ABCA2 | GeneID:20 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 20 Official Symbol ABCA2
Locus RP11-229P13.8 Gene Type protein-coding
Synonyms ABC2; MGC129761
Full Name ATP-binding cassette, sub-family A (ABC1), member 2
Description ATP-binding cassette, sub-family A (ABC1), member 2
Chromosome 9q34
Also Known As ATP-binding cassette, sub-family A, member 2; OTTHUMP00000064733
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is highly expressed in brain tissue and may play a role in macrophage lipid metabolism and neural development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55590

ID Symbol Protein Species
GeneID:20 ABCA2 NP_001597.2 Homo sapiens
GeneID:11305 Abca2 NP_031405.2 Mus musculus
GeneID:79248 Abca2 NP_077372.1 Rattus norvegicus
GeneID:480669 ABCA2 XP_537788.2 Canis lupus familiaris

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 scbt ABCA2 ABCA2 Antibody / ABCA2 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCA2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCA2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0043190 Component ATP-binding cassette (ABC) transporter complex
GO:0016023 Component cytoplasmic membrane-bounded vesicle
GO:0016021 Component integral to membrane
GO:0005765 Component lysosomal membrane
GO:0016020 Component membrane
GO:0005815 Component microtubule organizing center
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0042632 Process cholesterol homeostasis
GO:0006629 Process lipid metabolic process
GO:0032383 Process regulation of intracellular cholesterol transport
GO:0006357 Process regulation of transcription from RNA polymerase II promoter
GO:0042493 Process response to drug
GO:0048545 Process response to steroid hormone stimulus
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001606  UCSC Browser NP_001597
2 NM_212533  UCSC Browser NP_997698

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000355090 MI0000066 hsa-let-7e* CUAUACGGCCUCCUAGCUUUCC
ENST00000355090 MI0000433 hsa-let-7g* CUGUACAGGCCACUGCCUUGC
ENST00000355090 MI0000446 hsa-miR-125b-1* ACGGGUUAGGCUCUUGGGAGCU
ENST00000355090 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000355090 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000355090 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENST00000355090 MI0000456 hsa-miR-140-3p UACCACAGGGUAGAACCACGG
ENST00000355090 MI0000478 hsa-miR-149 UCUGGCUCCGUGUCUUCACUCCC
ENST00000355090 MI0000482 hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENST00000355090 MI0000234 hsa-miR-192 CUGACCUAUGAAUUGACAGCC
ENST00000355090 MI0000298 hsa-miR-221* ACCUGGCAUACAAUGUAGAUUU
ENST00000355090 MI0000080 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000355090 MI0000081 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000355090 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENST00000355090 MI0003646 hsa-miR-33b* CAGUGCCUCGGCAGUGCAGCCC
ENST00000355090 MI0000268 hsa-miR-34a UGGCAGUGUCUUAGCUGGUUGU
ENST00000355090 MI0001648 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENST00000355090 MI0003673 hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
ENST00000355090 MI0003135 hsa-miR-495 AAACAAACAUGGUGCACUUCUU
ENST00000355090 MI0003579 hsa-miR-572 GUCCGCUCGGCGGUGGCCCA
ENST00000355090 MI0003637 hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU
ENST00000355090 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENST00000355090 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENST00000355090 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENST00000355090 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENST00000355090 MI0003760 hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC
ENST00000355090 MI0000263 hsa-miR-7-1* CAACAAAUCACAGUCUGCCAUA
ENST00000355090 MI0005559 hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENST00000355090 MI0005567 hsa-miR-760 CGGCUCUGGGUCUGUGGGGA
ENST00000355090 MI0005527 hsa-miR-886-5p CGGGUCGGAGUUAGCUCAAGCGG
ENST00000355090 MI0005763 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000355090 MI0005764 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000355090 MI0005765 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000355090 MI0005766 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000355090 MI0005767 hsa-miR-942 UCUUCUCUGUUUUGGCCAUGUG
ENST00000355090 MI0001526 mmu-miR-434-3p UUUGAACCAUCACUCGACUCCU
ENST00000355090 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENST00000355090 MI0004707 mmu-miR-718 CUUCCGCCCGGCCGGGUGUCG
ENST00000355090 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC
ENST00000355090 MI0005472 mmu-miR-879 AGAGGCUUAUAGCUCUAAGCC
ENST00000371605 MI0000266 hsa-miR-10a UACCCUGUAGAUCCGAAUUUGUG
ENST00000371605 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENST00000371605 MI0000084 hsa-miR-26b* CCUGUUCUCCAUUACUUGGCUC
ENST00000371605 MI0000812 hsa-miR-331-3p GCCCCUGGGCCUAUCCUAGAA
ENST00000371605 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENST00000371605 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENST00000371605 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENST00000371605 MI0004700 mmu-miR-715 CUCCGUGCACACCCCCGCGUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAA84436   AAA84437   AAG09372   AAH08755   AAH64542   AAI09245   AAI72448   AAK14334   AAK14335   BAA83014   BAD66832   BAG58411   CAB82398   CAI12765   CAI12766   CAI12767   CAI12768   CAI12769   CAI12770   EAW88331   EAW88332   EAW88333   NP_001597   NP_997698   Q08EJ9   Q13038   Q13039   Q5SPY4   Q5SPZ4   Q5SPZ6   Q6P2G5   Q96HC2   Q9BZC7   Q9HC28   Q9UPU0  

