ABCA2 | GeneID:20 | Homo sapiens
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 20 | Official Symbol | ABCA2 |
|---|---|---|---|
| Locus | RP11-229P13.8 | Gene Type | protein-coding |
| Synonyms | ABC2; MGC129761 | ||
| Full Name | ATP-binding cassette, sub-family A (ABC1), member 2 | ||
| Description | ATP-binding cassette, sub-family A (ABC1), member 2 | ||
| Chromosome | 9q34 | ||
| Also Known As | ATP-binding cassette, sub-family A, member 2; OTTHUMP00000064733 | ||
| Summary | The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is highly expressed in brain tissue and may play a role in macrophage lipid metabolism and neural development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 55590
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:20 | ABCA2 | NP_001597.2 | Homo sapiens |
| GeneID:11305 | Abca2 | NP_031405.2 | Mus musculus |
| GeneID:79248 | Abca2 | NP_077372.1 | Rattus norvegicus |
| GeneID:480669 | ABCA2 | XP_537788.2 | Canis lupus familiaris |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | scbt | ABCA2 | ABCA2 Antibody / ABCA2 Antibodies; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0043190 | Component | ATP-binding cassette (ABC) transporter complex |
| GO:0016023 | Component | cytoplasmic membrane-bounded vesicle |
| GO:0016021 | Component | integral to membrane |
| GO:0005765 | Component | lysosomal membrane |
| GO:0016020 | Component | membrane |
| GO:0005815 | Component | microtubule organizing center |
| GO:0016887 | Function | ATPase activity |
| GO:0042626 | Function | ATPase activity, coupled to transmembrane movement of substances |
| GO:0005524 | Function | ATP binding |
| GO:0000166 | Function | nucleotide binding |
| GO:0042632 | Process | cholesterol homeostasis |
| GO:0006629 | Process | lipid metabolic process |
| GO:0032383 | Process | regulation of intracellular cholesterol transport |
| GO:0006357 | Process | regulation of transcription from RNA polymerase II promoter |
| GO:0042493 | Process | response to drug |
| GO:0048545 | Process | response to steroid hormone stimulus |
| GO:0006810 | Process | transport |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENST00000355090 | MI0000066 | hsa-let-7e* | CUAUACGGCCUCCUAGCUUUCC |
| ENST00000355090 | MI0000433 | hsa-let-7g* | CUGUACAGGCCACUGCCUUGC |
| ENST00000355090 | MI0000446 | hsa-miR-125b-1* | ACGGGUUAGGCUCUUGGGAGCU |
| ENST00000355090 | MI0000450 | hsa-miR-133a | UUUGGUCCCCUUCAACCAGCUG |
| ENST00000355090 | MI0000451 | hsa-miR-133a | UUUGGUCCCCUUCAACCAGCUG |
| ENST00000355090 | MI0000822 | hsa-miR-133b | UUUGGUCCCCUUCAACCAGCUA |
| ENST00000355090 | MI0000456 | hsa-miR-140-3p | UACCACAGGGUAGAACCACGG |
| ENST00000355090 | MI0000478 | hsa-miR-149 | UCUGGCUCCGUGUCUUCACUCCC |
| ENST00000355090 | MI0000482 | hsa-miR-185 | UGGAGAGAAAGGCAGUUCCUGA |
| ENST00000355090 | MI0000234 | hsa-miR-192 | CUGACCUAUGAAUUGACAGCC |
| ENST00000355090 | MI0000298 | hsa-miR-221* | ACCUGGCAUACAAUGUAGAUUU |
| ENST00000355090 | MI0000080 | hsa-miR-24 | UGGCUCAGUUCAGCAGGAACAG |
| ENST00000355090 | MI0000081 | hsa-miR-24 | UGGCUCAGUUCAGCAGGAACAG |
| ENST00000355090 | MI0000807 | hsa-miR-323-5p | AGGUGGUCCGUGGCGCGUUCGC |
| ENST00000355090 | MI0003646 | hsa-miR-33b* | CAGUGCCUCGGCAGUGCAGCCC |
| ENST00000355090 | MI0000268 | hsa-miR-34a | UGGCAGUGUCUUAGCUGGUUGU |
| ENST00000355090 | MI0001648 | hsa-miR-449a | UGGCAGUGUAUUGUUAGCUGGU |
| ENST00000355090 | MI0003673 | hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC |
| ENST00000355090 | MI0003135 | hsa-miR-495 | AAACAAACAUGGUGCACUUCUU |
| ENST00000355090 | MI0003579 | hsa-miR-572 | GUCCGCUCGGCGGUGGCCCA |
| ENST00000355090 | MI0003637 | hsa-miR-623 | AUCCCUUGCAGGGGCUGUUGGGU |
| ENST00000355090 | MI0003645 | hsa-miR-631 | AGACCUGGCCCAGACCUCAGC |
| ENST00000355090 | MI0003650 | hsa-miR-635 | ACUUGGGCACUGAAACAAUGUCC |
| ENST00000355090 | MI0003652 | hsa-miR-637 | ACUGGGGGCUUUCGGGCUCUGCGU |
