Abcd3 | GeneID:19299 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 19299 Official Symbol Abcd3
Locus N/A Gene Type protein-coding
Synonyms AI313901; AU018866; AW146054; PMP68; PMP70; Pxmp1
Full Name ATP-binding cassette, sub-family D (ALD), member 3
Description ATP-binding cassette, sub-family D (ALD), member 3
Chromosome 3 G-H1|3 56.6 cM
Also Known As ATP-binding cassette, sub-family D, member 3; peroxisomal membrane protein 1; peroxisomal membrane protein, 70 kDa
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein likely plays an important role in peroxisome biogenesis. Mutations have been associated with some forms of Zellweger syndrome, a heterogeneous group of peroxisome assembly disorders. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 2140

ID Symbol Protein Species
GeneID:5825 ABCD3 NP_002849.1 Homo sapiens
GeneID:19299 Abcd3 NP_033017.2 Mus musculus
GeneID:25270 Abcd3 NP_036936.1 Rattus norvegicus
GeneID:32992 CG12703 NP_608354.1 Drosophila melanogaster
GeneID:174126 pmp-1 NP_495407.1 Caenorhabditis elegans
GeneID:174127 pmp-2 NP_495408.1 Caenorhabditis elegans
GeneID:406803 abcd3a NP_998647.1 Danio rerio
GeneID:424487 ABCD3 NP_001012615.1 Gallus gallus
GeneID:457037 ABCD3 XP_513575.2 Pan troglodytes
GeneID:479939 ABCD3 XP_537064.2 Canis lupus familiaris
GeneID:526059 ABCD3 XP_604418.3 Bos taurus
GeneID:830144 PXA1 NP_568072.1 Arabidopsis thaliana
GeneID:1271802 AgaP_AGAP000440 XP_310656.2 Anopheles gambiae
GeneID:4337574 Os05g0107600 NP_001054425.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab28499 PMP70 antibody (Biotin) (ab28499); Rabbit polyclonal to PMP70 - Peroxisomal Membrane Marker (Biotin)
2 abcam ab3421 PMP70 antibody - Peroxisomal Membrane Marker (ab3421); Rabbit polyclonal to PMP70 - Peroxisomal Membrane Marker
3 sigma P0497 Anti-PMP70 antibody produced in rabbit ;
4 sigma P0090 Anti-PMP70−Atto 488 antibody produced in rabbit ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005743 Component mitochondrial inner membrane
GO:0005739 Component mitochondrion
GO:0005778 Component peroxisomal membrane
GO:0005777 Component peroxisome
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_008991  UCSC Browser NP_033017

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000029770 MI0000165 mmu-miR-140* UACCACAGGGUAGAACCACGG
ENSMUST00000029770 MI0000399 mmu-miR-299* UGGUUUACCGUCCCACAUACAU
ENSMUST00000029770 MI0003717 mmu-miR-302c AAGUGCUUCCAUGUUUCAGUGG
ENSMUST00000029770 MI0000640 mmu-miR-350 UUCACAAAGCCCAUACACUUUC
ENSMUST00000029770 MI0000768 mmu-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSMUST00000029770 MI0001645 mmu-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSMUST00000029770 MI0001146 mmu-miR-384-3p AUUCCUAGAAAUUGUUCACAAU
ENSMUST00000029770 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSMUST00000029770 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSMUST00000029770 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSMUST00000029770 MI0002406 mmu-miR-471 UACGUAGUAUAGUGCUUUUCAC
ENSMUST00000029770 MI0003518 mmu-miR-540-3p AGGUCAGAGGUCGAUCCUGG
ENSMUST00000029770 MI0004652 mmu-miR-687 CUAUCCUGGAAUGCAGCAAUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAA39958   AAC02967   AAH09119   AAH54446   BAB23450   BAE25677   BAE31880   CAA61748   EDL12331   EDL12332   NP_033017   P55096   Q3U645   Q3UNS0   Q71V77   Q91VT3   Q9DBZ6  

