AP06253PU-N Neuron specific enolase; antibody Ab
38 acris AM00578PU-N Neuron specific enolase; antibody Ab
39 acris AP12426PU-N Neuron specific enolase Y236; antibody Ab
40 acris DP054 Neuron specific enolase; antibody Ab
41 acris SM1711 Neuron specific enolase; antibody Ab
42 acris BM021 Neuron specific enolase; antibody Ab
43 acris DP054-05 Neuron specific enolase; antibody Ab
44 acris AM00997PU-N Neuron specific enolase; antibody Ab
45 acris AP12427PU-N Neuron specific enolase Y25; antibody Ab
46 acris SM1711T Neuron specific enolase; antibody Ab
47 scbt ENO2 ENO2 Antibody / ENO2 Antibodies;
48 sigma N0649 Anti-Neuronal Specific Enolase antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ENO2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ENO2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005622 Component intracellular
GO:0043204 Component perikaryon
GO:0000015 Component phosphopyruvate hydratase complex
GO:0005886 Component plasma membrane
GO:0016829 Function lyase activity
GO:0000287 Function magnesium ion binding
GO:0004634 Function phosphopyruvate hydratase activity
GO:0006096 Process glycolysis

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001975  UCSC Browser NP_001966 Q6FHV6   P09104  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000229277 MI0000253 hsa-miR-148a* AAAGUUCUGAGACACUCCGACU
ENST00000229277 MI0000285 hsa-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENST00000229277 MI0000294 hsa-miR-218-1* AUGGUUCCGUCAAGCACCAUGG
ENST00000229277 MI0000295 hsa-miR-218-2* CAUGGUUCUGUCAAGCACCGCG
ENST00000229277 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENST00000229277 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENST00000229277 MI0000816 hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU
ENST00000229277 MI0000785 hsa-miR-377* AGAGGUUGCCCUUGGUGAAUUC
ENST00000229277 MI0005531 hsa-miR-450b-3p UUGGGAUCAUUUUGCAUCCAUA
ENST00000229277 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENST00000229277 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENST00000229277 MI0003579 hsa-miR-572 GUCCGCUCGGCGGUGGCCCA
ENST00000229277 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENST00000229277 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENST00000229277 MI0003643 hsa-miR-629* GUUCUCCCAACGUAAGCCCAGC
ENST00000229277 MI0005563 hsa-miR-665 ACCAGGAGGCUGAGGCCCCU
ENST00000229277 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENST00000229277 MI0000391 mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU
ENST00000229277 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENST00000229277 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000229277 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENST00000229277 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENST00000229277 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENST00000229277 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG
ENST00000229277 MI0004685 mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA
ENST00000229277 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC
ENST00000229277 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AK124656   AK290525   AK295220   AK312402   BC002745   BT007383   CR536582   CR607583   DQ893819   EU176168   M22349   M36768   NM_001975   X13120   X14327   Y00691  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Aluminum
  • Aluminum results in decreased activity of ENO2 protein
11860913
bismuth tripotassium dicitrate
  • bismuth tripotassium dicitrate results in increased expression of ENO2 mRNA
15912405
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ENO2 mRNA
17484886
cobaltous chloride
  • cobaltous chloride results in increased expression of ENO2 protein
16772336
Diethylstilbestrol
  • Diethylstilbestrol results in decreased expression of ENO2 mRNA
15159206
Dimethylnitrosamine
  • Dimethylnitrosamine results in increased expression of ENO2 mRNA
17547211
Estradiol
  • Estradiol results in decreased expression of ENO2 mRNA
15159206
Estriol
  • Estriol results in decreased expression of ENO2 mRNA
15159206
Estrone
  • Estrone results in decreased expression of ENO2 mRNA
15159206
Genistein