| ENST00000355090 | MI0003672 | hsa-miR-663 | AGGCGGGGCGCCGCGGGACCGC |
| ENST00000355090 | MI0003760 | hsa-miR-671-3p | UCCGGUUCUCAGGGCUCCACC |
| ENST00000355090 | MI0000263 | hsa-miR-7-1* | CAACAAAUCACAGUCUGCCAUA |
| ENST00000355090 | MI0005559 | hsa-miR-744 | UGCGGGGCUAGGGCUAACAGCA |
| ENST00000355090 | MI0005567 | hsa-miR-760 | CGGCUCUGGGUCUGUGGGGA |
| ENST00000355090 | MI0005527 | hsa-miR-886-5p | CGGGUCGGAGUUAGCUCAAGCGG |
| ENST00000355090 | MI0005763 | hsa-miR-941 | CACCCGGCUGUGUGCACAUGUGC |
| ENST00000355090 | MI0005764 | hsa-miR-941 | CACCCGGCUGUGUGCACAUGUGC |
| ENST00000355090 | MI0005765 | hsa-miR-941 | CACCCGGCUGUGUGCACAUGUGC |
| ENST00000355090 | MI0005766 | hsa-miR-941 | CACCCGGCUGUGUGCACAUGUGC |
| ENST00000355090 | MI0005767 | hsa-miR-942 | UCUUCUCUGUUUUGGCCAUGUG |
| ENST00000355090 | MI0001526 | mmu-miR-434-3p | UUUGAACCAUCACUCGACUCCU |
| ENST00000355090 | MI0004196 | mmu-miR-667 | UGACACCUGCCACCCAGCCCAAG |
| ENST00000355090 | MI0004707 | mmu-miR-718 | CUUCCGCCCGGCCGGGUGUCG |
| ENST00000355090 | MI0004516 | mmu-miR-763 | CCAGCUGGGAAGAACCAGUGGC |
| ENST00000355090 | MI0005472 | mmu-miR-879 | AGAGGCUUAUAGCUCUAAGCC |
| ENST00000371605 | MI0000266 | hsa-miR-10a | UACCCUGUAGAUCCGAAUUUGUG |
| ENST00000371605 | MI0005529 | hsa-miR-220b | CCACCACCGUGUCUGACACUU |
| ENST00000371605 | MI0000084 | hsa-miR-26b* | CCUGUUCUCCAUUACUUGGCUC |
| ENST00000371605 | MI0000812 | hsa-miR-331-3p | GCCCCUGGGCCUAUCCUAGAA |
| ENST00000371605 | MI0003617 | hsa-miR-604 | AGGCUGCGGAAUUCAGGAC |
| ENST00000371605 | MI0003625 | hsa-miR-612 | GCUGGGCAGGGCUUCUGAGCUCCUU |
| ENST00000371605 | MI0003662 | hsa-miR-647 | GUGGCUGCACUCACUUCCUUC |
| ENST00000371605 | MI0004700 | mmu-miR-715 | CUCCGUGCACACCCCCGCGUG |
Chemicals and Drugs
[
] Comparative Toxicogenomics Database from MDI Biological Lab
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Chemical and Interaction | |
|---|---|
| nitrosobenzylmethylamine | |
|
|
Gene and Diseases
[
] Gene and Diseases [Data source: CTD]
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046 - [
] Minster RL, et al. (2008) "No association of DAPK1 and ABCA2 SNPs on chromosome 9 with Alzheimer's disease." Neurobiol Aging. ():. PMID:18336955 - [
] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560 - [
] Wollmer MA, et al. (2006) "Ethnicity-dependent genetic association of ABCA2 with sporadic Alzheimer's disease." Am J Med Genet B Neuropsychiatr Genet. 141B(5):534-536. PMID:16752360 - [
] Olsen JV, et al. (2006) "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell. 127(3):635-648. PMID:17081983 - [
] Mace S, et al. (2005) "ABCA2 is a strong genetic risk factor for early-onset Alzheimer's disease." Neurobiol Dis. 18(1):119-125. PMID:15649702 - [
] Wang Y, et al. (2005) "Expression of ABCA2 protein in human vestibular schwannoma and peripheral nerve." J Neurol Sci. 232(1-2):59-63. PMID:15850583 - [
] Beljanski V, et al. (2005) "Characterization of the ATPase activity of human ATP-binding cassette transporter-2 (ABCA2)." In Vivo. 19(4):657-660. PMID:15999530 - [
] Ile KE, et al. (2004) "Identification of a novel first exon of the human ABCA2 transporter gene encoding a unique N-terminus." Biochim Biophys Acta. 1678(1):22-32. PMID:15093135 - [
] Chen ZJ, et al. (2004) "Association of ABCA2 expression with determinants of Alzheimer's disease." FASEB J. 18(10):1129-1131. PMID:15155565 - [
] Davis W Jr, et al. (2004) "Human ATP-binding cassette transporter-2 (ABCA2) positively regulates low-density lipoprotein receptor expression and negatively regulates cholesterol esterification in Chinese hamster ovary cells." Biochim Biophys Acta. 1683(1-3):89-100. PMID:15238223 - [
] Homma K, et al. (2004) "Alternative splice variants encoding unstable protein domains exist in the human brain." J Mol Biol. 343(5):1207-1220. PMID:15491607 - [