Mutations and SNPs

[ - ] NCBI's dbSNP

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
Abcd1 Abcd1 / Abcd3 Affinity Capture-Western Liu LX (1999)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Hirai T, et al. (2007) "PPARalpha agonists positively and negatively regulate the expression of several nutrient/drug transporters in mouse small intestine." Biol Pharm Bull. 30(11):2185-2190. PMID:17978498
  2. [ + ] Lee J, et al. (2007) "Mitochondrial phosphoproteome revealed by an improved IMAC method and MS/MS/MS." Mol Cell Proteomics. 6(4):669-676. PMID:17208939
  3. [ + ] Kim SC, et al. (2006) "Substrate and functional diversity of lysine acetylation revealed by a proteomics survey." Mol Cell. 23(4):607-618. PMID:16916647
  4. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  5. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  6. [ + ] Guimaraes CP, et al. (2004) "Mouse liver PMP70 and ALDP: homomeric interactions prevail in vivo." Biochim Biophys Acta. 1689(3):235-243. PMID:15276650
  7. [ + ] Watahiki A, et al. (2004) "Libraries enriched for alternatively spliced exons reveal splicing patterns in melanocytes and melanomas." Nat Methods. 1(3):233-239. PMID:15782199
  8. [ + ] Kikuchi M, et al. (2004) "Proteomic analysis of rat liver peroxisome: presence of peroxisome-specific isozyme of Lon protease." J Biol Chem. 279(1):421-428. PMID:14561759
  9. [ + ] Ilieva HS, et al. (2003) "Age-related changes in peroxisomal membrane protein 70 and superoxide dismutase 1 in transgenic G93A mice." Neurol Res. 25(4):423-426. PMID:12870272
  10. [ + ] Mootha VK, et al. (2003) "Integrated analysis of protein composition, tissue diversity, and gene regulation in mouse mitochondria." Cell. 115(5):629-640. PMID:14651853
  11. [ + ] Brites P, et al. (2003) "Impaired neuronal migration and endochondral ossification in Pex7 knockout mice: a model for rhizomelic chondrodysplasia punctata." Hum Mol Genet. 12(18):2255-2267. PMID:12915479
  12. [ + ] Da Cruz S, et al. (2003) "Proteomic analysis of the mouse liver mitochondrial inner membrane." J Biol Chem. 278(42):41566-41571. PMID:12865426
  13. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  14. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  15. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  16. [ + ] Hu B, et al. (2001) "The paralemmin protein family: identification of paralemmin-2, an isoform differentially spliced to AKAP2/AKAP-KL, and of palmdelphin, a more distant cytosolic relative." Biochem Biophys Res Commun. 285(5):1369-1376. PMID:11478809
  17. [ + ] Schriml LM, et al. (2000) "Identification of 18 mouse ABC genes and characterization of the ABC superfamily in Mus musculus." Genomics. 64(1):24-31. PMID:10708515
  18. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  19. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  20. [ + ] Tanaka TS, et al. (2000) "Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray." Proc Natl Acad Sci U S A. 97(16):9127-9132. PMID:10922068
  21. [ + ] Ko MS, et al. (2000) "Large-scale cDNA analysis reveals phased gene expression patterns during preimplantation mouse development." Development. 127(8):1737-1749. PMID:10725249
  22. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  23. [ + ] Liu LX, et al. (1999) "Homo- and heterodimerization of peroxisomal ATP-binding cassette half-transporters." J Biol Chem. 274(46):32738-32743. PMID:10551832
  24. [ + ] Berger J, et al. (1999) "The four murine peroxisomal ABC-transporter genes differ in constitutive, inducible and developmental expression." Eur J Biochem. 265(2):719-727. PMID:10504404
  25. [ + ] Gartner J, et al. (1998) "Genomic organization of the 70-kDa peroxisomal membrane protein gene (PXMP1)." Genomics. 48(2):203-208. PMID:9521874
  26. [ + ] Savary S, et al. (1997) "Chromosomal localization of the adrenoleukodystrophy-related gene in man and mice." Eur J Hum Genet. 5(2):99-101. PMID:9195160
  27. [ + ] Baes M, et al. (1997) "A mouse model for Zellweger syndrome." Nat Genet. 17(1):49-57. PMID:9288097
  28. [ + ] Chen N, et al. (1995) "Peroxisomal membrane protein PMP68 of mouse liver: cloning of a cDNA encompassing the nucleotide binding fold and epitope mapping of monoclonal antibodies to the expressed protein." Arch Biochem Biophys. 321(2):526-530. PMID:7544098
  29. [ + ] Bryant DD, et al. (1995) "Differential evolution and expression of murine peroxisomal membrane protein genes." Biochem Mol Med. 55(1):22-30. PMID:7551822
  30. [ + ] Hamel CP, et al. (1994) "The gene for the retinal pigment epithelium-specific protein RPE65 is localized to human 1p31 and mouse 3." Genomics. 20(3):509-512. PMID:8034329
  31. [ + ] Taguchi T, et al. (1993) "Chromosomal localization of the Ox-44 (CD53) leukocyte antigen gene in man and rodents." Cytogenet Cell Genet. 64(3-4):217-221. PMID:8404042
  32. [ + ] Gartner J, et al. (1993) "Localization of the 70-kDa peroxisomal membrane protein to human 1p21-p22 and mouse 3." Genomics. 15(2):412-414. PMID:8449508