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
nitrosobenzylmethylamine
  • nitrosobenzylmethylamine results in decreased expression of ABCA2 mRNA
17616710

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Esophageal Neoplasms inferred via nitrosobenzylmethylamine 16805852, 16510608, 15547733, 16704527, 15547721, 15623463, 15150132, 15264214, 15878914
Stomach Neoplasms inferred via nitrosobenzylmethylamine 17575124, 12958204

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Minster RL, et al. (2008) "No association of DAPK1 and ABCA2 SNPs on chromosome 9 with Alzheimer's disease." Neurobiol Aging. ():. PMID:18336955
  3. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  4. [ + ] Wollmer MA, et al. (2006) "Ethnicity-dependent genetic association of ABCA2 with sporadic Alzheimer's disease." Am J Med Genet B Neuropsychiatr Genet. 141B(5):534-536. PMID:16752360
  5. [ + ] Olsen JV, et al. (2006) "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell. 127(3):635-648. PMID:17081983
  6. [ + ] Mace S, et al. (2005) "ABCA2 is a strong genetic risk factor for early-onset Alzheimer's disease." Neurobiol Dis. 18(1):119-125. PMID:15649702
  7. [ + ] Wang Y, et al. (2005) "Expression of ABCA2 protein in human vestibular schwannoma and peripheral nerve." J Neurol Sci. 232(1-2):59-63. PMID:15850583
  8. [ + ] Beljanski V, et al. (2005) "Characterization of the ATPase activity of human ATP-binding cassette transporter-2 (ABCA2)." In Vivo. 19(4):657-660. PMID:15999530
  9. [ + ] Ile KE, et al. (2004) "Identification of a novel first exon of the human ABCA2 transporter gene encoding a unique N-terminus." Biochim Biophys Acta. 1678(1):22-32. PMID:15093135
  10. [ + ] Chen ZJ, et al. (2004) "Association of ABCA2 expression with determinants of Alzheimer's disease." FASEB J. 18(10):1129-1131. PMID:15155565
  11. [ + ] Davis W Jr, et al. (2004) "Human ATP-binding cassette transporter-2 (ABCA2) positively regulates low-density lipoprotein receptor expression and negatively regulates cholesterol esterification in Chinese hamster ovary cells." Biochim Biophys Acta. 1683(1-3):89-100. PMID:15238223
  12. [ + ] Homma K, et al. (2004) "Alternative splice variants encoding unstable protein domains exist in the human brain." J Mol Biol. 343(5):1207-1220. PMID:15491607
  13. [ + ] Davis W Jr, et al. (2003) "Reciprocal regulation of expression of the human adenosine 5'-triphosphate binding cassette, sub-family A, transporter 2 (ABCA2) promoter by the early growth response-1 (EGR-1) and Sp-family transcription factors." Nucleic Acids Res. 31(3):1097-1107. PMID:12560508
  14. [ + ] Wistow G, et al. (2002) "Expressed sequence tag analysis of adult human lens for the NEIBank Project: over 2000 non-redundant transcripts, novel genes and splice variants." Mol Vis. 8():171-184. PMID:12107413
  15. [ + ] Schmitz G, et al. (2002) "ABCA2: a candidate regulator of neural transmembrane lipid transport." Cell Mol Life Sci. 59(8):1285-1295. PMID:12363033
  16. [ + ] Nakayama M, et al. (2002) "Protein-protein interactions between large proteins: two-hybrid screening using a functionally classified library composed of long cDNAs." Genome Res. 12(11):1773-1784. PMID:12421765
  17. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  18. [ + ] Kaminski WE, et al. (2001) "Complete coding sequence, promoter region, and genomic structure of the human ABCA2 gene and evidence for sterol-dependent regulation in macrophages." Biochem Biophys Res Commun. 281(1):249-258. PMID:11178988
  19. [ + ] Vulevic B, et al. (2001) "Cloning and characterization of human adenosine 5'-triphosphate-binding cassette, sub-family A, transporter 2 (ABCA2)." Cancer Res. 61(8):3339-3347. PMID:11309290
  20. [ + ] Klucken J, et al. (2000) "ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport." Proc Natl Acad Sci U S A. 97(2):817-822. PMID:10639163
  21. [ + ] Zhao LX, et al. (2000) "Cloning, characterization and tissue distribution of the rat ATP-binding cassette (ABC) transporter ABC2/ABCA2." Biochem J. 350 Pt 3():865-872. PMID:10970803
  22. [ + ] Kikuno R, et al. (1999) "Prediction of the coding sequences of unidentified human genes. XIV. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro." DNA Res. 6(3):197-205. PMID:10470851
  23. [ + ] Allikmets R, et al. (1995) "Characterization and mapping of three new mammalian ATP-binding transporter genes from an EST database." Mamm Genome. 6(2):114-117. PMID:7766993
  24. [ + ] Luciani MF, et al. (1994) "Cloning of two novel ABC transporters mapping on human chromosome 9." Genomics. 21(1):150-159. PMID:8088782
  25. [ + ] Adams MD, et al. (1992) "Sequence identification of 2,375 human brain genes." Nature. 355(6361):632-634. PMID:1538749