] Davis W Jr, et al. (2003) "Reciprocal regulation of expression of the human adenosine 5'-triphosphate binding cassette, sub-family A, transporter 2 (ABCA2) promoter by the early growth response-1 (EGR-1) and Sp-family transcription factors." Nucleic Acids Res. 31(3):1097-1107. PMID:12560508 - [
] Wistow G, et al. (2002) "Expressed sequence tag analysis of adult human lens for the NEIBank Project: over 2000 non-redundant transcripts, novel genes and splice variants." Mol Vis. 8():171-184. PMID:12107413 - [
] Schmitz G, et al. (2002) "ABCA2: a candidate regulator of neural transmembrane lipid transport." Cell Mol Life Sci. 59(8):1285-1295. PMID:12363033 - [
] Nakayama M, et al. (2002) "Protein-protein interactions between large proteins: two-hybrid screening using a functionally classified library composed of long cDNAs." Genome Res. 12(11):1773-1784. PMID:12421765 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Kaminski WE, et al. (2001) "Complete coding sequence, promoter region, and genomic structure of the human ABCA2 gene and evidence for sterol-dependent regulation in macrophages." Biochem Biophys Res Commun. 281(1):249-258. PMID:11178988 - [
] Vulevic B, et al. (2001) "Cloning and characterization of human adenosine 5'-triphosphate-binding cassette, sub-family A, transporter 2 (ABCA2)." Cancer Res. 61(8):3339-3347. PMID:11309290 - [
] Klucken J, et al. (2000) "ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport." Proc Natl Acad Sci U S A. 97(2):817-822. PMID:10639163 - [
] Zhao LX, et al. (2000) "Cloning, characterization and tissue distribution of the rat ATP-binding cassette (ABC) transporter ABC2/ABCA2." Biochem J. 350 Pt 3():865-872. PMID:10970803 - [
] Kikuno R, et al. (1999) "Prediction of the coding sequences of unidentified human genes. XIV. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro." DNA Res. 6(3):197-205. PMID:10470851 - [
] Allikmets R, et al. (1995) "Characterization and mapping of three new mammalian ATP-binding transporter genes from an EST database." Mamm Genome. 6(2):114-117. PMID:7766993 - [
] Luciani MF, et al. (1994) "Cloning of two novel ABC transporters mapping on human chromosome 9." Genomics. 21(1):150-159. PMID:8088782 - [
] Adams MD, et al. (1992) "Sequence identification of 2,375 human brain genes." Nature. 355(6361):632-634. PMID:1538749
With dense single-nucleotide polymorphism (SNP) maps for 199 drug-related genes, we examined associations between 4190 SNPs and 38 commonly measured quantitative traits using data from 752 healthy Japanese subjects. On analysis, we observed a strong association between five SNPs within the uridine diphosphate glucuronosyltransferase 1A1 (UGT1A1) gene and serum total bilirubin levels (minimum P-value in Mann-Whitney test=1.82 x 10(10)). UGT1A1 catalyzes the conjugation of bilirubin with glucuronic acid, thus enhancing bilirubin elimination. This enzyme is known to play an important role in the variation of serum bilirubin levels. The five SNPs, including a nonsynonymous SNP-rs4148323 (211G>A or G71R variant allele known as UGT1A1*6)-showed strong linkage disequilibrium with each other. No other genes were clearly associated with serum total bilirubin levels. Results of linear multiple regression analysis on serum total bilirubin levels followed by analysis of variance showed that at least 13% of the variance in serum total bilirubin levels could be explained by three haplotype-tagging SNPs in the UGT1A1 gene.Journal of Human Genetics (2009) 54, 317-323; doi:10.1038/jhg.2009.31; published online 3 April 2009.
Recently genetic variation in the DAPK1 and ABCA2 genes has been reported to be associated with late- and early-onset Alzheimer's disease (AD), respectively. We examined the most significant two single-nucleotide polymorphisms (SNPs) in DAPK1 in a large case-control cohort of late-onset subjects and matched controls and one of the most significant SNPs in ABCA2 in a small set of early-onset subjects as well. We did not detect associations with AD for any variation.