  • Genistein results in decreased expression of ENO2 mRNA
15159206
grape seed proanthocyanidins
  • grape seed proanthocyanidins affects the expression of ENO2 protein
16414080
Metribolone
  • Metribolone results in decreased expression of ENO2 protein
17152098
N-(4-bromo-2-fluorophenyl)-6-methoxy-7-((1-methylpiperidin-4-yl)methoxy)quinazolin-4-amine
  • N-(4-bromo-2-fluorophenyl)-6-methoxy-7-((1-methylpiperidin-4-yl)methoxy)quinazolin-4-amine results in increased expression of ENO2 mRNA
16052530
nonylphenol
  • nonylphenol results in decreased expression of ENO2 mRNA
15159206
Paraquat
  • Paraquat results in increased expression of ENO2 mRNA alternative form
17064354
Raloxifene
  • Raloxifene affects the expression of ENO2 mRNA
14699072
resveratrol
  • resveratrol results in decreased expression of ENO2 mRNA
15582268
Tretinoin
  • Tretinoin results in increased expression of ENO2 protein
16473924

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16166294, 16443354
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 16823087, 12679006, 17107899, 17217047, 17339181, 17368321, 17294898, 16140955, 16331271, 17361223, 17301526, 17506722, 16766008, 16788101, 16935935, 15748426
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 17534123, 16393696
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 17935668, 17164350, 16490592, 16267019, 17049120
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 16525036, 17125593, 16456233, 16317513, 17015251
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 16731767, 17804756, 17636462, 17718901, 15767336
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 15827377, 17520802, 16317513, 16314181
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Albuminuria inferred via Raloxifene 17308373, 17451421
Alzheimer Disease inferred via Raloxifene 15800139
Brain Injuries inferred via Raloxifene 16580743
Breast Neoplasms inferred via Raloxifene 17242785, 15572757, 17049068, 17595753, 16837676, 17440819, 15775269, 16912660, 17893378, 17952589, 15758505, 17261762
Carcinoma, Transitional Cell inferred via Raloxifene 17572228
Cardiovascular Diseases inferred via Raloxifene 15775269
Cognition Disorders inferred via Raloxifene 15800139
Depressive Disorder, Major inferred via Raloxifene 17474826
Diabetic Nephropathies inferred via Raloxifene 17308373, 17451421, 15920148
Edema inferred via Raloxifene 15860553
Encephalomyelitis, Autoimmune, Experimental inferred via Raloxifene 15845917
Fatty Liver inferred via Raloxifene 17473493
Heart Diseases inferred via Raloxifene 11110106
Hypertension inferred via Raloxifene 15787275, 17577099
Leiomyoma inferred via Raloxifene 16973256
Mixed Tumor, Mullerian inferred via Raloxifene 15863610
Multiple Myeloma inferred via Raloxifene 16497877
Myxoma inferred via Raloxifene 16343187
Osteoporosis inferred via Raloxifene 15775268, 17882678
Osteoporosis, Postmenopausal inferred via Raloxifene 15758505, 15579764, 17893378, 17823083
Prostatic Neoplasms inferred via Raloxifene 16220300, 16536755, 15731164
Purpura inferred via Raloxifene 15770314
Stroke inferred via Raloxifene 16837676
Urinary Bladder Neoplasms inferred via Raloxifene 17572228
Venous Thromboembolism inferred via Raloxifene 16837676
Vulvar Neoplasms inferred via Raloxifene 16343187
Agricultural Workers' Diseases inferred via Paraquat 11874814
Gliosis inferred via Paraquat 11124998
Nerve Degeneration inferred via Paraquat 16893418
Parkinson Disease inferred via Paraquat 12911755, 15824117, 15451049, 16510128, 11124998, 11445065, 16140633, 11181820
Pneumonia inferred via Paraquat 12504350
Pulmonary Fibrosis inferred via Paraquat 16324872, 17997886
Respiratory Distress Syndrome, Adult inferred via Paraquat 11700416
Respiratory Sounds inferred via Paraquat 11874814
Retinal Degeneration inferred via Paraquat 16458197
Thyroid Neoplasms inferred via N-(4-bromo-2-fluorophenyl)-6-methoxy-7-((1-methylpiperidin-4-yl)methoxy)quinazolin-4-amine 16940797
Breast Neoplasms inferred via Genistein 17200150, 16541309, 16873071
Carcinoma, Hepatocellular inferred via Genistein 16924424
Cardiovascular Diseases inferred via Genistein 16332659
Colonic Neoplasms inferred via Genistein 17182828