By analyzing 1,780,295 5'-end sequences of human full-length cDNAs derived from 164 kinds of oligo-cap cDNA libraries, we identified 269,774 independent positions of transcriptional start sites (TSSs) for 14,628 human RefSeq genes. These TSSs were clustered into 30,964 clusters that were separated from each other by more than 500 bp and thus are very likely to constitute mutually distinct alternative promoters. To our surprise, at least 7674 (52%) human RefSeq genes were subject to regulation by putative alternative promoters (PAPs). On average, there were 3.1 PAPs per gene, with the composition of one CpG-island-containing promoter per 2.6 CpG-less promoters. In 17% of the PAP-containing loci, tissue-specific use of the PAPs was observed. The richest tissue sources of the tissue-specific PAPs were testis and brain. It was also intriguing that the PAP-containing promoters were enriched in the genes encoding signal transduction-related proteins and were rarer in the genes encoding extracellular proteins, possibly reflecting the varied functional requirement for and the restricted expression of those categories of genes, respectively. The patterns of the first exons were highly diverse as well. On average, there were 7.7 different splicing types of first exons per locus partly produced by the PAPs, suggesting that a wide variety of transcripts can be achieved by this mechanism. Our findings suggest that use of alternate promoters and consequent alternative use of first exons should play a pivotal role in generating the complexity required for the highly elaborated molecular systems in humans.
A recent study demonstrated a significant genetic association between the ATP-binding cassette transporter A2 (ABCA2) and the risk for Alzheimer's disease (AD) in a large Caucasian sample. The rare T allele of the synonymous exonic single nucleotide polymorphism (SNP) rs908832 was overrepresented in early-onset AD patients as compared to cognitively healthy controls. Here we confirm the association of rs908832 with AD in a Western European population (n = 291, P = 0.008). In a second sample from Southern Europe, rs908832 was not associated with AD. Interestingly, rs908832 was not polymorphic in a Japanese sample. Furthermore, rs908832 was not associated with either serum cholesterol levels or with the risk for coronary artery disease, but seemed to be related to cholesterol levels in the cerebrospinal fluid. These data suggest that ABCA2 may exert population-dependent effects on the genetic risk for sporadic AD and support a role of ABC lipid transporters in the pathogenesis of this disease.
Cell signaling mechanisms often transmit information via posttranslational protein modifications, most importantly reversible protein phosphorylation. Here we develop and apply a general mass spectrometric technology for identification and quantitation of phosphorylation sites as a function of stimulus, time, and subcellular location. We have detected 6,600 phosphorylation sites on 2,244 proteins and have determined their temporal dynamics after stimulating HeLa cells with epidermal growth factor (EGF) and recorded them in the Phosida database. Fourteen percent of phosphorylation sites are modulated at least 2-fold by EGF, and these were classified by their temporal profiles. Surprisingly, a majority of proteins contain multiple phosphorylation sites showing different kinetics, suggesting that they serve as platforms for integrating signals. In addition to protein kinase cascades, the targets of reversible phosphorylation include ubiquitin ligases, guanine nucleotide exchange factors, and at least 46 different transcriptional regulators. The dynamic phosphoproteome provides a missing link in a global, integrative view of cellular regulation.
Recent epidemiological, biological and genetic data indicate a relationship between cholesterol and Alzheimer's disease (AD) including the association of polymorphisms of ABCA1 (a gene that is known to participate in cholesterol and phospholipid transport) with AD prevalence. Based on these data, we postulated that genetic variation in the related and brain-specific ABCA2 gene leads to increase risk of AD. A large case-control study was conducted where the sample was randomly divided into a hypothesis-testing sample (230 cases/286 controls) and a validation sample (210 cases/233 controls). Among the 45 SNPs we tested, one synonymous SNP (rs908832) was found significantly associated with AD in both samples. Additional analyses performed on the whole sample showed a very strong association between this marker and early-onset AD (OR = 3.82, 95% C.I. = [2.00 - 7.30], P = 5 x 10(-5)). Further research is needed to understand the functional role of this polymorphism. However, together with the reported associations of AD with APOE, CYP46A1 and ABCA1, the present result adds a very significant support for the role of cholesterol and phospholipid homeostasis in AD and a rationale for testing novel cholesterol homeostasis-related therapeutic strategies in AD.
ABCA2, which belongs to the A subclass of the ATP-binding cassette (ABC) transporter superfamily, is predominantly expressed in the cytoplasm of oligodendrocytes and Schwann cells, the myelin-forming cells in brain and peripheral nerve, respectively. Here, we demonstrate by immunoblot and immunohistochemistry that ABCA2 is expressed in benign vestibular schwannomas, which contain neither axons nor compact myelin. The expression patterns of ABCA2 in combination with other markers showed phenotypic heterogeneity in schwannomas. The majority of cells in fascicular Antoni type A areas coexpressed ABCA2, Ca2+-binding protein S100beta, and p75 nerve growth factor receptor. In contrast, considerably varied expression levels of ABCA2 and p75 were more prominent in hypocellular type B areas than in type A areas. These data suggest that ABCA2 may be useful as a marker for cellular characterization of schwannomas.
BACKGROUND: ABCA2 is a member of the ATP binding cassette transporter family with functional roles in cholesterol homeostasis and drug resistance. MATERIALS AND METHODS: In order to characterize its ATPase activity, we transfected HEK293 cells with an ABCA2 mammalian expression system and isolated ABCA2-enriched membranes. RESULTS: We found no measurable ATPase activity of ABCA2 in isolated membranes, except in the presence of the methyl-beta-cyclodextrin. However, competitive binding of a pseudo-substrate, 8-azido-[alpha-32P]-ATP, was demonstrated. CHO cells transfected with ABCA2 did not have a higher rate of endogenous ATP hydrolysis when compared to the mock-transfected cells. CONCLUSION: Overall, we conclude that, while ABCA2 may have low levels of ATPase activity that can be substrate-stimulated, it is more likely to have a regulatory role in cell physiology.
The human ABCA2 transporter is a member of a large family of ATP-binding proteins that transport a variety of molecules across biological membranes. Using RNA ligation-mediated PCR (RLM-PCR), we have identified a novel first exon, which we designate 1B that is located 699 bp upstream of the previously characterized first exon, which we designate 1A. These first exons are alternatively spliced to the second exon of the ABCA2 transcript resulting in a protein that has a unique amino terminus. For exon 1B, the new amino terminus encoded by the first exon is 52 amino acids and for exon 1A, 22 amino acids. We observed that among adult tissues examined, the highest expression of the 1B isoform was in peripheral blood leukocytes (PBL). Laser scanning confocal microscopy revealed that the 1A isoform and the 1B isoform co-localize with lysosome-associated membrane proteins-1 and -2 (LAMP-1 and -2). Cytotoxicity assays suggested a role for ABCA2 in estramustine and estradiol resistance, and overexpression of ABCA2 is seen in an estramustine-resistant prostate carcinoma line. Since both isoforms of the ABCA2 transporter have identical subcellular localization and both are overexpressed in a resistant cell line, we propose that they are also functionally redundant. It is likely that expression of ABCA2 by two independent promoters constitutes locus of regulation controlling expression of the protein to meet requirements in different tissues.
With the use of a novel method for detecting differential gene expression, alterations in functional gene clusters related to transport or oxidative stress response and beta-amyloid (Abeta) peptide metabolism were identified in a HEK293 cell line engineered to overexpress the human ATP binding cassette transporter ABCA2. These included fatty acid binding protein, phospholipid binding protein, phospholipid synthesis protein, transporter cofactors, seladin-1, Abeta precursor protein (APP), vimentin, and low-density lipoprotein receptor-related protein. ABCA2 was highly expressed in neuroblastoma cells and colocalized with Abeta and APP. Additionally, increased APP protein levels were detected within ABCA2/APP double-transfected cells, and increased Abeta was detected in the media of ABCA2-transfected cells relative to controls. The transporter was abundant in the temporal and frontal regions of both normal and Alzheimer's disease (AD) brain but was detected at lower concentrations in the parietal, occipital, and cerebellar regions. The ABCA2 transfected cell line expressed resistance to a free radical initiator, confirming involvement in protection against reactive oxygen species and suggesting a further possible link to AD.
We present evidence that the ATP binding-cassette transporter-2 (ABCA2) is a sterol-responsive gene that has a role in the trafficking of low-density lipoprotein-derived free cholesterol (LDL-FC). In HepG2 cells ABCA2 was coordinately expressed with other sterol-responsive genes. Stable constitutive expression of ABCA2 in Chinese hamster ovary cells (CHOA2) was accompanied by an increase the expression of the low-density lipoprotein receptor (LDLR) and other genes involved in the regulation of cholesterol homeostasis. LDLR mRNA was elevated greater than ninefold and 3-hydroxy-3-methylglutaryl CoA synthase (HMGCoA S) expression was elevated sevenfold in CHOA2 cells. The increase in LDLR expression was regulated at the level of transcription; however, culture of CHO and CHOA2 cells in medium containing lipoprotein-deficient serum (LPDS) results in similar levels of LDLR promoter expression. No differences were measured in the dose-dependent uptake of fluorescently labeled 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchorate-LDL (DiI-LDL) between CHO and CHOA2 cells cultured in medium containing LPDS. Ultraviolet microscopy revealed a similar distribution of the DiI-LDL label in cytoplasmic vesicles. We measured an LDL dose-dependent reduction in esterification of LDL-FC in intact CHOA2 cells cultured in medium containing LPDS, however, no significant difference was measured in acylcoenzyme A:cholesterol acyltransferase (ACAT) activity in cell-free extracts of CHO and CHOA2 cells. CHO cells or CHOA2 cells treated with the hydrophobic amine, U18666A, showed similar filipin staining of unesterified cholesterol in cytoplasmic vesicles. Addition of progesterone or U18666A to CHO cells elevated ABCA2 expression. Finally, we found that ABCA2 expression was elevated in Niemann-Pick type C1 (NPC1) fibroblasts and in Familial Hypercholesterolemia (FHC) fibroblasts.