Diabetes Mellitus, Type 2 inferred via Genistein 16647724
Endometrial Hyperplasia inferred via Genistein 16402032
Glioblastoma inferred via Genistein 16598420
Liver Cirrhosis, Experimental inferred via Genistein 17823541
Mammary Neoplasms, Experimental inferred via Genistein 14578162, 12929590
Myocardial Infarction inferred via Genistein 17141266
Myocardial Reperfusion Injury inferred via Genistein 17141266
Osteoporosis, Postmenopausal inferred via Genistein 16169203
Prostatic Neoplasms inferred via Genistein 16925846, 15378649, 15256057
Kidney Neoplasms inferred via Estrone 15610895
Endometrial Hyperplasia inferred via Estriol 16402032
Breast Neoplasms inferred via Estradiol 17289903, 12948864, 17261762, 14630087, 17018787, 18497071
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 11807958, 11408345, 16891317
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Adenocarcinoma inferred via Dimethylnitrosamine 16033868
Carcinoma, Squamous Cell inferred via Dimethylnitrosamine 16033868
Esophageal Neoplasms inferred via Dimethylnitrosamine 17016578
Liver Cirrhosis, Experimental inferred via Dimethylnitrosamine 17203207, 17036385, 18095165, 14568256, 15383259, 15479170, 16169303, 14643895, 18567088, 15798949, 15571005, 15161499, 12918455, 15298665, 16042886, 15793283, 18371158, 12925901, 15366600, 17348192, 17201889, 18237412, 17719030, 15081153, 18364076, 15369754, 15099470, 14709902, 15577212, 15504291, 17666798, 15138612, 16603200, 17724770, 15723089, 14726149, 16627068, 15942678, 15744066, 15591649, 18239293, 16270385, 17881167, 15492853, 18629640, 15864749, 15763062, 16544323, 15842777, 17432682, 17198567, 15086199, 15733078, 16009107, 18637143, 18672772, 15067225, 17640959, 15339415, 17196135, 14659978, 16570917, 17465448, 18210741, 17534399
Liver Failure, Acute inferred via Dimethylnitrosamine 17457977
Liver Neoplasms inferred via Dimethylnitrosamine 3113478, 15890375
Liver Neoplasms, Experimental inferred via Dimethylnitrosamine 15603536
Lung Neoplasms inferred via Dimethylnitrosamine 16061637
Stomach Neoplasms inferred via Dimethylnitrosamine 16033868
Amyloidosis inferred via Diethylstilbestrol 15469931
Breast Neoplasms inferred via Diethylstilbestrol 15324884, 17129689
Carcinoma, Hepatocellular inferred via Diethylstilbestrol 16924424, 15948411
Cryptorchidism inferred via Diethylstilbestrol 12952375, 16002989
Endometrial Hyperplasia inferred via Diethylstilbestrol 16402032
Endometrial Neoplasms inferred via Diethylstilbestrol 15700306, 16804899
Female Urogenital Diseases inferred via Diethylstilbestrol 16513791, 16002989, 16611131, 15751030, 16534752
Genital Neoplasms, Female inferred via Diethylstilbestrol 16452187
Hyperplasia inferred via Diethylstilbestrol 12960047, 14722030
Hypospadias inferred via Diethylstilbestrol 16002989
Infertility inferred via Diethylstilbestrol 15036965
Kidney Neoplasms inferred via Diethylstilbestrol 15003126, 14681315, 16762066
Liver Neoplasms inferred via Diethylstilbestrol 16712894, 15890375
Lupus Nephritis inferred via Diethylstilbestrol 15166399
Lymphoma inferred via Diethylstilbestrol 15700306
Male Urogenital Diseases inferred via Diethylstilbestrol 16002989
Neoplasms inferred via Diethylstilbestrol 15313581
Pituitary Diseases inferred via Diethylstilbestrol 14722030
Pituitary Neoplasms inferred via Diethylstilbestrol 15687265, 16977796
Prostatic Neoplasms inferred via Diethylstilbestrol 15846301, 17136230, 15046698
Spermatocele inferred via Diethylstilbestrol 16709447, 16002989
Urinary Bladder Neoplasms inferred via Diethylstilbestrol 16712894, 16452187
Uterine Cervical Neoplasms inferred via Diethylstilbestrol 16175088
Uterine Diseases inferred via Diethylstilbestrol 14652134
Uterine Neoplasms inferred via Diethylstilbestrol 15809267, 16690809
Vaginal Neoplasms inferred via Diethylstilbestrol 16513791, 16002989
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 15673190, 10355542, 16011737, 16097048, 16050911, 15700767, 16124888, 16227642
Fatty Liver inferred via Carbon Tetrachloride 16045604, 15959796, 12795759, 12631006, 17595544, 16239168, 61145
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 11566570, 16227642, 15968718, 15998439, 16177239, 15027814