Alternative splicing has been recognized as a major mechanism by which protein diversity is increased without significantly increasing genome size in animals and has crucial medical implications, as many alternative splice variants are known to cause diseases. Despite the importance of knowing what structural changes alternative splicing introduces to the encoded proteins for the consideration of its significance, the problem has not been adequately explored. Therefore, we systematically examined the structures of the proteins encoded by the alternative splice variants in the HUGE protein database derived from long (>4 kb) human brain cDNAs. Limiting our analyses to reliable alternative splice junctions, we found alternative splice junctions to have a slight tendency to avoid the interior of SCOP domains and a strong statistically significant tendency to coincide with SCOP domain boundaries. These findings reflect the occurrence of some alternative splicing events that utilize protein structural units as a cassette. However, 50 cases were identified in which SCOP domains are disrupted in the middle by alternative splicing. In six of the cases, insertions are introduced at the molecular surface, presumably affecting protein functions, while in 11 of the cases alternatively spliced variants were found to encode pairs of stable and unstable proteins. The mRNAs encoding such unstable proteins are much less abundant than those encoding stable proteins and tend not to have corresponding mRNAs in non-primate species. We propose that most unstable proteins encoded by alternative splice variants lack normal functions and are an evolutionary dead-end.
The human ABCA2 transporter gene encodes a member of a large family of ATP-binding proteins that transport a variety of macromolecules across biological membranes. We have performed luciferase reporter gene assays with promoter constructs comprising the 5'-flanking region to identify cis-regulatory DNA elements and have mapped the minimal promoter region to 321 bp upstream of the translation start site. We have discovered a functional role for two GC-boxes located in the proximal promoter of the ABCA2 gene that contain overlapping sites for the EGR-1 and Sp1 transcription factors. We observed that oligonucleotides containing overlapping EGR-1/Sp1 sites bind the Sp1, Sp3 and Sp4 transcription factors. When BE(2)-M17 cells were treated with phorbol 12-myristate 13-acetate, we observed inducible expression and binding of the EGR-1 transcription factor to the two GC-boxes. Transfection of Sp1, Sp3 or Sp4 expression constructs into Drosophila S2 induced a dose-dependent increase in transcriptional activation of the ABCA2 promoter, but transfection of EGR-1 alone failed to activate transcription. When increasing amounts of EGR-1 were transfected into the BE(2)-M17 neuroblastoma cells we observed a dose-dependent decrease in expression of the ABCA2 promoter, although expression of the endogenous ABCA2 gene increased following transfection of EGR-1.
PURPOSE: To explore the expression profile of the human lens and to provide a resource for microarray studies, expressed sequence tag (EST) analysis has been performed on cDNA libraries from adult lenses. METHODS: A cDNA library was constructed from two adult (40 year old) human lenses. Over two thousand clones were sequenced from the unamplified, un-normalized library. The library was then normalized and a further 2200 sequences were obtained. All the data were analyzed using GRIST (GRouping and Identification of Sequence Tags), a procedure for gene identification and clustering. RESULTS: The lens library (by) contains a low percentage of non-mRNA contaminants and a high fraction (over 75%) of apparently full length cDNA clones. Approximately 2000 reads from the unamplified library yields 810 clusters, potentially representing individual genes expressed in the lens. After normalization, the content of crystallins and other abundant cDNAs is markedly reduced and a similar number of reads from this library (fs) yields 1455 unique groups of which only two thirds correspond to named genes in GenBank. Among the most abundant cDNAs is one for a novel gene related to glutamine synthetase, which was designated "lengsin" (LGS). Analyses of ESTs also reveal examples of alternative transcripts, including a major alternative splice form for the lens specific membrane protein MP19. Variant forms for other transcripts, including those encoding the apoptosis inhibitor Livin and the armadillo repeat protein ARVCF, are also described. CONCLUSIONS: The lens cDNA libraries are a resource for gene discovery, full length cDNAs for functional studies and microarrays. The discovery of an abundant, novel transcript, lengsin, and a major novel splice form of MP19 reflect the utility of unamplified libraries constructed from dissected tissue. Many novel transcripts and splice forms are represented, some of which may be candidates for genetic diseases.
Studies in the past years have implicated multispan transmembrane transport molecules of the ATP binding cassette (ABC) transporter family in cellular lipid export processes. The prototypic ABC transporter ABCA1 has recently been demonstrated to act as a major facilitator of cellular cholesterol and phospholipid export. Moreover, the transporter ABCA4 (ABCR) plays a pivotal role in retinaldehyde processing, and ABCA3 has recently implicated in lung surfactant processing. These pioneering observations have directed considerable attention to the A subfamily of ABC proteins. ABCA2 is the codefining member of the ABC A-transporter subclass. Although known for some time, it was not until recently that its complete molecular structure was established. Unlike other ABC A-subfamily members, ABCA2 is predominantly expressed in the brain and neural tissues. The unique expression profile together with available structural data suggest roles for this largest known ABC protein in neural transmembrane lipid export.
Large proteins have multiple domains that are potentially capable of binding many kinds of partners. It is conceivable, therefore, that such proteins could function as an intricate framework of assembly protein complexes. To comprehensively study protein-protein interactions between large KIAA proteins, we have constructed a library composed of 1087 KIAA cDNA clones based on prior functional classifications done in silico. We were guided by two principles that raise the success rate for detecting interactions per tested combination: we avoided testing low-probability combinations, and reduced the number of potential false negatives that arise from the fact that large proteins cannot reliably be expressed in yeast. The latter was addressed by constructing a cDNA library comprised of random fragments encoding large proteins. Cytoplasmic domains of KIAA transmembrane proteins (>1000 amino acids) were used as bait for yeast two-hybrid screening. Our analyses reveal that several KIAA proteins bearing a transmembrane region have the capability of binding to other KIAA proteins containing domains (e.g., PDZ, SH3, rhoGEF, and spectrin) known to be localized to highly specialized submembranous sites, indicating that they participate in cellular junction formation, receptor or channel clustering, and intracellular signaling events. Our representative library should be a very useful resource for detecting previously unidentified interactions because it complements conventional expression libraries, which seldom contain large cDNAs.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
Members of the human ABC transporter A subfamily have gained considerable attention based on the recent findings that ABCA1 and ABCR (ABCA4) cause familial HDL-deficiency syndromes and distinct forms of hereditary retinopathies, respectively. Here we report the complete cDNA and the genomic organization of ABCA2, another member of the human ABC A transporter subfamily. The ABCA2 coding region is 7.3 kb in size and codes for a 2436 amino acid polypeptide that bears the typical features of a full-size ABC transporter. Among the known members of the ABC A subfamily ABCA2 shares highest homology with the cholesterol-responsive transporters ABCA1 (50%) and the recently cloned ABCA7 (44%). The ABCA2 gene comprises 48 exons which are localized within a genomic region of only 21 kb. Analysis of the putative ABCA2 promoter sequence revealed potential binding sites for transcription factors that are involved in the differentiation of myeloid and neural cells. Gene expression analysis in human macrophages showed that ABCA2 mRNA is induced during cholesterol import indicating that ABCA2 is a cholesterol-responsive gene. Our results suggest a potential role for ABCA2 in macrophage lipid metabolism and neural development.
We have isolated the full-length cDNA for human ATP-binding cassette, sub-family A, member 2 transporter (ABCA2). The ORF of this cDNA encodes a protein consisting of 2436 amino acids with apparent molecular weight of M(r) 270,000. Accordingly, ABCA2 is the largest known mammalian ABC transporter described thus far. Analysis of mRNA expression levels indicated that ABCA2 is highest in human brain and has a broad expression pattern in a panel of tumor cell lines. Using specific antibodies to ABCA2 and various organelle marker proteins, ABCA2 was found to colocalize with the lysosomal/endosomal marker LAMP1, forming discrete, punctate intracellular vesicles. In ABCA2-transfected cells, the transporter also colocalized with a fluorescently labeled steroid analogue, estramustine. The sequestration of the steroid into the lysosomal/endosomal compartment indicates a potential substrate specificity for ABCA2. Furthermore, the presence of a lipocalin signature motif in the ABCA2 sequence suggests a possible broad role for this protein in the transport of steroids, lipids, and related molecules.
Excessive uptake of atherogenic lipoproteins such as modified low-density lipoprotein complexes by vascular macrophages leads to foam cell formation, a critical step in atherogenesis. Cholesterol efflux mediated by high-density lipoproteins (HDL) constitutes a protective mechanism against macrophage lipid overloading. The molecular mechanisms underlying this reverse cholesterol transport process are currently not fully understood. To identify effector proteins that are involved in macrophage lipid uptake and release, we searched for genes that are regulated during lipid influx and efflux in human macrophages using a differential display approach. We report here that the ATP-binding cassette (ABC) transporter ABCG1 (ABC8) is induced in monocyte-derived macrophages during cholesterol influx mediated by acetylated low-density lipoprotein. Conversely, lipid efflux in cholesterol-laden macrophages, mediated by the cholesterol acceptor HDL(3), suppresses the expression of ABCG1. Immunocytochemical and flow cytometric analyses revealed that ABCG1 is expressed on the cell surface and in intracellular compartments of cholesterol-laden macrophages. Inhibition of ABCG1 protein expression using an antisense strategy resulted in reduced HDL(3)-dependent efflux of cholesterol and choline-phospholipids. In a comprehensive analysis of the expression and regulation of all currently known human ABC transporters, we identified an additional set of ABC genes whose expression is regulated by cholesterol uptake or HDL(3)-mediated lipid release, suggesting a potential function for these transporters in macrophage lipid homeostasis. Our results demonstrating a regulator function for ABCG1 in cholesterol and phospholipid transport define a biologic activity for ABC transporters in macrophages.