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 17334410, 16239168
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 16248980, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 16638106, 18395095, 18156304, 17976157, 17557913, 17805973, 17525996, 16116963, 15925388
Liver Diseases inferred via Carbon Tetrachloride 16246199, 16964402, 17285989, 15830285, 15720792
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Alzheimer Disease inferred via Aluminum 10721010
Inflammation inferred via Aluminum 16052892
Lung Diseases inferred via Aluminum 16052892
Multiple Sclerosis, Chronic Progressive inferred via Aluminum 17086897
Multiple Sclerosis, Relapsing-Remitting inferred via Aluminum 17086897

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ANXA11 ENO2 / ANXA11 Two-hybrid Stelzl U (2005)
C16orf45 C16orf45 / ENO2 Two-hybrid Stelzl U (2005)
C6orf47 ENO2 / C6orf47 Two-hybrid Stelzl U (2005)
ENSA ENO2 / ENSA Two-hybrid Stelzl U (2005)
HABP4 ENO2 / HABP4 Two-hybrid Stelzl U (2005)
HK1 ENO2 / HK1 Two-hybrid Stelzl U (2005)
HSF1 ENO2 / HSF1 Two-hybrid Stelzl U (2005)
IL17B ENO2 / IL17B Two-hybrid Stelzl U (2005)
MAP4 ENO2 / MAP4 Two-hybrid Stelzl U (2005)
NAT9 ENO2 / NAT9 Two-hybrid Stelzl U (2005)
NDUFS7 ENO2 / NDUFS7 Two-hybrid Stelzl U (2005)
RNUT1 RNUT1 / ENO2 Two-hybrid Stelzl U (2005)
SIGIRR ENO2 / SIGIRR Two-hybrid Stelzl U (2005)
ST3GAL2 ENO2 / ST3GAL2 Two-hybrid Stelzl U (2005)
TUBA1 ENO2 / TUBA1 Two-hybrid Stelzl U (2005)
UBE2C ENO2 / UBE2C Two-hybrid Stelzl U (2005)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Chiaretti A, et al. (2009) "NGF, DCX, and NSE upregulation correlates with severity and outcome of head trauma in children." Neurology. 72(7):609-616. PMID:19221293
  2. [ + ] Teepker M, et al. (2009) "Serum concentrations of s100b and NSE in migraine." Headache. 49(2):245-252. PMID:18783450
  3. [ + ] Enjuanes A, et al. (2008) "Genetic variants in apoptosis and immunoregulation-related genes are associated with risk of chronic lymphocytic leukemia." Cancer Res. 68(24):10178-10186. PMID:19074885
  4. [ + ] Bjerner J, et al. (2008) "Reference intervals for carcinoembryonic antigen (CEA), CA125, MUC1, Alfa-foeto-protein (AFP), neuron-specific enolase (NSE) and CA19.9 from the NORIP study." Scand J Clin Lab Invest. 68(8):703-713. PMID:18609108
  5. [ + ] Olsen L, et al. (2008) "The estrogen hypothesis of schizophrenia implicates glucose metabolism: association study in three independent samples." BMC Med Genet. 9():39. PMID:18460190
  6. [ + ] Forooghian F, et al. (2007) "Enolase and arrestin are novel nonmyelin autoantigens in multiple sclerosis." J Clin Immunol. 27(4):388-396. PMID:17436063
  7. [ + ] Kotaska K, et al. (2007) "Anti-vimentin antibodies and neuron-specific enolase in children with neurofibromatosis type-1." Neuro Endocrinol Lett. 28(6):761-764. PMID:18063947
  8. [ + ] Qin J, et al. (2006) "Fluoride inhibition of enolase: crystal structure and thermodynamics." Biochemistry. 45(3):793-800. PMID:16411755
  9. [ + ] Rech TH, et al. (2006) "Serum neuron-specific enolase as early predictor of outcome after in-hospital cardiac arrest: a cohort study." Crit Care. 10(5):R133. PMID:16978415
  10. [ + ] Rush J, et al. (2005) "Immunoaffinity profiling of tyrosine phosphorylation in cancer cells." Nat Biotechnol. 23(1):94-101. PMID:15592455
  11. [ + ] Guo D, et al. (2005) "Proteomic analysis of SUMO4 substrates in HEK293 cells under serum starvation-induced stress." Biochem Biophys Res Commun. 337(4):1308-1318. PMID:16236267
  12. [ + ] Stelzl U, et al. (2005) "A human protein-protein interaction network: a resource for annotating the proteome." Cell. 122(6):957-968. PMID:16169070
  13. [ + ] Pelinka LE, et al. (2005) "Nonspecific increase of systemic neuron-specific enolase after trauma: clinical and experimental findings." Shock. 24(2):119-123. PMID:16044081
  14. [ + ] Zhang Y, et al. (2005) "Time-resolved mass spectrometry of tyrosine phosphorylation sites in the epidermal growth factor receptor signaling network reveals dynamic modules." Mol Cell Proteomics. 4(9):1240-1250. PMID:15951569
  15. [ + ] Chai G, et al. (2004) "Expression, purification and the 1.8 angstroms resolution crystal structure of human neuron specific enolase." J Mol Biol. 341(4):1015-1021. PMID:15289101
  16. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  17. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  18. [ + ] Tiainen M, et al. (2003) "Serum neuron-specific enolase and S-100B protein in cardiac arrest patients treated with hypothermia." Stroke. 34(12):2881-2886. PMID:14631087
  19. [ + ] Rodriguez-Nunez A, et al. (2003) "Neuron-specific enolase, nucleotides, nucleosides, purine bases, oxypurines and uric acid concentrations in cerebrospinal fluid of children with meningitis." Brain Dev. 25(2):102-106. PMID:12581805
  20. [ + ] Muley T, et al. (2003) "Technical performance and diagnostic utility of the new Elecsys neuron-specific enolase enzyme immunoassay." Clin Chem Lab Med. 41(1):95-103. PMID:12636057
  21. [ + ] Lau L, et al. (2002) "Neuroblastoma: a single institution's experience with 128 children and an evaluation of clinical and biological prognostic factors." Pediatr Hematol Oncol. 19(2):79-89. PMID:11881792
  22. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  23. [ + ] Fujiwara H, et al. (2002) "Clinical significance of serum neuron-specific enolase in patients with adult T-cell leukemia." Am J Hematol. 71(2):80-84. PMID:12353304
  24. [ + ] Nakatsuka S, et al. (2002) "Enhanced expression of neuron-specific enolase (NSE) in pyothorax-associated lymphoma (PAL)." Jpn J Cancer Res. 93(4):411-416. PMID:11985791
  25. [ + ] Chekhonin VP, et al. (2002) "Serum time course of two brain-specific proteins, alpha(1) brain globulin and neuron-specific enolase, in tick-born encephalitis and Lyme disease." Clin Chim Acta. 320(1-2):117-125. PMID:11983209
  26. [ + ] O'Dwyer DT, et al. (2002) "Pituitary autoantibodies in lymphocytic hypophysitis target both gamma- and alpha-Enolase - a link with pregnancy?" Arch Physiol Biochem. 110(1-2):94-98. PMID:11935405
  27. [ + ] Wijnberger LD, et al. (2002) "Expression in the placenta of neuronal markers for perinatal brain damage." Pediatr Res. 51(4):492-496. PMID:11919335
  28. [ + ] Ansari-Lari MA, et al. (1997) "Large-scale sequencing in human chromosome 12p13: experimental and computational gene structure determination." Genome Res. 7(3):268-280. PMID:9074930
  29. [ + ] Angelov DN, et al. (1994) "Axotomy induces intranuclear immunolocalization of neuron-specific enolase in facial and hypoglossal neurons of the rat." J Neurocytol. 23(4):218-233. PMID:8035205
  30. [ + ] Pechumer H, et al. (1993) "Detection of neuron-specific gamma-enolase messenger ribonucleic acid in normal human leukocytes by polymerase chain reaction amplification with nested primers." Lab Invest. 69(6):743-749. PMID:8264236
  31. [ + ] Quan CP, et al. (1993) "Purification and partial amino acid sequence of suppressive lymphokine from a CD8+ CD57+ human T hybridoma." Immunology. 78(2):205-209. PMID:7682534
  32. [ + ] Oliva D, et al. (1991) "Complete structure of the human gene encoding neuron-specific enolase." Genomics. 10(1):157-165. PMID:2045099
  33. [ + ] Craig SP, et al. (1990) "Localisation of neurone-specific enolase (ENO2) to 12p13." Cytogenet Cell Genet. 54(1-2):71-73. PMID:2249478
  34. [ + ] Oliva D, et al. (1989) "Cloning, expression and sequence homologies of cDNA for human gamma enolase." Gene. 79(2):355-360. PMID:2792767
  35. [ + ] Van Obberghen E, et al. (1988) "Human gamma enolase: isolation of a cDNA clone and expression in normal and tumor tissues of human origin." J Neurosci Res. 19(4):450-456. PMID:3385803
  36. [ + ] McAleese SM, et al. (1988) "Complete amino acid sequence of the neurone-specific gamma isozyme of enolase (NSE) from human brain and comparison with the non-neuronal alpha form (NNE)." Eur J Biochem. 178(2):413-417. PMID:3208766
  37. [ + ] Day IN, et al. (1987) "Sequence conservation in the 3'-untranslated regions of neurone-specific enolase, lymphokine and protooncogene mRNAs." FEBS Lett. 222(1):139-143. PMID:3653393
  38. [ + ] Haimoto H, et al. (1985) "Immunohistochemical localization of gamma-enolase in normal human tissues other than nervous and neuroendocrine tissues." Lab Invest. 52(3):257-263. PMID:3974199