The ABC1 (ABCA) subfamily of the ATP-binding cassette (ABC) transporter superfamily has a structural feature that distinguishes it from other ABC transporters. Here we report the cloning, molecular characterization and tissue distribution of ABC2/ABCA2, which belongs to the ABC1 subfamily. Rat ABC2 is a protein of 2434 amino acids that has 44.5%, 40.0% and 40.8% identity with mouse ABC1/ABCA1, human ABC3/ABCA3 and human ABCR/ABCA4 respectively. Immunoblot analysis showed that proteins of 260 and 250 kDa were detected in COS-1 cells transfected with ABC2 having a haemagglutinin tag, while no band was detected in mock-transfected cells. After incubation with N-glycosidase F, the mobilities of the two proteins increased and a single band was detected, suggesting that ABC2 is a glycoprotein. Photoaffinity labelling with 8-azido-[alpha-(32)P]ATP confirmed that ATP binds to the ABC2 protein in the presence of Mg(2+). RNA blot analysis showed that ABC2 mRNA is most abundant in rat brain. Examination of brain by in situ hybridization determined that ABC2 is expressed at high levels in the white matter, indicating that it is expressed in the oligodendrocytes. ABC2, therefore, is a glycosylated ABC transporter protein, and may play an especially important role in the brain. In addition, the N-terminal 60-amino-acid sequence of the human ABC1, which was missing from previous reports, has been determined.
To extend our cDNA project for accumulating basic information on unidentified human genes, we newly determined the sequences of 100 cDNA clones from a set of size-fractionated human adult and fetal brain cDNA libraries, and predicted the coding sequences of the corresponding genes, named KIAA1019 to KIAA1118. The sequencing of these clones revealed that the average size of the inserts and corresponding open reading frames were 5.0 kb and 2.6 kb (880 amino acid residues), respectively. Database search of the predicted amino acid sequences classified 58 predicted gene products into the five functional categories, such as cell signaling/communication, cell structure/motility, nucleic acid management, protein management and cell division. It was also found that, for 34 gene products, homologues were detected in the databases, which were similar in sequence through almost the entire regions. The chromosomal locations of the genes were determined by using human-rodent hybrid panels unless their mapping data were already available in the public databases. The expression profiles of all the genes among 10 human tissues, 8 brain regions (amygdala, corpus callosum, cerebellum, caudate nucleus, hippocampus, substania nigra, subthalamic nucleus, and thalamus), spinal cord, fetal brain and fetal liver were also examined by reverse transcription-coupled polymerase chain reaction, products of which were quantified by enzyme-linked immunosorbent assay.
Analysis of the human expressed sequence tag (EST) database identified four clones that contain sequences of previously uncharacterized genes, members of the ATP-binding cassette (ABC) superfamily. Two new ABC genes (EST20237, 31252) are located at Chromosome (Chr) 1q42 and 1q25 respectively in humans, as determined by FISH; at locations distinct from previously mapped genes of this superfamily. Two additional clones, EST 600 and EST 1596, were found to represent different ATP-binding domains of the same gene, ABC2. This gene was localized to 9q34 in humans by FISH and to the proximal region of Chr 2 in mice by linkage analysis. All genes display extensive diversity in sequence and expression pattern. We present several approaches to characterizing EST clones and demonstrate that the analysis of EST clones from different tissues is a powerful approach to identify new members of important gene families. Some drawbacks of using EST databases, including chimerism of cDNA clones, are discussed.
The family of ATP binding cassette (ABC) transporters or traffic ATPases is composed of several membrane-associated proteins that transport a great variety of solutes across cellular membranes. Two novel mammalian members of the family, ABC1 and ABC2, have been identified by a PCR-based approach. They belong to a group of traffic ATPases encoded as a single multifunctional protein, such as CFTR, STE 6, and P-glycoproteins. Their peculiar structural features and close relationship to ABC transporters involved in nodulation suggest that ABC1 and ABC2 define a novel subgroup of mammalian traffic ATPases.
We recently described a new approach for the rapid characterization of expressed genes by partial DNA sequencing to generate 'expressed sequence tags'. From a set of 600 human brain complementary DNA clones, 348 were informative nuclear-encoded messenger RNAs. We have now partially sequenced 2,672 new, independent cDNA clones isolated from four human brain cDNA libraries to generate 2,375 expressed sequence tags to nuclear-encoded genes. These sequences, together with 348 brain expressed sequence tags from our previous study, comprise more than 2,500 new human genes and 870,769 base pairs of DNA sequence. These data represent an approximate doubling of the number of human genes identified by DNA sequencing and may represent as many as 5% of the genes in the human genome.

